Welcome to Michael’s Domain! on Michael’s Domain

Courses I teach

Fri, 26 Jan 2024 00:00:00 +0000

IN RED - as (one of the) responsible teacher(s); * - as course developer

Current wet lab teaching
*DPDR-305 (1 ECTS) Purification of Recombinant Proteins and Protein Drugs by FPLC Introduction Methods Protein tags PROV-004 (5 ECTS) Introduction to cell and molecular biology methods Alternative assignment: Expression, purification and functional testing of Phusion polymerase Practical: PCR Work PROV-410* (4 ECTS)** Recombinant DNA technology in therapeutic protein engineering - laboratory work

Current wet lab teaching

DPDR-305* (1 ECTS) Purification of Recombinant Proteins and Protein Drugs by FPLC
PROV-004 (5 ECTS) Introduction to cell and molecular biology methods
- Alternative assignment: Expression, purification and functional testing of Phusion polymerase
- Practical: PCR Work
PROV-410* (4 ECTS) Recombinant DNA technology in therapeutic protein engineering - laboratory work

Current courses
FARM-310 (5 ECTS) Biopharmaceuticals, basic course Luento #3: Terapeuttiset proteiinit I: Insuliinit ja insuliinianalogit Lecture #3: Therapeutic proteins I: Insulin ja insulin analogs Luento #4: Terapeuttiset proteiinit II: Erytropoietiini, interferonit, & G-CSF Lecture #4: Therapeutic proteins II: Erythropoietin, interferons, & G-CSF Luennot #5+#6: Terapeuttiset proteiinit III: Vasta-aineet ja fuusioproteiinit Lectures #5+#6: Therapeutic proteins III: Antibodies and fusion proteins PROV-004 (5 ECTS) Introduction to cell and molecular biology methods Lecture #1: Alternative Assignment: Protein Production & Purification Lecture #2: Protein Purification Methods Lecture #3: Protein Purification Tags Lecture #4: PCR lecture *PROV-409 (1 ECTS) Recombinant DNA technology in therapeutic protein engineering - lecture & exercise course Session #1: Introduction to Recombinant DNA Technology: Restriction Enzymes, PCR, Plasmids, Transformation Session #2: Multifragment assembly (“Gibson” and similar), Golden Gate, mutagenesis methods, CRISPR/Cas systems Session #3: Databases, sequences, software, bioinformatics for your cloning Session #4: Vectors and systems for protein expression Session #5: How to make transgenic organisms and recombinant viruses PROV-216 (5 ECTS) Molecular Pharmacology VEGFs and VEGF receptors PROV-204 (5 ECTS) Biological Drugs II Antibodies, antibody fusions and antibody conjugates as drugs TMED-929* (1-2 ECTS) Drug discovery & development with a focus on biologics Introductory lecture Protein drugs group work kick-off Vaccines, vaccine development & biological warfare: The smallpox vaccine Challenges in formulation, production and quality control Evidence-based medicine, science-based medicine, and complementary and alternative medicine PROV-303 (5 ECTS) Advanced Biopharmaceutics Session #6: Biological barriers: The blood brain barrier Session #8: Recombinant DNA Technology (aka “cloning”) is the starting point for nearly every biological drug …and much more Session #9: Transgenic animals: For drug production, generating human antibodies and making animal models of human diseases Session #10: Protein Drugs: Engineering and Case Studies GMB-401 (5-10 ECTS) Integrative health biosciences Clinical Trials MPHARM-002A/PROV-105A (11 ECTS) Drug development and preclinical evaluation Discovery, Development and Optimization of Protein Drugs MPHARM-002B/PROV-105B (11 ECTS) Pharmaceutical product development and rational use of medicines Biophamaceuticals - Challenges in formulation, production and quality control MPHARM-009 (5 ECTS) Introduction to research methods in drug discovery and development – theory Plans for the future… Protein production and purification Stable cell line generation FARM-314 (5 ECTS)** Medicinal preparations I Basic Issues in the Formulation of Biophamaceuticals

Current courses

FARM-310 (5 ECTS) Biopharmaceuticals, basic course
- Luento #3: Terapeuttiset proteiinit I: Insuliinit ja insuliinianalogit Lecture #3: Therapeutic proteins I: Insulin ja insulin analogs
- Luento #4: Terapeuttiset proteiinit II: Erytropoietiini, interferonit, & G-CSF Lecture #4: Therapeutic proteins II: Erythropoietin, interferons, & G-CSF
- Luennot #5+#6: Terapeuttiset proteiinit III: Vasta-aineet ja fuusioproteiinit Lectures #5+#6: Therapeutic proteins III: Antibodies and fusion proteins
PROV-004 (5 ECTS) Introduction to cell and molecular biology methods
- Lecture #1: Alternative Assignment: Protein Production & Purification
- Lecture #2: Protein Purification Methods
- Lecture #3: Protein Purification Tags
- Lecture #4: PCR lecture
PROV-409* (1 ECTS) Recombinant DNA technology in therapeutic protein engineering - lecture & exercise course
- Session #1: Introduction to Recombinant DNA Technology: Restriction Enzymes, PCR, Plasmids, Transformation
- Session #2: Multifragment assembly (“Gibson” and similar), Golden Gate, mutagenesis methods, CRISPR/Cas systems
- Session #3: Databases, sequences, software, bioinformatics for your cloning
- Session #4: Vectors and systems for protein expression
- Session #5: How to make transgenic organisms and recombinant viruses
PROV-216 (5 ECTS) Molecular Pharmacology
- VEGFs and VEGF receptors
PROV-204 (5 ECTS) Biological Drugs II
- Antibodies, antibody fusions and antibody conjugates as drugs
TMED-929* (1-2 ECTS) Drug discovery & development with a focus on biologics
PROV-303 (5 ECTS) Advanced Biopharmaceutics
GMB-401 (5-10 ECTS) Integrative health biosciences
- Clinical Trials
MPHARM-002A/PROV-105A (11 ECTS) Drug development and preclinical evaluation
- Discovery, Development and Optimization of Protein Drugs
MPHARM-002B/PROV-105B (11 ECTS) Pharmaceutical product development and rational use of medicines
- Biophamaceuticals - Challenges in formulation, production and quality control
MPHARM-009 (5 ECTS) Introduction to research methods in drug discovery and development – theory
FARM-314 (5 ECTS) Medicinal preparations I
- Basic Issues in the Formulation of Biophamaceuticals

Teaching Videos
2025 Biologiset Lääkkeet (in Finnish) (Unitube) Biologiset lääkkeet: Intro ja historia Linkki Biologiset lääkkeet: Tuotanto, stabiilius, säilytys ja käsittely Linkki Biologiset lääkkeet - Biosimilaarit, biobetterit ja lainsäädäntö Linkki Esimerkkejä biologisista lääkkeistä Biologiset lääkkeet - Metaboliset sairaudet Linkki Biologiset lääkkeet - Syövän hoitoon tarkoitetut vasta-aineet Linkki Biologiset lääkkeet - Vasta-ainekonjugaatit Linkki Biologiset lääkkeet - Bispesifiset vasta-aineet Linkki Biologiset lääkkeet - Vasta-aineet Alzheimerin taudin hoitoon Linkki Biologiset lääkkeet - Tulevaisuus Linkki

Teaching Videos

2025 Biologiset Lääkkeet (in Finnish) (Unitube)
1. Biologiset lääkkeet: Intro ja historia Linkki
2. Biologiset lääkkeet: Tuotanto, stabiilius, säilytys ja käsittely Linkki
3. Biologiset lääkkeet - Biosimilaarit, biobetterit ja lainsäädäntö Linkki
Esimerkkejä biologisista lääkkeistä
1. Biologiset lääkkeet - Metaboliset sairaudet Linkki
2. Biologiset lääkkeet - Syövän hoitoon tarkoitetut vasta-aineet Linkki
3. Biologiset lääkkeet - Vasta-ainekonjugaatit Linkki
4. Biologiset lääkkeet - Bispesifiset vasta-aineet Linkki
5. Biologiset lääkkeet - Vasta-aineet Alzheimerin taudin hoitoon Linkki
1. Biologiset lääkkeet - Tulevaisuus Linkki

Previous wetlab teaching
2014 - 2019 DPBM-135 Purification and Characterization of Recombinant Proteins (organized yearly until Covid-19) 2015 2017 2015 - 2017 DPBM Cloning Club (wetlab part) 2014 DPBM Practical Molecular Biology and Genetic Engineering (wetlab part) 2010 HBGS Tags in protein expression, detection and purification

Previous courses
2018-2022 DPBM-119 Protein Interaction Biochemistry 2018 Cell-based assays for protein interaction detection & quantification 2022 Cell-based assays for protein interaction detection & quantification 2017 DBPM CancerBio Summer School A short histrory of antiangiogenic tumor treatment 2014 DPBM Practical Molecular Biology and Genetic Engineering (lecture part) 2011 Lymphatic Research lecture series (six lectures) Lecture #1: Introduction to Lymphatic Research

Previous courses

2018-2022 DPBM-119 Protein Interaction Biochemistry
- 2018 Cell-based assays for protein interaction detection & quantification
- 2022 Cell-based assays for protein interaction detection & quantification
2017 DBPM CancerBio Summer School
- A short histrory of antiangiogenic tumor treatment
2014 DPBM Practical Molecular Biology and Genetic Engineering (lecture part)
2011 Lymphatic Research lecture series (six lectures)
- Lecture #1: Introduction to Lymphatic Research

Workshops
2015 - 2017 DPBM Cloning Club (workshop part)

Adding "Add to calendar" buttons for multiple targets (Google, Outlook, iCal) to an email invitation

Sat, 11 Jul 2026 00:00:00 +0000

This is more work than it should be in 2026. These were the first instructions that worked for me: https://www.litmus.com/blog/how-to-create-an-add-to-calendar-link-for-your-emails/ . The instructions essentially use hand-written code (and code generated with Amit Agarwal’s Calendar Links tool ( https://www.labnol.org/apps/calendar.html ).

Inauguration of the new professors

Thu, 28 May 2026 00:00:00 +0000

We - the new professors in the Faculty of Pharmacy at the University of Helsinki - gave our inaugural lectures yesterday!

Angiogenic doping - doable and difficult to detect

Thu, 21 May 2026 00:00:00 +0000

Less than 1% of athletes test positive for doping in typical world-class events (World Championships, Olympics). However, we know that at least 70% of the athletes are doping . How do we explain this discrepancy? My lab does angiogenesis research, i.e., we study the growth of blood and lymphatic vessels. Ever since the discovery of VEGF-B by Birgitta Olofsson and Ulf Eriksson in 1996 , I suspected that VEGFs could make for good doping agents, sooner or later. Anti-doping research in endurance sports has focused on blood and red blood cells (RBCs). Erythropoietin (EPO) doping shows how important the RBCs are. But considering the basic mathematical equation “concentration = mass divided by volume” tells us immediately that you can increase the RBC mass without increasing the RBC concentration by increasing the blood volume. Unsurprisingly, blood volume is very important for endurance performance, perhaps even more so than RBC concentration. This can be seen in “sports (pseudo)anemia”, where some athletes have a relatively low hemoglobin concentration despite unimpaired performance. What is the upper limit of the blood volume? And would it be possible to increase the upper limit by growing more blood vessels? We discuss Angiogenic Doping in our latest publication in Sports Medicine . Our hypothesis is that angiogenic doping might already be in use without any good possibility for WADA to detect it. VEGF growth factors are likely not yet used because their application requires advanced medical technologies that only a few laboratories can provide. However, there are quite a few small molecules that can be slowly up- and microdosed to stimulate both angiogenesis and RBC production in sync, thus avoiding major impacts on the athlete’s biological passport. Thanks go to Sofie Lehto, who laid the groundwork for this study, and to doping researcher and sports physician Sergei Iljukov for continuing to work on this side project with me over the last two years.

Vantaa Blue

Fri, 15 May 2026 00:00:00 +0000

Swedish Blue Stone is a synthetic jewelry stone made from blast-furnace slag. They were not made on purpose, but have been cast away as a byproduct of metal ore smelting during the last centuries. While in Sweden these stones are commercially used , nobody in Finland bothers to make a business out of them. A few hobbyist gemstone hunters - like me - have been gathering these stones over the last 50 years or so, but you can still find quite a few of these. One deposit of these blue stones is near the Pitkäkoski Rapids on the Vantaa River. I have polished a few and use them occasionally as presents.

JetPEI transfection of insect cells

Tue, 12 May 2026 00:00:00 +0000

Getting DNA into cells is one of the basic requirements of most of today’s life sciences. There are many ways to get DNA into cells: More exotic methods include shooting and electric shocks, but the most common methods deploy chemicals called transfection reagents. These somehow mingle with the DNA and help it to cross the plasma membrane. PEI (Polyethylenimine) is one of the “cheaper” transfection reagents. If you make it yourself, it probably costs about the same as calcium phosphate transfection (which is one of the oldest and cheapest methods). Even commercially available preparations, such as JetPEI and PEIMax, are budget-friendly compared to many other transfection reagents. However, they do not work very well for insect cells. When I asked - perhaps ten years ago - our provider (Polyplus Transfections), they provided me with a custom protocol for the transfection of insect cells with JetPEI. I have been using it successfully, but mostly only to generate stable cell lines. When making stable transfectants, a somewhat lower transfection efficiency is acceptable. However, I could not find that protocol anywhere online, and thus I have attached it to this post for everybody who needs this information. In a nutshell, the amounts of DNA and transfection reagent are increased to make up for the lower efficacy.

AI: Medically trained models, consciousness

Mon, 11 May 2026 00:00:00 +0000

Most people can perhaps name a handful of LLM models, maybe a dozen if they follow the tech news. However, meanwhile about 3 million different LLM models are freely available from Hugging Face . And not all of them are low-quality models. E.g. Google’s Open Source Gemma models are also hosted there; they share a common genesis with Google’s Gemini models, but have been optimized for local and research use. Importantly for biomedical researchers, there are also many open, freely available, and locally usable, medically trained LLMs. I have not tested them, but there is a curated list of specialty models on GitHub: https://github.com/FreedomIntelligence/Awesome-Specialized-Medical-LLMs . The list also contains several freely available general medical models like

Installing Zotero on Linux/Ubuntu

Mon, 11 May 2026 00:00:00 +0000

The official way to install Zotero on Linux is mildly speaking a nightmare ( https://www.zotero.org/support/installation ). The fact that you need detailed instructions and command line skills to succeed in the installation speaks for itself:

I am focusing on the wrong things

Wed, 22 Apr 2026 00:00:00 +0000

This is a rant, but hear me out. Instead of working on how to utilize AI in my own field, I am:

Purifying Proteins with Äkta & Unicorn

Sun, 19 Apr 2026 00:00:00 +0000

Proteins (and other biomolecules) are mostly purified by chromatographic methods. There are a few vendors that have designed dedicated chromatography systems that are optimized for biomolecules such as proteins, nucleic acids, and viruses. The most well-known systems are BioRad’s NGC and Cytiva’s Äkta lines. Our faculty has recently acquired an Äkta Avant, and we are almost ready with setting it up. It’s already integrated into the reservation system. Only the automated backup system is still missing. I have been using Äkta devices since 1996, when Professor Jorma Keski-Oja bought one of the first Äkta Explorers for the Haartman Institute. The software was and still is Unicorn, but we are at version 7 now, which has a modern look when compared to the Unicorn versions from the last millennium: much less messy and cluttered. However, even after more than 10 years of development, Unicorn 7 is not yet at feature parity with the old versions. Hence, its Evaluation module offers you the option to switch back to Evaluation Classic. E.g., if you want to present personalized and stylish chromatograms in your talks, you still need Evaluation Classic! The new Evaluation module does have quick buttons to import curves into presentation software such as PowerPoint, but it is all pixel-based and therefore not easily editable after export. You want to export your curves into the industry-standard vector graphics file: SVG. You can edit it with any modern vector graphics editor, such as Canva, Adobe Illustrator, or Inkscape. When you right-click inside the chromatogram in Evaluation Classic, you have the option to save the chromatogram as a meta file. However, in the recent Unicorn version, this results in an error on Windows 11. But there is a workaround:

The Study Voucher

Sat, 04 Apr 2026 00:00:00 +0000

Since I am working at the University of Helsinki (UH), I should probably know a bit more about the upcoming Study Voucher pilot (Finnish: opintoseteli), as UH will offer a lot of courses within this program, including some of mine, e.g. the Recombinant DNA Technology (aka “Cloning”) course. I did some reading, and here is the gist of it:

Application is not responding

Fri, 27 Mar 2026 00:00:00 +0000

In Gnome, you get a warning if an application takes too long to complete a task. This can be really annoying if you know that the application is just trying to do its job with the available resources. Gdebi, Zotero and SnapGene are some of the apps that frequently cause this timeout warning on my (rather slow) laptop. To let Gnome know to stop sending this disturbing notification (or at least make them much less frequent), you can increase the timeout like this:

The find command on an old Asustor

Sat, 21 Mar 2026 00:00:00 +0000

Instead of clicking randomly through endless hierarchies of folders on the web GUI of Asustor, you can just ssh into the device and search on the command line using find. However, there are important differences between the find command on contemporary Linux systems and the find command of ADM (the OS of Asustor NAS servers). My EOL Asustor (AS-304T) uses 3.5.9.RWM1, which uses the BusyBox find v1.19.3, while my Ubuntu Linux uses GNU find 4.9.0. BusyBox find trades features for a small binary footprint and is locked to GPL-2. On the GPL-3 side on Linux, significant new features and performance enhancements have been added. Here is the find command that you need if you want to search all disks on your Asustor:

Zotero with 15GB free file storage?

Thu, 12 Mar 2026 00:00:00 +0000

I have been using Zotero as my bibliography management software since 2013 (migrating from EndNote) and have generally been happy with it (and I blogged about it before). Although our university provides EndNote access, most students will lose “free” access after leaving the university. A yearly subscription to EndNote used to set you back about €100 (in Finland via a reseller), which is an unnecessary expense in a student’s budget. EndNote’s “one-time purchase” model is, imho, deceptive marketing, because you are not eligible to major upgrades, which are released approximately yearly. The “upgrade fee” is usually about the same as the yearly subscription used to be.

You know you've been in Finland too long…

Wed, 04 Mar 2026 00:00:00 +0000

You know you’ve been in Finland too long when… is an old Facebook thread from 2010 , but I have had quite a few of these moments realizing that I would no longer pass as a normal German.

How to install the color-blind-safe Nature Color Palette in Inkscape

Wed, 28 Jan 2026 00:00:00 +0000

This one is short and easy on Linux. For instructions how to install this color palette on Windows or macOS, please visit https://github.com/atsuyaw/NatureColorPalette .

The Asustor AS-304T NAS cannot mount contemporary ext4 filesystems

Thu, 22 Jan 2026 00:00:00 +0000

The Asustore AS-303T is meanwhile quite old (from 2013), but I still wanted to keep it around to store backups from the last 15 years or so. I originally had placed four 2TB-drives into the device, but now I happened to have four old 3TB-drives lying around and I wanted to use them to maximize the storage capacity. So I temporarily copied the data from the NAS’s RAID to a few external drives before upgrading the NAS with the 3TB-drives. I did some of the copying via a direct point-to-point cable connection with my laptop , which was a bad idea, because when I later tried to copy back the data using the local USB3-port on the NAS, the NAS’ operating system did not recognize the ext4 file system, that my Ubuntu 24.04 had been using. It turns out that the Asustor NAS uses BusyBox v1.19.3, and even though it can read the ext4 filesystem, it does not know the modern ext4 features and thus failed to mount the drives (ADM version 3.5.9.RWM1, which received its latest update on August 29th, 2022). In order for the Asustor OS to recogize these drives, I needed to “downgrade” the ext4 filesystem. Below are the necessary commands to disable the newer ext4 features:

Routing network traffic through two different NICs

Sat, 03 Jan 2026 00:00:00 +0000

I am just copying a lot of files from our NAS-Backup do my laptop. Since the WiFi was too slow (1 TB takes a few hours in the real world), I connected the NAS directly to my laptop with an ethernet cable. Both machines needed to setup their IP address manually within the same network (which can be whatever; I used 192.168.8.150 for my laptop and 192.168.8.199 for the NAS, and Netmask for both 255.255.0.0). Since this “internal” network does not provide internet access, my Ubuntu 24.04 laptop fell automatically back to WiFi. To force the laptop to use the wired network, I needed to deactivate WiFi. But now I cannot get online without WiFi. So I needed to tell the computer to use the wired network only for the NAS which has the IP 192.168.8.199. The command I needed is:

My Samsung Work Phone Came Preinstalled With Spyware

Thu, 25 Dec 2025 00:00:00 +0000

Working at the University of Helsinki, you might get the impression that the IT department is serious about protecting your digital safety. For example, the IT department forces all UH employees to take a yearly “exam” to prove that we still remember the basics of computer security and privacy. They also continue – against all experts’ advice – to force users to update their passwords annually. Studies have shown that both above practices are lowering and not increasing the security posture [1,2]. Privacy is more of a theater than reality in today’s digital world [3]. Should I have been surprised that the Android phone model officially recommended by my own IT department came preinstalled with spyware?

Python rules our plants

Wed, 24 Dec 2025 00:00:00 +0000

In 2025, we updated our 12-year-old router (the Asus RT-AC66U, WiFi 5/IEEE 802.11ac) and replaced it with a WiFI 6 Flint 2 (GL-MT6000) . While the default user interface of the Flint 2 is pretty basic, its advanced setup is a powerhouse. When you click “Advanced Setup”, you can access the underlying OpenWRT user interface. OpenWRT is a Linux distribution for routers. And unsurprisingly, it is very powerful. A year ago, we started to use a LED array to help our plants survive the winter. To automatically operate the lights, we use a Shelly smart plug via a Python script that calculates the light levels and electricity prices (using the sähkönhintatänään API to get the price data) and switches the plant lights only on when both light levels and electricity prices are low. Today, we moved this Python script from my desktop computer to the Flint 2 router. There are thousands of installable packages available for OpenWRT (directly from the router UI: Applications > Plug-ins). To make my Python script work on the router, we first needed to install the openssh-server to get shell access (btw. the p/l combo is root/“same password as for the web UI”, the router correctly opens the access only to the local network). We also installed python3 and python3-pip and then pip-installed the two non-standard packages ShellyPy (to address the smart plugs) and astral (to calculate the dark/bright periods for any given day at Helsinki latitude, which is around 60°North). We just needed to add an entry to the crontab to run the script once every hour. Since you are logged in as root, you just need to execute crontab -e and add this line to the crontab 0 * * * * python3 /root/plantlight.py and restart the cron daemon (which you can do via the OpenWRT UI under “System > Startup”).

Still wondering what to study?

Sat, 20 Dec 2025 00:00:00 +0000

This is what I would do if I were 20 years old today: I would enter an interdisciplinary study program. My favorite among the programs offered in Finland is the International Master’s Programme in Pharmacy (officially “Master’s Programme in Pharmaceutical Research, Development and Safety”, abbreviated MPHARM) at the University of Helsinki. I give you 5 compelling reasons:

The Finnish Dream: A Pipe Dream?

Mon, 15 Dec 2025 00:00:00 +0000

A reality check for international students

Finland has been celebrated as the world’s happiest country for now eight years in a row . However, Finland is not only the happiest country, but also the country with one of the lowest fertility rates . In order to stabilize the pension system , Finland decided that it needs immigration, an idea very radical for a country that was 30 years ago almost as isolated from the rest of Europe as North Korea is nowadays from the rest of Asia. At that time, the international car sign for Finland was still SF for Soviet Finland (just kidding, the S obviously stands for Sweden). Finland wants to increase immigration by attracting foreign students to pursue degrees in Finland, hoping that some of them will stay in the country after graduation. Hence, Finland has become an increasingly popular destination for international students, particularly from Asia. Lured by promises of a high-quality life, excellent education, and abundant opportunities, many invest big time to pursue a degree in one of the Finnish universities . Ten years ago, university education was free for everybody (including all foreigners), but since since 2017, students from non-EU/EEA countries have needed to pay tuition fees . This was not the universities’ own decision, but mandated by the government.

Instructions how to convert an Asustor AS7004T into an Ubuntu Server

Sat, 22 Nov 2025 00:00:00 +0000

This weekend, I upgraded our old Asustor AS7004T NAS to run an Ubuntu 24.04 server. The ADM OS had not been received any updates anymore for more than a year and it had been switched off and sitting on shelf since. This is a shame because there was absolutely nothing wrong with it. I had early on upgraded the original 2 GB memory of the device with an 8 GB module to a total of 10 GB. But you can run an Ubuntu server on 2 GB if you wanted to… What do you need for the conversion? Obviously, you need to plug in a USB-keyboard and a mouse. Apple USB keyboards do not work. The cheaper the keyboard the better. Sometimes there were problems with the mouse and then it helped to plug it into another USB port. And of course you need to connect the NAS to a monitor via an HDMI cable. I recommend to install Ubuntu Server 24.04.3. Ubuntu Desktop 24.03 also works (I tested it), but I don’t need it and the server has a much smaller footprint. Unlike with older Asustor NAS devices and distributions, fan control worked without problems. However, LED control and display info do not work: The display always shows “Starting system. Please wait…”.

Just another type of fish

Wed, 12 Nov 2025 00:00:00 +0000

I still dream of improving my Finnish language skills, and as a consequence, I occasionally do irrational things. Now, with much help from two amazingly patient editors, I have tried to write a popular science article in Finnish about our scientific excursion into fish biology territory. The article just appeared in the mene & tiedä online magazine of the Young Academy Finland ( Nourten Tiedeakatemia ).

Quiz results

Thu, 06 Nov 2025 00:00:00 +0000

ADAMTS18 regulates ECM turnover via fibronectin cleavage

Tue, 04 Nov 2025 00:00:00 +0000

The maintenance of the specialized blood vessels in intestinal villi had been the topic of a Nature Communications paper from the Petrova lab ( https://doi.org/10.1038/s41467-022-31571-2 ). Maintaining the polarity of the nutrient-absorbing vessels required a differential exposure to VEGFA, which was maintained by specialized cells producing the right amount of fibronectin. The previously orphan ADAMTS18 was the protease that appeared instrumental in the proteolytic maturation of fibronectin. Now, a publication from the University of Eastern Finland analyzed the ADAMTS18 fibronectin connection in more detail: https://doi.org/10.1016/j.jbc.2025.110844 . Fibronectin normally does not exist as a single molecule, but it forms fibrils that are essential building blocks of the extracellular matrix. ADAMTS18 removes a critical part of the fibronectin molecule, thus preventing it from forming fibrils. This establishes ADAMTS18 as an important player not only in endothelial cell biology, but potentially in many other contexts in which fibronectin-containing extracellular matrix is involved. Fibronectin, as a major component of the provisional matrix, is crucial during wound healing and in the ECM maintenance of organs like the lungs. Consequently, there are many interesting avenues opening up to look at additional specific functions for ADAMTS18. Congrats, Maria, for this important contribution to our understanding of another ADAMTS family member!

Thank you, Aalto-Helsinki iGEM team!

Sun, 02 Nov 2025 00:00:00 +0000

I am extremely proud of you, Aalto-Helsinki iGEM team ( https://www.aaltohelsinki.com )! Although being in survival mode all year long, the results are truly exceptional: Gold Medal achieved, nominated for Best Therapeutics Project (overgrad series, tightly beaten by the equally exceptional Toronto University’s Mystiphage project), and two special prizes for Best Measurement and Best Sustainable Development Impact! I would have loved to be in Paris for the Grand Jamboree, but teaching duties and grant application deadlines took priority. Judging from the videos, I was not required at all. An oral vitamin B12 supplement that also works for all patients currently requiring injections is one step closer. We will keep you informed about our progress, this is only the beginning!

The War on Cancer

Wed, 01 Oct 2025 00:00:00 +0000

Wednesday, October 1, 2025, is the European Day of Foundations and Donors. Since we receive close to zero basic research funding, my research is absolutely dependent on external funding. As much of our government’s R&D funding has shifted from academic to commercial research (“business funding”), foundations are keeping cancer research in Finland alive. In the past, a significant amount of money has also been coming from taxpayers’ money. Most people associate this with US President Richard Nixon, who declared War on Cancer in 1971. However, the politically supported “War on Cancer” was not, as often claimed, started by Nixon. The war against cancer had been a priority of politicians of a very different kind almost 40 years earlier.

Paprika harvest is starting soon

Sun, 21 Sep 2025 00:00:00 +0000

For the first time, we will have a decent paprika harvest from our balcony garden. We have had success with cucumbers and tomatoes , but our paprika plants were always attacked early on in the growing season by some spider mites, which seem to be indigenous to our balcony. However, the fruits are just now starting to get their red color. Hopefully, all will get red before the first night temperatures fall below zero on our balcony, but that is often only the case in late December, since the balcony is glassed. Of course, green paprika is also edible, but the red ones just contain more vitamins (at least more vitamin C and folic acid/vitamin B9 . Do you want to know which breed we seeded? We used the seeds from the red Ramiro paprika that you can buy from Prisma: https://www.s-kaupat.fi/tuote/coop-makea-suippopaprika-300g/6438574276493 .

Exporting from Avidemux to MP4

Sat, 20 Sep 2025 00:00:00 +0000

For some reason, Helsinki University’s Unitube crashes when trying to upload an MKV file. The same used to work last year… Only proprietary formats seem to be ok (such as MP4). This creates lots of additional work for me, since I use open source tools to edit my lecture recordings (mostly to cut out unnecessary parts).However, to create an MP4 file, I need to transcode, which is a time-consuming process that requires changing many of the default settings. Below the process using the Open source software Avidemux:

t_coffee still fails on a standard Ubuntu 24.04 LTS install

Thu, 18 Sep 2025 00:00:00 +0000

The bug in t_coffee, reported on https://github.com/cbcrg/tcoffee/issues/27#issuecomment-1355339411, is still an issue after many years. I hardly dare to recommend t_coffee to my students, even though I would like to, because it is otherwise an excellent and very powerful program. Most of them fail to install it on our university’s default Ubuntu distribution (“Cubbli”), which is atm Ubuntu 24.04. I tried it out myself just recently (Ubuntu 24.04 LTS with both the version provided by the default Ubuntu repository via the package manager and the stable and beta versions from https://tcoffee.org/Projects/tcoffee/index.html (stable COFFEE_installer_Version_13.46.0.919e8c6b_linux_x64.tar.gz and beta T-COFFEE_installer_Version_13.46.1.b8b01e06_linux_x64.tar.gz). All of them still complain with –ERROR: MAX_N_PID exceeded. It gets stuck somewhere and takes approximately one minute before it throws the error, even with a simple task that normally takes a few seconds. With a more complex alignment, it can take minutes or hours before the error is thrown. The workaround is to set the environment variable before every run, i.e., you replace t_coffee with a shell script that calls the renamed t_coffee after setting the environment parameter MAX_N_PID_4_TCOFFEE to something big (like /proc/sys/kernel/pid_max). The issue is explained in the Github link above. See also https://github.com/cbcrg/tcoffee/issues/47 . Another workaround is to recompile with a different MAX_N_PID, which is rather straightforward; see also here https://github.com/cbcrg/tcoffee :

Delivery still limits VEGF therapy

Fri, 12 Sep 2025 00:00:00 +0000

Simply injecting a lab-made growth factor into the body isn’t enough to copy what the body does naturally. That’s because our own growth factors are released in the right place, at the right time, and in the right amount, and their levels are constantly adjusted using feedback loops.

Wireguard

Sat, 30 Aug 2025 00:00:00 +0000

My home router (a GL-iNet GL-MT6000) offers built-in WireGuard support. To add a client, you push a button and can either scan a QR code or download the configuration file. The QR code works out-of-the-box with my Wireguard for Android App (the official client for Android), and the configuration file works equally well for Ubuntu Linux 24.04 with Network Manager. To set up the VPN, you simply import the configuration file. The last command is to prevent the VPN from autostarting after a reboot, since when I work from home there is little use in routing my traffic to my own VPN server at home if I am anyway at home.

Backing up DVDs

Sat, 09 Aug 2025 00:00:00 +0000

DVD ripping is one thing (and Handbrake is the tool I have been mostly using for that). But sometimes you want to just copy the whole DVD to your hard drive. On Ubuntu Linux, my preferred software for this is dvdbackup .

Academic career

Sun, 03 Aug 2025 00:00:00 +0000

A tiny job market but the best European country to live in (considering global warming)

This month, I transitioned from Associate to Full Professor at my university. Trusting the opinion of my doctoral supervisor Kari Alitalo , my current supervisor , and mostly everybody else, I did not prepare a plan B, in case I would be denied tenure. As a Gen Xer on the Finnish job market, what could have been a realistic plan B? Looking at the international job market would make it easier to solve the problem by increasing opportunities by a factor of 100, even when considering only English- and German-speaking countries. Finland’s population is only about 5.6 million, and its job market is tiny. However, going abroad is not that easy if the rest of your family is opposed to a change of scenery. And why would I leave the only country in Europe whose summer temperatures are not health-threatening? Sure, global warming also hits the Nordic countries: We just had the longest uninterrupted heatwave in Finland since people are taking measurements (22 days of >30°C). But 30°C beats 40°C hands down. For my American friends & family: 30°C = 86°F, 40°C = 104°C.

Same place, 38 years later (part A)

Sat, 19 Jul 2025 00:00:00 +0000

I visited Tallinn for the first time in 1987. It was also my first and last visit to the Soviet Republic of Estonia. I took a few photographs at the time (I had one roll of 35-mm film with 36 exposures). Last week, I went back after more than 25 years of not having been there to take re-shots of some of the places. I received help from an expert, who pinpointed the exact locations, down to a few meters, where I had taken the shots in 1987. However, it was still difficult to get the perspective right, and I clearly failed in three of the four pictures. I thought I had taken my 28-100 mm Zoom objective in 1987, but after looking at the pictures, I am not so sure anymore. I also had a 70-210 mm Zoom, and I might have used that one. It’s somehow clear from the 1987 images that I must have been far away from the people I photographed, since nobody took notice. I should have used the same camera (which I still have in a drawer that I hadn’t opened for a decade or longer), but I didn’t manage to get photographic (“chemical”) film on short notice. Shot #3 was especially challenging since none of the buildings visible in the 1987 image still exist. Happy to get feedback for my next visit!

Same place, 38 years later (part B)

Sat, 19 Jul 2025 00:00:00 +0000

#Not necessary! # #

Same place, 38 years later (part C)

Sat, 19 Jul 2025 00:00:00 +0000

This was the most tricky image and I am not sure at all whether the new image captures the correct place. Again, I think the 1987 shot must have been taken with a focal length of more than 100 mm. There was no building that could have served as a clearly identifiable fixpoint.BTW: All the 2025 images were taken with the mobile phone camera of a Samsung Galaxy A35. Taking the original camera (Ricoh XR-P) with me would have approximately doubled the weight of my luggage.

Same place, 38 years later (part D)

Sat, 19 Jul 2025 00:00:00 +0000

Next time I’ll take my old SLR camera and the 70-210 zoom objective. I guess I could have used the digital zoom of my mobile phone…

Booting my Lenovo ThinkPad X390 from USB

Sat, 12 Jul 2025 00:00:00 +0000

It’s sometimes harder than you think to boot a computer from a USB stick. It takes two non-trivial skills to pull it off:

An impossible overlap-extension PCR

Sat, 21 Jun 2025 00:00:00 +0000

A PhD student of mine asked me about plasmid maps for several DNA constructs that I had created some 20 years ago. Since SnapGene did not exist at the time, I had used the now obsolete GeneConstructionKit2. I performed many clonings at the time, but I did not continue generating maps for all of them. The GCK2 format does not allow for easy annotation. You needed a separate program for comprehensively annotating the plasmids, and this data was saved in a separate file, the so-called “illustration” file: what could possibly go wrong? Yesterday, I ended up digging out my old lab notebooks and retracing about 10 old clonings in SnapGene. However, I was unable to simulate one of the assemblies because SnapGene was too conservative in disallowing “bad” PCR primers to function. I had performed overlap-extension PCR to introduce a mutation into the mouse VEGF-D cDNA. The homologous mutation had been introduced into human VEGF-D before, and I therefore had the primers for the human sequences. Mouse and human VEGF-D are very similar. The primers designed to amplify the human PCR were not perfect when using mouse cDNA as a template, but none of the differences would result in amino acid changes. So I attempted the PCR with a primer that had a mismatch in the third nucleotide from the 3’-end. The PCR was successful, but even when I lowered the hybridisation parameters to the least stringent settings, SnapGene would not anneal this primer to my template. To simulate cloning in SnapGene and generate a map, I needed to introduce a mutation into my primer and then reverse the mutation after the overlap extension PCR. I guess I need to file a bug report (or would this be a feature request?). It seems appropriate that the program should be able to allow annealing of primers that do anneal in reality…

Python Virtual Environments

Mon, 16 Jun 2025 00:00:00 +0000

There are many different ways to run Python in a virtual environment. I have used mostly conda (together with anaconda), but I frequently end up doing work on machines that do not have it installed. Hence, I have been recently starting to use the “inbuilt” virtual environment. If you are working on a Python project in a directory, these are the steps to start using it:

Learning and Teaching Materials about Biological Drugs

Sun, 08 Jun 2025 00:00:00 +0000

Lecture slides “Biologiset lääkkeet” (Finnish)

Learning Materials in Finnish Language

Basic introduction to biological drugs

Title: Biologiset lääkkeet (Biological Drugs) Year: 2016 Creator: Fimea (Finnish Medicines Agency) URL: https://fimea.fi/laaketurvallisuus_ja_tieto/biologiset-laakkeet
Title: Biologiset lääkkeet (Biological Drugs) Year: 2023 Creator: Terveyskylä (Public information service provided a.o. by Finnish university hospitals) URL: https://www.terveyskyla.fi/laaketalo/tietoa-laakkeista/biologiset-laakkeet

Basic introduction to biosimilars

A better Levodopa

Sat, 31 May 2025 00:00:00 +0000

Saku Renunanen’s manuscript about novel inhibitors of levodopa decarboxylases was published in the European Journal of Pharmaceutical Sciences . It is a textbook example of drawing from the expertise of many different people to make progress. We all know that levodopa provides only symptomatic treatment and that the real breakthrough in Parkinson’s Disease treatment probably has to come from a molecular understanding of the formation of the alpha synuclein and tau protein aggregates and how to interfere with or reverse it. However, disentangling the molecular aetiology of Parkinson’s disease and finding a way to interfere with it will still take us many years. Therefore, improving existing treatment strategies can have a bigger impact on patients’ lives in the short term, and exploring new approaches to improve dopamine deficiency-addressing strategies is thus worthwhile.Levodopa is still the go-to drug for Parkinson’s disease, but a lot of it gets broken down before it ever reaches the brain. While we already use drugs like carbidopa (Lodosyn) to help prevent this, recent research suggests that gut bacteria may also be contributing to the issue. Specifically, Enterococcus faecalis and similar bacteria can interfere with their tyrosine decarboxylase enzymes.To address this, in this paper, over 150,000 compounds were screened computationally looking for ones that could block this bacterial enzyme. After a series of in silico and lab tests, three promising compounds were selected that can inhibit both the bacterial TyrDC and human AADC (the enzyme is already targeted in patients).Why does this matter? These compounds could lead to more effective symptomatic treatments for Parkinson’s Disease. Due to differences in the gut microbiome, some patients might benefit more than others, notably those with high levels of levodopa-hungry gut bacteria. Check out the full study here: https://doi.org/10.1016/j.ejps.2025.107133 . I always learn a lot of new, super-interesting things in these types of collaborations. Which is one of the reasons why I chose to do science for a living in the first place.

ProxyJump

Thu, 01 May 2025 00:00:00 +0000

Since OpenSSH 7.3, it has been much easier to connect from the outside to Linux computers inside the UH network. With older ssh versions, you needed to use a complicated “ProxyCommand”, but now it is straightforward:

Restriction Enzyme Calculator

Tue, 29 Apr 2025 00:00:00 +0000

Use our interactive tool to calculate the volume of restriction enzyme required for your digest.

Restriction Digest Calculator

Sometimes, you need to know how much restriction enzyme is required to cut a specific amount of a certain plasmid within a given time. Here is the calculation tool you have been looking for! All data that was used to write the code for this algorithm was obtained from New England Biolabs (NEB). The survival of the enzyme in the reaction was extrapolated from the experiments reported by NEB. Just plug in the numbers into the form and hit the submit button!

VEGFC-loaded Lignin Nanoparticles

Thu, 24 Apr 2025 00:00:00 +0000

Vascular Endothelial Growth Factor C (abbreviated either VEGFC or VEGF-C) has been used in several preclinical models in regenerative medicine. Its potential applications range from repairing damaged heart tissue to treating neurodegenerative disorders . While repairing damaged hearts and brains is not realistic at this moment, VEGFC does offer a glimmer of hope for patients with lymphedema — a chronic condition that presently can only be treated symptomatically. Yet, despite promising preclinical and even some clinical trial data, one key hurdle remains: effective delivery.The current frontrunner, adenoviral VEGFC (AdVEGFC) gene therapy, had progressed to phase II clinical trials, but the results were inconclusive . One possible explanation is that the amount or the duration of VEGFC production by AdVEGFC is insufficient. Its rapid inactivation by the immune system is a double-edged sword, making it a safe, but perhaps not very potent drug. This shortfall has sparked interest in novel delivery systems that bypass the immune system while providing controlled and sustained release.In our latest preprint , we explore the potential of lignin nanoparticles (LNPs) as carriers for VEGFC, from synthesis to stability. Why lignin? Lignin, a major component of plant cell walls, is the second most abundant biopolymer on planet Earth, and it can be extracted from many different sources and synthesized into nanoparticles.Our stability tests revealed that VEGFC is relatively stable on its own. It easily survives weeks of storage at elevated temperatures, and we have kept it at 4°C for a year without any significant loss of activity. It is also relatively stable against proteolytic attacks. It is not degraded by trypsin or thermolysin, and even withstands limited exposure to proteinase K. However, freezing and thawing cause it to lose activity (one cycle is acceptable, but after 32 cycles, it has lost most of its activity). Therefore, nanoparticle delivery might not be critical for protecting VEGFC from degradation, but sustained and delayed release would be its major advantage.We loaded VEGFC onto the particles and evaluated its release profile. Our findings indicate not only successful encapsulation but also a delayed release pattern, suggesting that LNPs could serve as a slow-release depot for VEGFC. We discovered that VEGFC can hang around for a long time even on its own, as the difference between naked VEGFC and LNP-delivered VEGFC was less than we had expected. In a modified Ba/F3-VEGFR3/EpoR bioassay, naked VEGFC sustained cell survival and proliferation for more than a week, even though at the later time points, not to the same levels as LNP-bound VEGFC. Based on previous studies, we attribute the innate ability of VEGF-C to “hang around for a long time” to its affinity for specific extracellular matrix components and cell surface molecules such as heparan sulfate proteoglycans. Even though most of these interactions are mediated by the silk-homology domain of VEGFC (which was absent in our study, which used mature VEGFC), some of these interaction capabilities also seem to remain in mature VEGFC.With this study, we dipped our toes for the first time into nanoparticle-based delivery of biologics. Our work supports the feasibility of LNPs as an alternative to viral vectors. However, there is room for improvement. One way to improve the delayed release is to modify VEGFC (as was done by Güç et al ). However, instead of modifying a cDNA that codes for mature VEGF-C (as Güç et al. did), it might make sense to try pro-VEGFC. After all, pro-VEGFC is the endogenous, inactive “latent form” of VEGFC. That’s what we’ll try next. Check out the full preprint for detailed methodology and data! Link to the preprint: https://doi.org/10.1101/2025.04.23.649697

Nobody to rescue us

Sun, 13 Apr 2025 00:00:00 +0000

I have been frustrated with the fact that it is almost impossible to live ecologically in Finland. Everything seems to work against this goal. Even when considering a fairly radical lifestyle, I cannot reach anything close to sustainable. The biggest (but not the only) item in the catalog of my unsustainable habits is that I am living in an apartment. And I have the luxury of 30 square meters per person (120 square meters total). When searching for items to further improve my personal carbon footprint, the only option was to move to a smaller apartment or to move to a country where less energy is needed for heating. Unfortunately, Finland requires heating for a large part of the year. I wrote a letter about my frustration to our local newspaper (Helsingin Sanomat , which happens to be the biggest daily in Scandinavia). When it was published, many people chimed in with their opinions. It was eye-opening to see how many were trying to argue away or justify the fact that Finland has - per capita - one of the largest carbon footprints among comparable countries (e.g. Sweden or Switzerland have lower carbon footprints than we do, see here ). There was (as usual) the typical (and wrong) blaming of the population-rich countries. Some just told me to be satisfied with what I am doing, while others told me to get help from a shrink. Lots of defensive rationalization and compartmentalization. The smarter we are, the better we are at rationalizing. I think we all know deep down that we are just pretending to rescue the planet. Most of the Germans also knew deep down that these factories, where all the Jews had been ordered to work, were not just producing soap. The US came to rescue Europe in WWII, but no US is coming to rescue the planet.

Scholar-what?

Mon, 07 Apr 2025 00:00:00 +0000

This morning, an email from ScholarGPS dropped into my inbox informing me that Your prolific publication record, the high impact of your work, and the outstanding quality of your scholarly contributions have placed you in the top 0.05% of all scholars worldwide according to the most recent 2024 ScholarGPS rankings. Is this some scam to inflate my ego first and then make me buy into some subscription service? I was Googling around, but it seems to be a legitimate endeavor. I am not clear why somebody thinks that there should be still another company collecting this kind of research metrics, and why universities would be buying their ScholarGPS Pro subscription, which is aimed at academic institutions and apparently the way they monetize their service. ScholarGPS was founded in 2022 and evaluates individual scholars, institutions and publications. I briefly checked their rankings, and the institutional rankings are - with a few exceptions - pretty in line with other well-known ranking systems. E.g., the University of Helsinki ranks 82nd , behind the Karolinska Institute (67), ETH Zürich (56) and the University of Copenhagen (54). The three highest ranked publications are all about technical advances in protein analysis (Lowry, Bradford and Laemmli). Their numbers for these three (235778, 208682 and 195947 as of April 7th, 2025) do not match with Scopus (273686, 233419, 220553), Web of Science (356029, 242982, 259225), or Google Scholar numbers (234173, 261986, 307492). Do they really do their own counting? They claim to use AI. I don’t think counting counts as AI, and for all that counts, AI is really bad at counting and other simple math ( https://x.com/yuntiandeng/status/1836114401213989366 ). What does this “top 0.05% of all scholars” actually mean? Not much if you do not know how big the pond is from where you are fishing. There is no precise definition of what a “scholar” is. Scopus and Web Science contain profiles for about 10 million unique authors. And 0.05% of these is 5000, which is still a large number. ScholarPro claims it has data about 30 million scholars and 15000 academic institutions. For all that it’s worth, I checked the other experts on the VEGF list , and the vast majority checks out as legitimate (#1 Napoleone Ferrara, #2 Kari Alitalo). They have broken up science into many subspecialties, and you can look at the ranked experts in each of these (e.g. angiogenesis or TGF . Although the categories sometimes appear random. Why are there VEGFs and TGFs, but not Angiopoietins?

English or Finnish?

Wed, 26 Mar 2025 00:00:00 +0000

I am teaching to Bachelor, Master and PhD students at the University of Helsinki . While almost all Master’s and PhD theses in the life sciences are written in English, I am always discussing with BSc students the question of whether to write the thesis in Finnish or English. I am comfortable with both Finnish and English, but when you need to decide, you might want to consider a few things:

Space exploration

Tue, 25 Mar 2025 00:00:00 +0000

When I was 10 years old, I wanted to become an astronaut. Not anymore. I still think space exploration is exciting, but given our chances of survival in space, I very much prefer to stay on planet Earth. We don’t even know yet how to protect humans on the way to Mars…

140% too much

Sat, 15 Mar 2025 00:00:00 +0000

In Finland, the average person hit Earth Overshoot Day in 2024 on March 12th. If everyone on this planet lived like the average Finnish person, we would need 3.5 planets to sustain that level of consumption. This always has struck me as improbable because compared to many other developed countries I have visited, Finland is not particularly rich, nor is our lifestyle particularly extravagant or consumption-oriented.However, according to the statistics, our consumption has always been up there with the Emirates, Saudi Arabia, and other rich countries like Luxemburg and the United States. We are using more resources than many other well-off countries such as Sweden, Germany, or Switzerland. This year (2025), we did a bit better: we dropped from March 12 to April 6. Maybe it’s our new atomic power plant or the recession, but we are not damaging our planet with the same vigor as in previous years. My personal Earth Overshoot DayOthers do not always appreciate my frugal lifestyle, and to see whether I am truly exaggerating, I wanted to know on which date my personal Earth Overshoot Day falls. I took the test , and the result was a bummer: Despite

Sweden, my genetic data and our collective inability to keep secrets

Thu, 06 Mar 2025 00:00:00 +0000

The UK has recently set a precedent, and the mighty Apple has caved into UK requirements. Apple is removing the possibility of switching on secure end-to-end encryption from UK-based devices . This means that the UK government has a backdoor into iPhone users’ private communications via iCloud backup. Almost everybody knowledgeable thinks this is a bad idea because backdoors are usually more quickly cracked open by Russian or Chinese hackers than King Charles III can give his Royal Assent for the law to come into force (see e.g. the Financial Times reporting here ).

Goodbye Finland

Sat, 01 Mar 2025 00:00:00 +0000

If there is a minister in our current government who rubs me the wrong way, then it’s probably Arto Satonen, our Minister of Economic Affairs and Employment. I mean, the guy is right in his view that Finland needs much more work-based immigration, but he is delusional when he thinks that Finland will be able to compete with other European countries for the most wanted and most valuable immigrants. How otherwise could he have supported the “three-months-rule”, a law that would kick immigrants out of the country who lost their jobs and did not find a new employment within three months. This rule has been criticized by many ( https://www.hs.fi/politiikka/art-2000010770898.html ). If our incompetent Arto Satonen doesn’t think that this is a problem ( https://www.hs.fi/politiikka/art-2000010770898.html ), then it is probably because he does not know or talk with foreigners who are working in jobs with low job security. Sure, there are always immigrants willing to come to Finland (”Suomeen on kyllä tulijoita”), but why does Mr. Satonen want the rat’s tail of all potential immigrants? Other countries with better conditions and a more welcoming attitude will scoop the creme from the top. Finland starts already with massive disadvantages in the fight for the best talent: A peripheral location, dark and dirty winters, and an incomprehensible language. Mr. Satonen must have a very distorted picture of Finland’s attractiveness for highly educated foreign workers. Similar to most incompetent politicians, he generally seems not overly interested to base his policies and decisions on facts and research ( https://www.hs.fi/mielipide/art-2000011074278.html ). No, Finland is not a very attractive country for most foreigners. We have not only problems attracting international talent but also problems retaining the talent we already have within the country.Being half Finnish, I tend to forget how incompetently this country can behave towards its guests. Please read the article on Yle.fi “Kiitos Suomi ja näkemiin” ( https://yle.fi/a/74-20143543 ), if you want to know what is going wrong in this country. If we want to be able to make this country more attractive for foreigners, we first have to put a stop to the unacceptable behaviour of people who don’t understand that the future of this country depends on immigration. The current government led by prime minster Petteri Orpo is unable to help in any meaningful way, because it relies on the support of “The Finns Party” (formerly known as True Finns), a party with an arguably dangerously high percentage of convicts, ex-Nazis and other suspect individuals (similar to the AfD in Germany).According to the report by Etla (the Finnish Institute of Economic Research), higher educated foreigners are the first to leave Finland. Is this ever going to change? Mr. Satonen now gets unexpected help from President Trump. In the past, the US has been very successful in attracting and integrating foreign top talent, but the climate towards foreigners seems to be changing. Many of my colleagues working in the US are very worried about what is going on. If you happen to be both a scientist and a foreigner, you get a double hit from the current US administration. Maybe more of the talent will divert to Europe in the future.I have recently started thinking about moving back from Finland to Germany due to climate change. When the AMOC stops, Finland will freeze over, and we’ll fall back into a new ice-age with possible snow cover all year round for most of the country. Meanwhile, Germany is located precisely where global warming and the loss of the AMOC-mediated South-to-North heat transfer will likely balance out. Germany won’t be spared from extreme weather events like storms and flooding, but at least you won’t freeze to death, nor will you be grilled to death. According to the current predictions for the weakening of the AMOC and my life expectancy, I will likely still be around when this s**t hits the fan. UPDATE: A very recent analysis published in Nature concludes that a complete collapse of the AMOC is unlikely this century. Predicting the future is difficult, but at least there is hope for Finland!

Billion-dollar gamble

Fri, 28 Feb 2025 00:00:00 +0000

Last December, Forbes published a feature article about Megan Baldwin’s work to improve the antiangiogenic treatment of eye diseases. I hope she wins her billion-dollar gamble not only because the drug in question was invented here at the University of Helsinki. The drug is called OPT-302 or with its INN name sozinibercept. The patent lists Kari Alitalo and me as the inventors. The drug was initially designed (under the name VGX-300) for cancer treatment, but - perhaps luckily - never really took off as such because it inhibits not only VEGF-D but also VEGF-C, which is needed in the body’s immune response against the cancer. So far, nobody has been able to separate the prometastatic and the proimmunogenic propeties of VEGF-C.

The DTE protein asporin and gut regeneration

Thu, 13 Feb 2025 00:00:00 +0000

Aging and regeneration are two of the most fascinating areas of life science. The somewhat obscure protein (or rather proteoglycan) Asporin, previously known, e.g., to regulate TGF-beta activity in cartilage, has now been shown to play a key role in the regeneration of the intestine. An impressive demonstration of scientific grit, Sharif & Pekka! This paper has been in the making for many years, and there were multiple technical challenges to overcome. Sawan K. Jha started this collaboration in 2017 by creating several cell lines before he succeeded with the recombinant production of Asporin. There is no generally accepted definition for the term “difficult to express (DTE) protein”, but Asporin fits the description well. It has miserable yields, and its activity is easily lost during purification. Sawan also produced and purified the first batches, and after Sawan had moved on to Red-Horse Lab at Stanford University , Sharif (upstream) and I (downstream) shared the production and purification work. Here is the direct link to the publication, which should work until April 26, even if you do not have a subscription. After that, use https://doi.org/10.1016/j.stem.2025.02.009 . If you don’t have a subscription, I will happily send you the PDF by email…

Sartorius Midi Plus

Sun, 26 Jan 2025 00:00:00 +0000

When bigger competitors swallow innovative small companies or brands, the product quality can sometimes suffer due to attempts to increase productivity. I do not know whether this is the case for the BioHit Midi Plus pipetting controller, but we have had our fair share of trouble after the rebranding of the BioHit Midi Plus under the “Sartorius” name. It feels like a bad contact issueOur lab has probably about 20 of these. Among them are the (ancient) bright blue type, the dark blue, and the black models. We had and still have many problems with the black, i.e., the newest model . Although charged, these models sometimes suddenly stop functioning altogether. After pushing the aspirate and eject buttons several times, they start working again (as if there was some contact problem). But sometimes, we need to plug the charger cable for a short time into such a temporary dysfunctional pipette to render them again operational. Even though I have used the older (blue) models almost daily for two decades, this behavior is new to me. It is especially disturbing when working in the cell culture: you have just removed the medium from cells and want to add PBS for washing. Now, your cells are starting to dry out while you are frantically searching for a replacement pipetting aid. As the PI, I work less and less in the cell culture, but when I do, this happens to me nowadays every single time with the Sartorius Midi Plus. Product development should make products better, not worseI have also wondered why these pipettes have not developed much over the years. Why is there no up-to-date intelligent charging controller like every mobile phone has these days? I guess there must be some kind of controller, but apparently, it is not up to the task. Some things did change. For example, the oldest models used NiCd 2/3 AA cells, which were later replaced by NiMH 2/3 AA cells. I assume that the charging controller was also updated since these two battery types need different treatments during charging to optimize the battery life span.I feel that the oldest pipettes of this series have been the most reliable and that the lifetime of the newer models has been decreasing over the years. Since I live very close to the lab, I offered to split cells for everybody in my lab over the last Christmas holidays. However, due to the Midi Plus issues, I got very frustrated when I did the splitting. I needed to exit the cell culture to get another pipetting aid, which is always a big hassle. The MidiPlus that I found (also black) worked, but its LEDs started blinking, and there was some beeping, which I had not experienced before with any of the older models. Sloppy user manualLater, I tried to look up from the user manual what the LED messages and the beeping meant. Sadly, I could not find any information in the manual. Why would anybody include such features and then not document them in the user manual? I contacted Sartorius with this very question on December 31. I received an email reply on January 10th, in which the local service representative offered to visit our lab to sort out our problems. However, none of my questions were answered concerning the missing documentation on the blinking/beeping, and only a repeated request resulted in an answer: Red blinking = battery almost outGreen blinking = chargingSolid green = fully chargedBeeping = battery almost outContinuous beeping sound = battery voltage too low, maybe the batteries need to be replaced In the current version of the manual (01/2022), only the green LED messages are mentioned. It is strange that the user manual was distributed with incomplete information for something like 10 years. Did Sartorius not care? Maybe an intern wrote the manual who never used the BioHit Midi Plus for long enough to ever witness the blinking/beeping? However, Sartorius promised that they would add the missing information to the next edition of the user manual. **Should we switch to Integra? Any user experiences with other brands?**When I started my lab, the first Sartorius-branded black Midi Plus we bought was broken right from the start. It never was able to recharge its batteries and went straight for repair. Interestingly, all three of our (original) Integra Pipetteboys are still going strong. Yes, we needed to exchange the batteries, but the Integras have the advantage of running on rechargeable 9V cells, which you can buy almost everywhere where batteries are sold. This is in stark contrast to the Midi Plus’ 2/3 AA batteries, which you need to order from Sartorius for a premium price. I guess that Sartorius sells these batteries for about 10 times the price that they buy them for from the Chinese manufacturer. Unfortunately, Integra does not sell the original Pipetteboy anymore, and I have no experience with the Pipetteboy acu 2. **What is your favorite pipetting aid?**Are you using electronic pipetting aids in your work? I would like to know your experiences: Which brands are reliable, durable, and affordable? I have no problems with paying a premium price for a premium product, but it feels to me that, at this moment, Sartorius’ BioHit Midi Plus only earns the premium designation for the price, not for the performance.

Barrier (a software KVM switch)

Tue, 21 Jan 2025 00:00:00 +0000

Barrier is an incredible software that lets you use the same keyboard and mouse with different computers without the need for hardware. I have two computers on my desk, and I used to have a hardware KVM (keyboard, video, and mouse) switch, which became obsolete when my computers started to output their video via HDMI. Hence, I have two keyboards on my desk, which is not very ergonomic. I knew about software solutions to this dilemma, but I never had the time to implement them, and I also did not want to pay a subscription fee for this luxury. I now started to use Barrier: https://github.com/debauchee/barrier . It’s been working excellently so far (except for the installation and documentation), but I still need to get it to work before logging in to dump my second keyboard.here are the steps that were not well documented:When installed on Ubuntu, Barrier does not automatically create certificates. So you need to do this yourself:Execute in both client and server: /home/username/.local/share/barrier/SSL:openssl req -x509 -nodes -days 365 -subj /CN=Barrier -newkey rsa:4096 -keyout Barrier.pem -out Barrier.pemYou also need to open port 24800 if you are using a firewall. After you get Barrier working, check the correct command (ps aux) from the command line. It is probably something like this:/usr/bin/barrierc -f --no-tray --debug INFO --name computer-name [87.167.231.88]:24800startUse the Startup applications in Ubuntu and paste the above command in. This means you cannot use Barrier to log in because it is loaded only after logging in. But that’s as much as I managed to figure out so far. There is probably a way to make this work pre-login via systemd, but I did not have the time to figure out how.

Most dangerous disease of 2025?

Wed, 08 Jan 2025 00:00:00 +0000

Thanks to effective vaccines and evidence-based treatment, Covid-19 is not the most dangerous disease of 2025. Equally unsurprising for experts is the fact that HIV, tuberculosis, and malaria are still the top three diseases of concern this year. These cover three different types of pathogens: viruses, bacteria, and parasites. All three collectively kill about 2 million people every year. We in Europe and the US think of HIV, tuberculosis, and malaria as diseases of the past or as manageable chronic diseases. However, all three of these can come back. Malaria was, e.g., endemic in Finland before it slowly disappeared ( last indigenous case in 1954 ). As a consequence of climate change, it could not only return but also spread into countries that have never seen it before. However, in Europe and the US, we probably should be most afraid of the bird flu (avian influenza). Why? Because all pieces are in place for the end of the world as we know it. Influenza type A H5N1 is the type of bird flu currently writing headlines. It has recently caused many outbreaks in birds and cows. Also, humans have increasingly become infected by birds, cows, or drinking raw milk. The only thing that prevents the bird flu from becoming a pandemic is that the bird flu virus does not easily transmit from human to human. However, it only takes a single mutation to change this behavior ( https://doi.org/10.1126/science.adt0180 ). With every infected human, the chance that this mutation happens increases. Influenza is notably an RNA virus, which does mutate on average much easier than a DNA virus. Therefore, it makes much sense to vaccinate the people who are at the greatest risk of contracting the disease, like poultry workers, bird ringers, or vets. Finland has started to do exactly that , and also several other EU countries are following a similar strategy . However, unless the rest of the planet follows, these actions won’t make much of a dent in the global mountain of risk in front of us. The production of a bird flu vaccine is routine and could be done rather rapidly since the process is identical to the generation of the seasonal flu vaccine. But I doubt that it will be possible to vaccinate the population fast enough. Big countries like Germany apparently want to wait until the virus has mutated. How else can you interpret the statement of the German Federal Ministry of Health that Germany would only acquire bird flu vaccines ‘ in the case of an existing or imminent threatening communicable disease ’. What could possibly go wrong? It is scary that in the US, somebody advocating raw milk might soon be the secretary of Health and Human Services. Other countries take the threat more seriously. While most countries - including Finland - have dismantled their state-run vaccine development centers years or decades ago, the UK maintained a state-owned vaccine development and evaluation center (VDEC, UKHSA’s Vaccine Development and Evaluation Centre ). The UK government has just tasked its VDEC with making 5 million doses of a bird flu vaccine to prepare for a possible epidemic ( https://www.euronews.com/health/2024/12/03/uk-purchases-5-million-bird-flu-vaccine-doses-to-prepare-for-possible-pandemic ). With up to 30% mortality in humans , the bird flu makes Covid-19 (0.3% mortality for unvaccinated people my age) look like a bargain. While the 30% mortality rate is likely an overestimate, even a 3% mortality rate would still be about 10 times worse than COVID-19. Differently from COVID-19, we know the virus and could be well prepared. But with an incompetent government (and I am not only thinking of the coming US government), we are heading straight for the apocalypse. It is unlikely that any warp-speed operation or vaccination campaign will be fast enough to catch up with the flu wave that will be rolling around the globe faster than ever due to air travel having surpassed pre-COVID-19 levels and further on the rise. Happy New Year - and don’t forget to stockpile toilet paper! This piece is loosely based on the discussion about emerging diseases in episode #1017 of the The Skeptics’ Guide to the Universe podcast..

Reset the admin (user #1) password in Drupal 9

Wed, 01 Jan 2025 00:00:00 +0000

I have been playing around with Drupal 9 and forgot the admin password. If this happens to you, go to the base folder of the drupal installation.

German Music for Beginners

Tue, 31 Dec 2024 00:00:00 +0000

Our lab won't go bancrupt in 2025!

Fri, 29 Nov 2024 00:00:00 +0000

Our lab has been so unlucky with its recent grant applications that I was already seriously considering alternative career paths. Like becoming a tram driver. Helsinki and its surrounding cities are expanding their tram networks, and good drivers are rare. However, the Cancer Foundation Finland has now ended our unlucky streak! Although it is only a modest amount, I am hopeful for the future. Not all research is equally expensive: some methods need more money than others, and ours are at the budget end of that spectrum. What project got funded? Well, it’s not our novel protein expression system, but a project to answer a question that has been bugging many vascular biology researchers since 2001, when the Achen/Stacker lab published a paper showing that mouse and human VEGF-D do NOT share the same receptors, but that mouse VEGF-D does not bind mouse VEGFR-2 ( Baldwin et al., 2001 ). We showed in 2011 and 2019 , that the proteolytic activation of VEGF-D by cathepsin D leads to a loss of all VEGFR-3 binding in human VEGF-D. If this was true for mouse VEGF-D as well, it would be a growth factor without a receptor! This is not impossible, but it would be exceptional. It is important to get these molecular details right because we are testing our future cancer drugs always in mice. If there is a big difference in the angiogenic signaling between mice and men, this could render much mouse data very difficult to interpret and perhaps even explain why drugs that work well in mice fail in humans. Notably, among all drugs, oncology drugs have the worst success rates in clinical trials. There is reasonable evidence to believe that VEGF-D is the “bad boy” in the VEGF family, i.e., the one that is responsible for cancers developing resistance against antiangiogenic cancer therapies, that are based on blocking VEGF-A. In any case, a big shout-out to the Cancer Foundation Finland! Read here about the award.

JuFo ranking: A Worse Impact Factor?

Sat, 02 Nov 2024 00:00:00 +0000

Changes to the Finnish PhD educationAll Finnish universities are lowering the requirements for a doctoral thesis. Instead of 3 to 4 publications, you can now defend your thesis with 2 to 3. One argument favoring this change was to create a level playing field with other countries. None of the big European countries requires any publications to get a PhD: Neither Great Britain, Germany, France, or Italy do. The other Scandinavian countries are the only other European countries that have (or have had) similar requirements with respect to the number of required publications, with Sweden being almost on par with the Finnish system.If international harmonization was the goal, the change should have been more radical, i.e., get rid of any requirement for publications. However, the new rules just ensure that we lose in quality what we gain in quantity. I prefer fewer but better-educated PhDs, but our current government apparently just wants to bump up the number of PhDs that Finland produces. Publish of perishI fear that the push towards a shorter PhD might decrease the quality of the publications. PhD students are now under pressure to get three papers out in 3 to 4 years. As soon as the “smallest publishable unit” has been produced, it is pushed out into the world. Few research groups have the luxury of postponing publishing research results for a long time because the publish-or-perish culture is still flourishing. While Finland has abandoned the impact factor (good), we have replaced it with a less transparent system (bad). The currently used metric in Finland is the JuFo system, where journals get ranked into classes 0-3 based on “expert consensus opinion.” JuFo is the abbreviation of Julkaisufoorumi (“Publication forum”).Since everybody (including experts) has their preferred go-to journals, this opens the door to bias and even manipulation. There are plentiful examples of highly respected, 10+ impact factor journals with astronomically high rejection rates that were for a long time classified as JuFo 1, until - after a rotation of members in the respective JuFo panel - they were finally bumped to level 2. Why is there such a thing as JuFo rankings in the first place? One argument is that the Journal Impact Factor (JIF) does not account for the individual differences in the publication and citation cultures between different research fields. These differences are huge, but after classifying all journals into individual categories (e.g., clinical medicine versus languages versus agriculture, etc.), one could develop a compensation formula (perhaps even including manually assigned compensation factors) to adjust the JIF for such inter-discipline differences. A software script could do all the work of the JuFo panels automatically and transparently. Bibliometrics researchers have proposed such better alternatives to the JIF. Please drop me an email if you think that I am missing something here! Anecdotes versus dataHaving a system that allows for “manual” downgrading of journals is certainly a good thing. I also endorse JuFo’s attempt to solicit individual researchers’ feedback. However, when you count the number of journals JUFO needs to evaluate, you will see that gathering feedback from 180 individual scientists’ experiences and then downgrading 60 journals based on this feedback has issues. That’s what happened a few years back. If we assume that ALL feedback has been negative and ALL negative feedback has resulted in a downgrade, there will be a tiny number of cases for each journal. In the parlor of evidence-based medicine, some of these cases might be anecdotes. Don’t get me wrong: These decisions are probably not wrong, and neither is it wrong to gather feedback from researchers. In fact, my own experience with one of the downgraded journals (International Journal of Molecular Sciences) is pretty much indicative of predatory publishing. However, the data underlying these decisions is not the best, and it would be surprising if every single one of these decisions would hold up to scrutiny. It is difficult to imagine how such feedback could avoid bias. It’s self-reporting, and researchers might be incentivized to report negative experiences. Grading on the curveAnother little-known fact is that JuFo is a zero-sum game. Journals cannot be freely distributed over the four categories, but JuFo uses a variation of “grading on a curve”: No more than 10% of the articles published in journals for a specific JuFo panel (e.g., for Chemical sciences) are allowed to fall into JuFo category 3. This accounts for differences in publication volume between fields. However, if we - the scientific community - improve the quality of our publication output generally, this will not be reflected in the JuFo ranking. That is, in my opinion, wrong (for the same pedagogical reasons that schools are discouraged from grading pupils on a curve). **Decisions behind closed doors?**The second big issue is transparency. The fact that I have to speculate in the paragraph above about the numbers that have led to the downgrades is worrisome:

Teaching ”Biological Drugs” in Finnish

Fri, 01 Nov 2024 00:00:00 +0000

In 2022, the steering group of the International Master’s Programme in Pharmaceutical Research, Development and Safety (MPHARM) collectively received the Innoopeli prize 2022 for developing teaching at the Faculty of Pharmacy . As a member of the steering group, I was a bit surprised as none of our students had graduated yet. However, the preliminary laurels received approval earlier this year, when the first batch of the students graduated .

Producing proteins better than the pros

Thu, 31 Oct 2024 00:00:00 +0000

Congratulations, Laura & Akseli! Your article in Scientific Reports ( https://doi.org/10.1038/s41598-024-77104-3 ) is a solid piece of work that has not only relevance for cardiovascular diseases but also for the work that we are doing on lipedema/lipoedema (and therefore, potentially even for lymphedema, which has been the main focus of our research in the past). There are astonishing similarities between coronary artery disease and lipedema, because both can be regarded as lipid storage disorders.And thanks to Khushbu and Betül for helping Laura produce and purify such a high-quality LCAT protein that worked better than the protein preps that are commercially available! Perhaps much of the secret was the high expression levels that we could reach compared to other systems. For the first time, we tried out HEK293T cells with a custom CHO vector ( pCHOKE-B-LCAT-H6 ), and it worked surprisingly well. pCHOKE-B was assembled from scratch and we incorporated several advancements made over the years compared to regular CHO expression vectors. The vector contains

Images for talks and illustrations

Mon, 09 Sep 2024 00:00:00 +0000

I promised in January to list websites where you can find free images ( free as in beer and free as in speech ). And then I forgot about the promise. Since I mostly use Inkscape to draw illustrations, I normally search for SVG images. Inkscape is an open-source software that generates vector graphics. SVG is not only the web standard for vector graphics but also the native file format for Inkscape. Sometimes, PNG or JPEG images are also acceptable if they can be easily converted into SVG images (e.g., silhouettes). Occasionally, I look for 3D images (“models”), and then I prefer them in Blender format (the only 3D software that I have used more than just a few times).There are two different types of free images on the web: Public Domain and Creative Commons . Public Domain images can be used without restrictions, while Creative Commons images typically come with some restrictions. The most common restriction for CC-licensed images is that you need to credit the creator. Sometimes, there are additional restrictions, such as prohibiting commercial use or modifications.When you do an image search with Google or DuckDuckGo , you can restrict the view to images that conform to a specific license. However, Google and DuckDuckGo cover only a fraction of the internet, and there are search sites that have specialized in searching for specific images.You may also ask AI to generate the perfect image. It typically requires several iterations to get something useful, and you will never be able to get copyrights for the image, even though you spent hours engineering the perfect prompt. You can try e.g., DALL·E 3 , or you can even run some AI image generators on your own computer like Stable Diffusion . The image above was generated with DALL·E 3, using the following prompt: “A person surrounded by images, symbolizing the search for the perfect image.”

What do we really know about lipedema?

Mon, 09 Sep 2024 00:00:00 +0000

Lipedema is an accumulation of subcutaneous fat, mainly in the lower body, which is resistant to weight loss and occurs almost exclusively in women. It is often painful, prone to bruising and is thought to have a genetic component, which is likely triggered by hormonal changes. Although lipoedema was recognised as a condition more than 80 years ago, our understanding of the condition and its aetiology remains incomplete. This is due in no small part to the fact that lipoedema has only recently been included in the official classification of diseases. Virtually all aspects of the condition are controversial, starting with its classification. The symptoms of lipoedema overlap with those of obesity, lipodystrophy, lymphoedema and connective tissue disorders. There are as yet no specific tests, and due to the uncertainty surrounding diagnosis, there is also considerable uncertainty regarding the prevalence of lipoedema, with estimates varying widely from 1 in 75,000 to 39 per cent of all women. Many hypotheses have been put forward regarding the cause of lipoedema, including that it is a lipid metabolism disorder, a connective tissue disorder, or an inflammatory or immune-mediated disease. A definitive cause has not yet been identified, and the search for ‘lipoedema genes’ has so far yielded no conclusive results, with the exception of individual genes that play a role in only a small proportion of all patients.

6. Swiss Lymphsymposium

Sat, 07 Sep 2024 00:00:00 +0000

The 6. Swiss Lymphsymposium has just completed. This symposium seems to gain popularity with every iteration, and I heard that there was a waiting list this year. The Juzo AG had invited experts to discuss topics at the intersection of Edema and Adipositas. The meeting was interesting and did not shy away from controversies. For a bench scientist like me, it is always stimulating to get the healthcare practitioners’ perspective into the diseases whose molecular basis I research. I had been at the 3. Swiss Lymphsymposium in 2021 , and there have been many developments that I have chosen not to pay attention to in my ivory tower of basic biomedical research. Specifically, the new S2k lipedema guidelines which are in effect since the beginning of 2024 received lots of attention.The new lipedema guidelines consider questions and goals related to diagnostic criteria, differential diagnostics, how diagnosis and therapy are influenced by co-morbidities, what therapeutic possibilities exist, and how patients can actively contribute to managing the disease. Given how little we understand about the etiology of lymphedema, these goals are ambitious. Dr. Tobias Bertsch from the Földi Clinic gave a very passionate and persuasive talk about the progress these guidelines represent in his talk “The New Guidelines Concerning the Lipedema Syndrome - More Light Than Shadow”. The presentation loosely followed the position paper he published with many other European experts. The one item where the position paper deviates most from the guidelines is the evaluation of liposuction as a treatment option. The position paper clearly states that liposuction does not produce long-lasting results, whereas the guidelines are surprisingly sparse-worded about this topic, and the reached consensus received the lowest support from the authors among all recommendations.For a bench scientist, making decisions absent high-grade evidence remains unsatisfying. However, guidelines for healthcare professionals cannot speak the same language as scientific articles because that would counteract their usefulness. “Whoever heals is right”, and if the new guidelines result in better medical outcomes, they serve their purpose. Guidelines - as scientific knowledge - are always provisional and subject to adjustment once better evidence becomes available. At the same time, we have to be careful not to block progress by taking them as gospel. After all, the saying “Whoever heals is right” is attributed to Samuel Hahnemann, the German physician who founded homeopathy (which is essentially witchcraft; do I need to mention this?). Nevertheless, when Samuel Hahnemann lived, using homeopathy likely resulted in better medical outcomes than the mainstream treatments of the time, such as bloodletting or patent mercury potions, which were frequently not only useless but dangerous or toxic.How I view lipedemaAfter following the lipedema field for a few years, my hypothesis is that lipedema is one endpoint in the wide spectrum of human fat storage physiology. Fat storage has been such a big asset during 99.999997% of evolution that nature was willing to accept the many risks inherent to complex and difficult systems. The more complex a machine, the more frequently it will fail, and many hereditary lipid-related diseases are failures of this machinery. The essential problem that this complex machinery has evolved to overcome is the insolubility of fat in water. Any transport of fat inside and outside the cell requires rendering fat water-soluble. In the blood, this is achieved by packaging fat molecules into lipoprotein particles.Lipids that are not burned get stored somewhere. They can be stored subcutaneously or viscerally. There are more ways to store fat, but this is the simplified version: Everybody will have a slightly different distribution between visceral and subcutaneous fat storage based on a complex interplay of many genes and the environment. In some people, this interplay results in extreme imbalances between these two compartments with pathological consequences. For example, in coronary heart disease, for most people, the genetic burden results from many genes (polygenic), whereas in a minority of patients, one or a few genes might explain the condition (monogenic or oligogenic). Hunting genes likely won’t result in any actionable findings for most lipedema patients. However, similar to coronary artery disease, it might be possible to identify risk factors. We already know three risk factors for lipedema: being female, undergoing hormonal changes, and having a family history of the disease. It would be helpful to identify additional risk factors that are easier to modify than the three we know of. We need for lipedema something similar to what the blood lipid panel is for coronary heart disease. Here is the link to my presentation (which I will keep updating over time with better information): What do we really know about lipedema? . You can also download the German version Was wissen wir eigentlich sicher über Lipödeme? - Eine Bestandsaufnahme" .

Do fish have difficulty breathing?

Fri, 28 Jun 2024 00:00:00 +0000

Fish are breathing with their gills, but this is literally, for many of them, only half of the story. The difficulty of extracting oxygen from water is the single most defining force that shapes fish evolution. Land animals are mostly exposed to the same oxygen concentration, but fish need to operate in waters of vastly different and rapidly changing oxygen content. Moreover, water contains much less oxygen than air, and the diffusion of oxygen in water is magnitudes slower than the diffusion of oxygen in air. Therefore, fish evolution was forced to come up with creative ways to

Who does still restriction enzyme cloning?

Thu, 27 Jun 2024 00:00:00 +0000

Restriction enzymes cleave DNA at specific sites and thus enable — together with DNA-ligating enzymes — the molecular cut-and-paste operations that still underlie most of today’s recombinant DNA constructs. There were always some alternative assembly methods, but about 10 years ago, restriction enzyme cloning got serious competition from the single-tube homology-based assembly strategies (foremost from “Gibson Assembly” and its derivatives). Despite this, restriction enzymes still occupy an important position in any recombinant DNA workshop.There are not many commercial providers with a large portfolio of restriction enzymes. New England Biolabs and ThermoFisher are the two big elephants and are the only providers with more than 200 different enzymes. All other players (Roche, TaKaRa, Promega) have a much less comprehensive offering. About 10 years ago, I argued that nobody should use FastDigest enzymes from ThermoFisher. You can read that blog post , but it comes down to the following take-home message:ThermoFisher does not provide enough information about its enzymes to use them as equals in a mixed environment with enzymes from vendors that have full transparency, such as New England Biolabs (NEB).This close-mindedness has led ThermoFisher to invent their own definition of restriction enzyme activity based on a 5-minute window, which makes straightforward comparisons with competitors’ enzymes impossible since they use the standard 1-hour window. Since enzymes survive for different amounts of time in a reaction, and since ThermoFisher — unlike NEB — does not provide any data about their enzymes’ survival times, no meaningful comparison is possible. One wonders whether the only purpose of the new unit definition was to prevent any comparisons. That alone should be sufficient reason to avoid ThermoFisher like the plague, but there is more. In 2014 I pointed out that after acquisition of Fermentas by ThermoFisher, not a single new FastDigest enzyme had been added to their product line. This statement is still true a decade later (and it is equally true for conventional restriction enzymes). Innovation concerning restriction enzymes has also slowed at NEB, but since 2015, NEB added some five HighFidelity enzymes (ApoI, BbsI, BclI, BsiWI, BstZ17I) as well as a few conventional restriction enzymes to their portfolio.The biggest issue I see with ThermoFisher’s policy of silence. hardly anyone knows that they sell isoschizomers under the prototype enzyme’s name. While they are upfront about the use of isoschizomers in their non-FastDigest lineup, they do not disclose the identity of their FastDigest enzymes. Many of the FastDigest enzymes are isoschizomers according to Arvydas Janulaitis , the former CSO of Fermentas , the company that developed the FastDigest system before they were swallowed by ThermoFisher in 2010.In a recently updated flyer , Thermo Scientific tries to paint a picture of superiority over NEB but only manages to fool cloning novices. In their infographic, they try to emphasize the simplicity of the buffer choice within ThermoFisher’s restriction enzyme portfolio and compare it to NEB’s portfolio.However, they ignore their 190 conventional enzymes that are not FastDigest buffer-compatible (and this group includes important enzymes, e.g. the “GoldenGate” type IIS enzyme BsmBI). To correct the record, I have made a better graphical comparison between ThermoFisher and NEB, which is the main image of this blog post.Even my comparison is optically misleading since it does not account for redundant enzymes, which ThermoFisher features a lot due to its aggressive acquisition strategy. In this comparison, it looks as if ThermoFisher offers more different enzymes, but this is not the case at all. Accounting for redundancies, NEB has 257 different commercially available restriction enzymes, while Thermo Fisher has only 209. I did not count myself but relied on the newest enzyme description file from the best cloning planning and documentation software SnapGene .In 2014, I complained that their Fast Digest buffer has a proprietary composition, and when I checked today, that was still the case. There has been zero progress at Thermo Fisher’s restriction enzyme front: no innovation, no increased transparency.

Ouriginal fails more often than not to detect plagiarism

Thu, 23 May 2024 00:00:00 +0000

Ouriginal , the plagiarism detection service formerly known as Urkund, has been in use at the University of Helsinki for a very long time. Because of Ouriginal’s inability to process some of our students’ Master’s thesis, I spent a little bit of time investigating Ouriginal and its problems. Here’s what I found out. From Swedisch to European to US-AmericanIt is unclear to me which software we are really using since Ouriginal is a merger of the Swedish Urkund and the German PlagScan, and in 2021 Ouriginal was acquired by the American Turnitin . I don’t need any of such software, but our university mandates that theses must be scanned by the software. Since I read and evaluate an increasing number of theses every year, I also increasingly use Ouriginal. Ouriginal supports many document formats, but support is buggy Looking at the history of submissions, I realized that until about mid-May 2024, all submitted PDFs had been dutifully analyzed. But last week, something changed since about half of the submitted documents were not processed. The usual tricks (submitting in another format such as .docx, .odt, .ps, .rtf) did work for some, but not all of the theses. One thesis was especially stubborn, and neither our “experts” nor the Original helpdesk staff had any clue why their software could not process it (which makes me again wonder what software their backend is actually using). Ouriginal is investigating already for a month without getting back to me with answers… Our university receives funding from the Ministry of Education based on graduating students, and we lose thousands of Euros for each student who fails to graduate on time. Fee-liable students also have a strong incentive to graduate on time in order to avoid additional costs. Therefore, every delay in the graduation schedule is unacceptable. Ouriginal’s performance disappoints with a shocking detection rate Since there are dozens of ways how to turn a Word document into a PDF, I tried to isolate the problem by submitting test documents to the Ouriginal service. I used manuscripts that we had published over the last few years. I was shocked when I realized that Ouriginal failed to detect plagiarism in more than half of all cases. Paywalls are not to blame since almost all our publications are freely available. Neither the novelty of the publication nor the quality of the journal made a perceivable difference. However, it seems evident that Ouriginal has more problems with non-English documents. It is very difficult to explain why so many freely available scientific texts from reputable journals ( Scientific Reports , Angiogenesis , Annals of Anatomy ) are not indexed by Ouriginal. Failure to detect plagiarism from Helsinki University’s own thesis repository Original does not even index our own university’s freely available PhD theses ( https://ethesis.helsinki.fi ). None of the PhD thesis written in my own lab was recognized. I also checked my own PhD thesis , and it was the only one that was recognized (Ouriginal found it on docslib.org , not our own university’s official thesis repository). Does it make any sense to pay for such an imperfect service? I don’t think so. The omission of freely available texts from important journals seems inexcusable since a simple Google search does a better job. I did Google searches for sentences from the unrecognized texts, and in most cases, Google identified the original source without problems. A Python script to split texts into sentences for individual Google searches and to aggregate the results can be written by any programmer in an afternoon. Why would you maintain your own database if Google does a better job than you can? Plagiarism to the following published manuscripts/theses/proceedings was NOT detected:*

Admission interview

Thu, 09 May 2024 00:00:00 +0000

An increasing number of MSc study programs at our university are incorporating an interview into the admission procedure. Tiina Immonen from the TRANSMED program was the pioneer at the University of Helsinki who ventured first into this territory. If you are invited to an interview at the University of Helsinki, you have already taken the biggest hurdle, which is the evaluation of your application. To be accepted, you have to make sure not to screw up the interview. You don’t need to be stellar, but you need to meet expectations. The reason is that interviews are notoriously tricky to evaluate, and therefore, many programs use them primarily to screen for red flags.

MPHARM milestone

Fri, 26 Apr 2024 00:00:00 +0000

Helsinki University’s International Master’s Programme in Pharmaceutical Research, Development and Safety (MPHARM) is close to another milestone: Our first graduates are soon to submit their theses. On Thursday, we were celebrating after the MSc Theses seminar, where the first batch of students presented the results of their thesis work. At the center is Leena , our benevolent director. Not in the picture is Tomi , who deserves much of the credit for making the Drug Design and Pharmacology track such a success!

If you have a "green card" (S-etukortti), you can vote for me*!

Fri, 05 Apr 2024 00:00:00 +0000

I want to advance an aggressively green, science-based agenda. And I want Finland to feel like home not only for the indigenous but for everyone committed to Scandinavian values. Look at my values at the candidate finder website .Given that close to 20% of the capital region’s population has a foreign background, foreigners are - with about 5% - massively under-represented among the candidates in the upcoming cooperative elections (osuuskauppavaalit) . Unsurprisingly, you cannot find any foreigners among the candidates of the “True Finns” (Perussuomalaiset). Still, other lists were not excelling in their complete or near absence of foreign candidates, such as the Center party (Keskusta). Due to this lack of inclusion and diversity, I signed up as a candidate in the capital region’s subsection of the S Group (HOK-Elanto).The purpose of the “osuuskauppavaalit” is to elect a 60-member representative body (and deputy members) of the representative body of the HOK-Elanto cooperative for the next four years. HOK-Elanto is the section of the S Group that operates in the capital region. The S Group is the biggest Finnish retailing cooperative. Unlike its most significant competitor (Kesko), it is not listed on the Finnish stock market. But the goal of the S Group and Kesko is the same: making their owners rich. Just that the owners of the S Group are the customers, while the owners of Kesko are the shareholders. In 2020, there were more than 2 million S Group customer-owners in Finland, but only about 60000 Kesko shareholders.

Mia Sivén, the world's first professor of sustainable pharmacy

Fri, 05 Apr 2024 00:00:00 +0000

When we were asking our foreign students what made them join the University of Helsinki, several of them mentioned sustainability aspects. Many of the research groups at the Faculty of Pharmacy study topics that are highly relevant to a sustainable future. For example, tackling the increasing threat of antibiotic resistance is a high priority for our faculty. And my group works on the planet’s most environmentally friendly protein production system. There is no part of a drug’s life cycle that could not be approached from a sustainability angle. Therefore, it was high time that this over-arching theme was finally acknowledged by establishing a dedicated professor position. To our knowledge, next month Mia Sivén will start her job as the world’s first professor of sustainable pharmacy . You are probably not surprised that I am very happy about this appointment.

Taking an webcam image from the command line

Fri, 05 Apr 2024 00:00:00 +0000

There are probably not many use cases, but remote surveillance is an example, both in a malicious and legitimate context. Malware can take pictures of the unwitting user, and “Has anybody searched through my office after I forgot to close the door last Friday?”, respectively.

Finished with Finnish?

Sat, 30 Mar 2024 00:00:00 +0000

In her opinion piece in Helsingin Sanomat , Annikka Mutanen picked up on the predicted population decline in the numbers of Finnish people : At the end of this century, the number of people in Finland with Finnish roots will have fallen below 2 million. I won’t be around anymore to experience this, but my children have a good chance to.

Essential elements for life science

Sun, 24 Mar 2024 00:00:00 +0000

Here is my version of a simplified periodic table for life scientists. A few years back, my son learned the complete periodic table by heart up to element 118 (Oganesson). He found it funny that I only knew the first two rows. I am not embarrassed, even though I don’t even remember the first two rows entirely. There are elements that I almost never encounter during my work, such as aluminium. Yes, I know that aluminium is used as an adjuvant for immunization. But then, we can’t even agree on whether to spell this element “aluminium” or “aluminum”! And I would even forget Beryllium if it wasn’t for the fact that I once have been gemstone hunting for Beryll (which you can find in Finland ). At work I come across no more than perhaps 11 elements (which make up more than 99.5% of the human body). The question of how many elements are essential for human life is not easy to answer. It’s somewhere between 19 and 29. Why are there so many elements with an unknown status? Some of the “controversial” elements might not be strictly essential for life, but still necessary for good health. Where to draw the border? And then there is the problem of how to experimentally prove essentiality. Many of the controversial elements are so-called ultra-trace minerals, and it is very difficult to rear experimental animals in an environment that is completely devoid of even the smallest trace of these elements ( https://en.wikipedia.org/wiki/Biological_roles_of_the_elements ).

Overstretched IT support

Fri, 23 Feb 2024 00:00:00 +0000

The problem: Crash during boot

More than a year ago, a few weeks after receiving my new work computer, it failed to reboot after a system update and got stuck early in the boot process. I soon realised I could still start the computer using “safe mode”. Strangely, nothing seems to be wrong because when I manually exit safe mode at the end of the boot process, the computer works fine. Our IT department has tried to fix the problem many times without success. I even had to work without a computer for about 3 weeks while it was “under repair”. You probably know how much work you can get done without a computer: close to zero.My computer runs Cubbli 20.04.06LTS, an unofficial Ubuntu spin maintained by the University of Helsinki for internal use. Although you can do bioinformatics on a Windows or macOS computer, Linux is hands-down the first choice. Many bioinformatics developers don’t even bother to release their software for Windows. MacOS works mostly fine (since it is also UNIX-compliant OS), but I would have to pay twice the price for the same calculating power.The computer is a Lenovo P350 with an NVIDIA T1000 graphics card, which I use to address two screens. I mainly need the graphics card for 3D modelling, phylogenetics analysis and similar tasks. This graphics card may have caused the trouble. I initially did not want to buy this model, but since there was a shortage of graphic cards at the time, IT convinced me to swap out my original choice against the T1000.

Back to the monograph?

Thu, 01 Feb 2024 00:00:00 +0000

Finland had become internationally known for producing highly qualified PhD graduates in the STEM fields. This was a result of the requirement to publish 4 to 5 scientific manuscripts in renowned scientific journals. Not surprisingly, it took, on average, about seven years to accomplish that feat. Today, Finnish PhD graduates are perhaps internationally more known for being relatively old once they graduate. I myself was 34 years old when I received my doctoral hat . It took me a bit less than six years.On the other hand, my supervisor was so smart to let me do what I wanted, and I spent quite a bit of time with side projects that did not really advance me on my trajectory towards the degree certificate. However, it also meant that I acquired skills, knowledge, and connections that I otherwise would not have. If you take the 10000-hours-rule literally, 10000 hours equal pretty much a six-year PhD education.At the moment, the Finnish Ministry of Education wants to lower the time required for achieving the PhD goal down to 3 years. This article in World University News is to date the most extensive English information piece that has surfaced about this project.My questions are: Why? and How? The why is pretty obvious: Finland has fallen behind in the OECD statistics of highly educated professionals. To polish these numbers, Finland needs more PhD graduates. And since attention-span-reduced politicians cannot be expected to wait six years, it is only logical that they would agree to spend money to increase the degree numbers, provided this would happen fast.But what about the how? How can PhD students learn in 3 years what they normally used to learn in 6 years? If that were possible, it would mean our current PhD education is massively inefficient. Can we squeeze it down to three years without compromising quality? There is clearly an opportunity for optimization. Especially when it comes to the funding of the studies. There has been a constant lack of university-salaried PhD positions. As a consequence, many PhD students spend a significant chunk of their time applying for grants or - even worse - working part-time in order to make ends meet. However, while absolutely a step in the right direction, paying a salary will not cut down the required time by 50%.There is something annoying about science that politicians might not fully understand: It is impossible to predict the outcome of scientific experiments. This very fact is the only reason you do them in the first place! However, if you cannot predict the outcome of experiments, you cannot predict how long it’ll take to get the work done and publish the results. In order to straight-jacket the process of obtaining a PhD degree into a three-year predictable journey, we need to dig deeply into our academic bag of tricks and resurrect the “monograph”. The monograph is an alternative way to attain a PhD degree. Although alive on paper, it had practically died in the STEM fields decades ago, with more than 99% of all STEM PhD theses being publication-based. In some fields and faculties, the monograph has held on to a higher share, but its popularity has been diminishing everywhere for very good reasons. But now it is back!With the monograph, you don’t open up your scientific output to the scientific community for peer review, improvement, and appreciation (in the form of citations). Instead, you write up your research results in a hundreds of pages thick manuscript that is only scrutinized by your supervisors and two external experts appointed by the faculty council. What could possibly go wrong? I hope that I am wrong, but a three-year PhD education will likely not be able to offer the same as a six-year PhD education. Besides, there are other factors that unnecessarily slow down PhD education, which are not addressed in the current pilot. The most notably ignored factor is the supervisor-to-student ratio. Due to the sustained relative decrease in the funding of the basic university functions, teachers and supervisors at Finnish universities are already very thinly stretched, and the current “suboptimal” supervisor-to-student ratio will deteriorate with 1000 additional PhD students who will enter Finish universities over the next year. I fully understand the desire to harmonize the PhD degree at the European level (something that we have done more-or-less successfully with the BSc and MSc degrees starting with the Bologna process in 1999). We don’t know many of the implementation details for this pilot yet. But very clearly, most of the real stakeholders were never asked when this pilot had been cooked up.UPDATEThere have been two articles in the Finnish daily newspaper “Helsingin Sanomat” about this pilot that talk about the two most important points of criticism that have been targeted at the 1000-PhD-students project, namely the decrease in PhD education quality that seems to be inevitable and the very unequal distribution of the funding between different disciplines: https://www.hs.fi/politiikka/art-2000010217525.html https://www.hs.fi/kaupunki/art-2000010242698.html UPDATEThe University of Helsinki has finally posted some information about the upcoming call. The page is not available from the news feed, but you have to know what you are looking for in order to find it. This his is counterproductive given the fact that the application period is only two weeks: https://www.helsinki.fi/en/research/doctoral-school/doctoral-education-pilot

Do fish have lymphatics?

Sat, 27 Jan 2024 00:00:00 +0000

Read the whole back story in our preprint: https://doi.org/10.20944/preprints202312.2119.v1 . It isn’t easy to believe that the scientific community cannot agree on whether zebrafish have a lymphatic vascular system. Zebrafish is one of the most successful model organisms in biology, and one would assume that we know its overall vascular setup. However, starting with W. Vogel in 1981 ( https://doi.org/10.1515/znc-1981-5-627 ), many fish physiologists subscribe to the notion that there are no lymphatics in fish, and most contemporary fish physiology textbooks have appropriated this point of view. At the same time, solid publications from multiple labs show that lymphatic vessels exist in fish ( https://doi.org/10.1038/nm1427 , https://doi.org/10.1016/j.cub.2006.05.026 ). What is going on? When the Yaniv lab published in 2022 that embryonic lymphatics in zebrafish can transdifferentiate into blood vessels ( https://doi.org/10.1038/s41586-022-04766-2 ), it suddenly appeared possible to unite the two contradictory views. In a nutshell: In most fish, an embryonic lymphatic system transdifferentiates during development into blood vessels that form a specialized subcompartment of the cardiovascular system (the so-called secondary vascular system). The degree of transdifferentiation seems quite variable between fish species, and some vessels - notably the thoracic duct - might retain a hybrid phenotype.As so often is the case in top journals, the original article by Das et al. neither discussed the 100-year-old controversy nor the ramifications of its landmark findings. Even though Kari Alitalo and I did so in a short commentary ( https://rdcu.be/cOjJ0 ), more space is needed to do justice to the topic. Although the controversy about piscine lymphatics is far from settled, it appears important to record the current status of the discussion in the scientific literature. Moreover, we wanted to describe a high-likelihood consensus model against which to plan future experiments. The result is an extended review; we hope you’ll enjoy reading it. If you find something that you don’t like, by all means, let us know! Especially if you can back up your critique with data or sound arguments. We sent the manuscript for review and are happy to improve it based on your input.

Why you should not use BioRender

Wed, 17 Jan 2024 00:00:00 +0000

About two years ago, our university started subscribing to an institutional plan for BioRender . BioRender is a browser-based scientific illustration software with a large library of pre-made items, including complex illustrations. It allows you to illustrate scientific concepts quickly or to make flow charts for your experimental setups. And given how easy it is to use, the results look rather slick. It’s like the McDonald’s of scientific illustration. It’s fast and gets the job done. Sure, the food in a 3-star Michelin restaurant tastes much better, but most of us rarely can afford that luxury.Why should you not use it despite all of the advantages mentioned above?

It’s difficult to grade student’s assignments

Sat, 16 Dec 2023 00:00:00 +0000

I have been reading hundreds of student assignments this autumn. In many of these assignments, the students are expected to answer questions. Grading these assignments means deciding whether the answer is “right” or “wrong”. This is sometimes difficult. Most answers are somewhere between “right” and “wrong”. Therefore, the need for grading exposes a deeper problem: Before I can decide where on the spectrum from “right” to “wrong” the students’ answers fall, there needs to be an objective “right” and “wrong”. Otherwise, objective grades are an illusion to begin with (not even considering the problem of how to determine them reliably).However, all our scientific knowledge is preliminary. It is subject to modification or even reversal when new, better data becomes available. So, how can one grade any assignment with any certainty? Luckily, not all of our knowledge is equal. One important hallmark of a scientific statement is falsifiability , a concept that was perhaps first popularised by the science philosopher Karl Popper in his book The Logic of Scientific Discovery . What are examples of scientifically falsifiable theories?

The Finnish 1000 PhDs pilot

Tue, 28 Nov 2023 00:00:00 +0000

The Finnish government is going to finance 1000 additional new fully funded doctoral positions, which would start in the academic year 2024/2025.The money (85000€/year for each PhD student) will be competitively distributed between Finnish universities, and some of that money will be used to pay for the salary of the PhD students for three years. Perhaps one of the triggers for this initiative is that Finland has been falling behind in the OECD statistics in the number of highly educated workers. The question is whether this one-time expense will really increase the level of education or only boost the numbers.The average duration of a PhD education is around seven years in Finland. In order to pull off a 3-year PhD education at such a large scale, it is expected that the requirements for the PhD will be lowered. As a matter of fact, the requirements have already been lowered, but further “easings” might still come. Together with these, universities are aiming to streamline the kafkaesque absurd and medieval administration process, which can easily take half a year from the time of completing the last manuscript to receiving the actual PhD certificate.Many other outlets have reported about this pilot; here’s one that is available also in English: https://acatiimi.fi/2023/11/28/for-once/Although most people are happy about the additional money, almost everybody is sceptical to some degree. Good intentions are not enough, and there are many serious issues with this pilot:

Unbricking the Netgate pfsense SG-3100

Fri, 10 Nov 2023 00:00:00 +0000

The current process of restoring functionality on the Netgate pfsense SG-3100 router after an unsuccessful firmware upgrade is too difficult (although the device is magnificent otherwise). Today, I experienced the third failed upgrade within six years. Recovery worked every time without problems, but it should be MUCH easier if you want me to recommend this router to my less tech-savvy friends. To pull the recovery off, you need an 8-GB USB stick and USB cable with a high-profile micro-USB connector at one end and a regular USB-A connector at the other. These are the steps that you need to do to unbrick the device:

Bio-Rad fixes our NGC

Wed, 20 Sep 2023 00:00:00 +0000

UPDATE (situation Dec. 21st, 2024)

We just survived our protein purification course (DPDR-305, see also my other blog posts related to teaching . After having done about 25 runs with the “repaired” Bio-Rad NGC, I sadly have to conclude that the most significant issue remains: that the FPLC becomes unresponsive to commands issued manually. Also, the randomness of these disconnects persisted. Only one student group had problems, but we had several incidents during that single day. That, sadly, concludes our short stint into Bio-Rad territory for protein purification. All of this indicates that any further investments into this device will be wasted time and money. We have neither too much time nor too much money. If Bio-Rad wants to do anything from their own initiative, I am happy to let them do whatever it takes to get the machine into a usable state, but we won’t actively pursue any further actions.The best way to keep your FPLC device in good shape is to have a maintenance contract. Although we have been able to get money from our university to buy a top-of-the-line FPLC twice in the last 30 years, getting money for a service contract is much more difficult. One of the many reasons is that most grant periods are shorter than service contracts, which only make sense if you make them over several years.

Helsinki University dropped from top 100

Sun, 27 Aug 2023 00:00:00 +0000

The largest Scandinavian daily, Helsingin Sanomat, reported the last week that the University of Helsinki had dropped from the top 100 universities in the Shanghai ranking . Now several Finnish academicians have responded . The take-home message of the response could be summarized as *Don’t take these rankings seriously!*Are these rankings really a meaningless indicator of university quality, just a part of the “attention economy”? This is certainly true for those rankings that are not completely transparent about how the ranking procedure works. And for those that are opening up their methodology completely, Goodhart’s Law still applies: When a measure becomes a target, it ceases to be a good measure. Everything is good then, despite Helsinki University’s downfall from the upper echelons of academic research, right? Perhaps not. The many university rankings ( Shanghai , THE , and QS being perhaps the most influential) are just one of many targets that Finnish universities aim at. Another - and perhaps a practically much more important one - is the scheme according to which the Finnish Ministry of Education distributes money among Finnish universities. This scheme might be the secret driver behind the decline of Helsinki University. Under the Sipilä government (2015-2019), the distribution criteria were changed so that the number of produced degrees increased in importance while scientific research (as measured by publication output) became less important. Helsinki University is very research-focused. As a matter of fact, after the changes to the money distribution scheme, Helsinki University’s research output reaches the maximum yearly points that can be given typically at the end of the summer. All publications after that until the end of the year do not improve Helsinki University’s standing compared to the other domestic universities. In Finland, the money from the ministry is very important since they do not operate on multi-billion-dollar endowments as most large US universities do. The HS article specifically mentions that these rankings are not a good way to measure the quality of teaching and, thus, should not influence students’ decisions about where to study. However, some rankings do have meaningful metrics. For instance, the THE ranking compares the ratio between students and teachers. Obviously, if a university does not have enough teachers, it will not be able to deliver good teaching. Bad teaching is neither good for students nor the NYT ranking. I agree that some rankings include questionable practices, such as asking more-or-less randomly selected scientists about what universities they think are the best in their fields. I myself have been contributing to such a ranking in 2021. I tried to skew the needle in favour of Finland and Germany as much as I ethically could justify to myself. Although flawed, I would not completely dismiss rankings. The HS article concludes with a similar sentiment: that the displacement of Helsinki University from the top 100 should be a warning sign to the present government to finally put Finnish Universities on equal grounds with the other Scandinavian (Swedish, Danish and Norwegian) universities which have not suffered from nearly two decades of declining funding. However, this warning sign comes very late, although the decline has been obvious for quite some time for those following university news. The funding situation has already resulted in irreversible losses of human capital. When the purchase-power-adjusted funding for the University of Helsinki went down for the first time, everybody knew that it would take many years before the effects of the funding cuts would become blatantly evident. It finally happened, with a delay of more than ten years. Thanks to all the politicians that have contributed since 2005 by not doing anything, doing not enough or even actively supporting the dismantlement of Finnish academic research. 2005 was the year when I realized that university funding had declined for the first time in real terms.

Did we publish in a predatory journal?

Thu, 03 Aug 2023 00:00:00 +0000

When I get a manuscript review request, I first look at the journal where the request comes from. More often than not, I do not know the journal’s name. After all, perhaps 25000 scientific journals are published on our planet. If the request comes from a predatory journal, I mostly reject it. Sometimes I accept to expose myself to the nonsense deliberately (it’s at the same time funny and frustrating). But how do you know whether a journal is predatory or not?The question has been asked a lot over the last few years, e.g. in this Nature commentary . In the article, leading experts have come up with a definition. Predatory publishers:

Bicycle parking on the Viikki campus

Mon, 31 Jul 2023 00:00:00 +0000

We have new bicycle storage spaces in Viikki, about 400 of them. While this sound good at first, let’s look at the details:The access-controlled parking spaces are subject to a fee. I assume it is still “allowed” to park your bicycle outside these access-controlled spaces. However, the Flamma text seems to implicate that all parking on campus areas requires a permit: “There is a fee for parking on all Helsinki campuses.” ( https://flamma.helsinki.fi/en/group/tilat/pyoraily-pysakointi-ja-julkinen-liikenne ). This could have been written a bit more clearly, but I guess the writer had (only?) cars in mind.The Flamma article claims that 36 free-to-use bicycle racks were also installed in the non-heated, outside space in the underpass behind Biocenter 2 (which used to be the gathering space for electric and electronic waste). Yes, but that possibility existed before and has been used before. It’s right next to the smallest (48-rack) access-controlled parking space, the only one where I finally spotted a bicycle. Using the access-controlled parking makes sense if you have an expensive bicycle. If you do, you likely don’t care about the yearly 30€ fee either: expensive bicycle parking for the rich. You pay for your parking via an app. I installed the app on my phone but did not pay the 30€/year fee. Why not? I have two issues with the fee:

Withings Body Scan smart scales

Thu, 29 Jun 2023 00:00:00 +0000

In 2009, we bought our first Withings smart scales. Although I tried them out at the time, I soon stopped using them because of their limited functionality. Now, more than ten years later, I believe that smart scales technology has finally advanced to the point where it is genuinely useful. What’s more, I now fit the target demographic for this device: I’m a middle-aged, overweight man with a family history of heart disease who does some sport, but probably not enough. To sum up in advance: I intend to use the Body Scan scales every single day from now on. Aside from some more useful and some less useful features, it reminds me that, once you reach a certain age, you need to actively maintain your cardiovascular health. Withings has recently launched three smart scales at different price points: the Body Scan, Body Comp and Body Smart. We received the top-of-the-range Body Scan model for review. It arrived four days before we set off on our summer holiday, which is why I haven’t tested all its features. Some features require a certain minimum number of repeated measurements, so this article may be updated once I’ve used the scales for a longer period. What can the scales do? Apparently, they can measure your weight and the composition of different parts of your body (body fat and muscle percentage). They also claim to be able to distinguish between visceral and subcutaneous fat. Not all fat is equally bad: visceral fat is much more dangerous than subcutaneous fat, which can even be beneficial. If the scales could reliably distinguish between visceral and subcutaneous fat in the body, it would be an astonishing technical breakthrough (more on this later). ECG FEATURE The Body Scan scales can perform an ECG (electrocardiogram), meaning they can measure the heart’s electrical activity. An ECG can be used to detect a wide range of heart problems, but the number of electrodes (measurement points) on the body is crucial for this measurement. The medical standard is 12 electrodes. For practical reasons, devices intended for consumers are less sophisticated, and therefore have only limited ability to detect different types of heart problems. The Body Scan device has 6 electrodes, which is the best currently available in a device intended for consumers. However, such a 6-lead ECG is significantly inferior to the standard medical ECG and may even fail to detect an acute, recent heart attack. In fact, the only medical conditions that this ECG can reliably detect are atrial fibrillation and atrial flutter. Atrial fibrillation is a heart rhythm disorder that can be detected by feeling the pulse (e.g. the heart beats twice instead of once). Atrial flutter is a somewhat similar condition, characterised by a rapid heart rate (> 250/min), which may occur episodically (lasting from hours to days) but can also be continuous. Both conditions require medical treatment, and it therefore seems sensible that a consumer device should be able to detect them. However, clinical studies show that the results of mass screening for atrial fibrillation are not clearly beneficial. Experts are, in fact, divided on whether mass screening is a good idea: the 2020 guidelines issued by the European Society of Cardiology recommend mass screening, whilst the US Preventive Services Task Force and the UK National Screening Committee do not currently recommend them. Although atrial fibrillation is fairly common, it is usually secondary to other heart conditions, and the target group for the Withings Body Scan (health-conscious, middle-aged, middle-class) may not be the group that would benefit most from this feature. In one study investigating atrial fibrillation (the so-called LOOP STUDY), did not use a device intended for consumers but rather sensors designed for professional use, which is a more reliable method for detecting atrial fibrillation. Furthermore, the study focused on individuals with risk factors for a heart attack. Unsurprisingly, the detection (and treatment) of atrial fibrillation tripled, but despite this setup, the study found no benefit in terms of a reduction in heart attacks or arterial embolisms.Some experts believe that there are different types of atrial fibrillation and that we simply do not yet know how to distinguish the dangerous types from the benign ones.In summary, it can be said (also based on some more recent data) that the benefit of the Body Scan ECG appears to be small. The benefit is likely to be significant only in high-risk population groups who are unlikely to use a €400 smart scale (e.g. the elderly).It is not yet known (as such devices have not become widely adopted amongst consumers) what the burden on the healthcare system is due to false-positive results. It is also worth noting that there is currently no digital infrastructure in place to enable the data generated by the scales to be transferred to a doctor for review. In fact, there is not even a standardised file format. Whilst there is an open data transfer standard (DICOM) for X-rays and similar imaging data, there is no equivalent for ECG data. All of the above explains why the Body Scan is not yet available in the US. The FDA has not approved it as a medical device. The regulatory frameworks and requirements differ between the EU and the US, but according to Withings, the Body Scan will become available in the US from the third quarter of 2023, following FDA approval. In Europe, the device ‘only’ needs to obtain the CE mark for medical devices. To obtain the CE mark, the device must meet certain standards, which depend on its classification. Body Scan is classified as a Class IIA device (which, interestingly, places it alongside dental fillings, surgical clamps and tracheostomy tubes). Conformity assessment is not carried out by the European Medicines Agency (EMA) but by independent accredited organisations (known as ‘Notified Bodies’). They analyse and certify the device’s safety and performance. Approval by the EMA and the FDA is essential, as it is naturally important to have independent confirmation that the device actually detects the arrhythmias it claims to detect, and so on. Here is a YouTube video from Medlife Crisis discussing the benefits of atrial fibrillation screening. The video focuses on the Apple Watch, but in principle the same applies to any consumer device: https://www.youtube.com/watch?v=rW3DGnHO2iY&t=719s DETERMINING BODY COMPOSITIONBody composition data is extremely useful for assessing your health and fitness levels. An easier measure to use is the body mass index (BMI), which requires only your height and weight to calculate: (weight in kilograms)/(height in metres²). Although BMI correlates with health, there are many exceptions, particularly concerning very fit individuals with a high amount of muscle mass (who are often technically overweight), and lean individuals with little muscle mass (who are not technically overweight but may still have too much body fat). A much better measure of fitness is body fat percentage, which this scale determines using bioelectrical impedance analysis (BIA). The scale measures the percentages of fat and muscle mass in the torso and other body parts. Put simply, this means that the scales send electrical impulses through the body. As fat conducts electricity less efficiently than muscle, the scales can deduce the amount of fat between two measurement points. Unfortunately, BIA is not a particularly accurate method for determining segmental body composition. To truly know where the fat is located, and in particular to distinguish between visceral and subcutaneous fat, the gold standard is magnetic resonance imaging (MRI). At present, however, this method is rarely used for this purpose outside of medical research, and it is also very expensive. A less accurate method for measuring body fat percentage is dual-energy X-ray absorptiometry (DEXA/DXA), which is primarily used to determine bone mineral density, but which can also be used to measure body fat percentage. However, DEXA has difficulty distinguishing between subcutaneous fat and visceral fat (if you wish to have this type of analysis carried out, you should ask your service provider what data their device provides). To obtain segmental body composition data, you’ll need a smart scale from the Body Scan range. The Body Comp and Body Smart models do not offer this feature. The big question is: how do the scales carry out this measurement, and how reliable is it? There isn’t much information available, except that the scales use multiple frequencies to improve measurement accuracy. Thanks to the BMI calculated from the arms and legs, the segmental body composition is probably reasonably accurate. However, it is completely unclear how the scales determine the percentage of visceral fat. There are no explanations, patents or – most importantly – scientific publications that would validate the technology against the gold standard of MRI. The percentage of visceral fat is also displayed separately from body composition, which may suggest that this measurement is taken using a different method. Paradoxically, the legendary six-pack is not a good indicator of fitness: if there is fat covering the six-pack muscles, you cannot see the six-pack, even if it is there. However, the fat covering the muscles is not the most dangerous type of fat. The dangerous fat is found beneath the six-pack muscles, in the body cavity where your organs are located. You may have a visible six-pack despite the fact that dangerous fat has accumulated on and around your vital organs (liver, kidneys, intestines, etc.). The body fat percentage determined by the scales is probably reasonably accurate. However, without external validation, I suspect that the visceral fat index shown to me by the scales is nowhere near a meaningful value in reality. What does this ‘visceral fat index’ actually mean? According to the explanation, it is a value between 1 and 20. But what is it? I would understand if body fat percentage were broken down into visceral and non-visceral fat (but that figure would be between 0–100 per cent). As long as it remains shrouded in obscurity, this value is likely to be rather useless (and I’ve seen it fluctuate quite rapidly from one day to the next, which suggests it isn’t very reliable). ASSESSING THE RISK OF CARDIOVASCULAR DISEASEWhen it comes to cardiovascular disease, the three major risk factors are:

Germany's responsibility

Tue, 27 Jun 2023 00:00:00 +0000

It is difficult to spend vacation in Poland without coming across a concentration camp from Nazi-Germany. It happens to me every single time.Last time it was Stutthof , this week Płaszów. In Cracow, during my daily running, I suddenly saw the sign shown in the image next to the trail.,Remembering is one thing, but more important is to fight today’s fascism in all of its incarnations . Germany’s government should remember that Hitler’s expansionism was only stopped by concerted military action.

Congratulations, Dr. Khushbu Rauniyar!

Sat, 10 Jun 2023 00:00:00 +0000

Defending a PhD thesis is a BIG thing in Finland, and you just did it. Unlike the rest of the world (perhaps except for Sweden), no other country requires as much demonstration of perseverance from PhD candidates as Finland does. On average, it takes four publications and 7 years. The long duration and the lack of well-defined requirements are two problems the Finnish Ministry of Education wants to address over the next few years to level the playing field for Finnish PhD graduates in the international job market. Completing a PhD in Finland takes a lot of Sisu. Sisu is a Finnish word which cannot be translated into any other language, but the recent movie with the same title can give you an idea. Wikipedia defines Sisu as extraordinary determination in the face of extreme adversity .In the “old times”, drugs were discovered based on their effects while not knowing their mechanism of action. This paradigm is more and more turned on its head. Researchers try to understand the mechanism that leads to disease before they start developing or finding a drug. Much of Khushbu’s thesis is about better understanding the mechanisms that govern the action of the primary lymphangiogenic growth factor VEGF-C: The evolutionary origin, activation, and potential as a drug target . Prof. Eckhard Lammert did a great job as the opponent, and Prof. Kari Keinänen did the same as the custos. Dear Khushbu , we wish you all the best for your next big project!

Dynamic DNS with DomainDiscount24 and pfsense

Sat, 27 May 2023 00:00:00 +0000

Many companies offer free dynamic DNS. But since I use DomainDiscount24, I also use their dynamic DNS service. To update the IP address of vpn.jeltsch.org, I need to send an https request to a specific URL, including a password and the hostname for which I want the update:https://dynamicdns.key-systems.net/update.php?hostname=vpn.jeltsch.org&password=12345678&ip=autoTo automate this, I use the crontab of my pfsense router. Editing the crontab is not enabled by default, but you can download and install the cron package. After that, you get a GUI under “Services > Cron”, where you add the timing and the command:/usr/local/bin/curl "https://dynamicdns.key-systems.net/update.php?hostname=vpn.jeltsch.org&password=12345678&ip=auto"

The human genome was just completed (again)

Mon, 15 May 2023 00:00:00 +0000

More than 20 years ago, the human genome was

completed

(Lander et al., 2001) by the Genome Reference Consortium (GRC). This assembly is known as the GRCh38 reference sequence. Although it is based on DNA from an anonymous group of donors, ⅔ of its sequence is derived from one single male donor of African-European ancestry (Genome Reference Consortium, 2023).*

Cutting-edge vascular biology continues at the Wihuri Research Institute

Wed, 10 May 2023 00:00:00 +0000

Taija Mäkinen has been appointed to become the Wihuri Research Institute (WRI) Director starting in 2024. Like the current director Kari Alitalo , Taija has outstanding expertise in lymphatic vascular biology. Taija is currently doing research in Sweden at Uppsala University . With her contributions, she has revolutionized our understanding of how lymphatic vessels form and grow ( 10.1016/j.celrep.2015.02.026 , 10.1161/CIRCRESAHA.116.306170 ).The Wihuri Research Institute , located at Biomedicum Helsinki, was founded and is funded by the Jenny and Antti Wihuri Foundation . It focuses on cardiovascular and vascular biology. This research is essential for the development of new treatments for heart disease. However, blood and lymphatic vessels penetrate nearly all body organs and play a role in almost all diseases, including inflammatory and infectious diseases, neurodegenerative diseases, cancer, and vascular malformations or hypoplasia. Therefore, the research done at the WRI opens avenues for treating many diseases beyond heart disease. The Board of Trustees of the Jenny and Antti Wihuri Foundation has made an excellent choice, even though I am biased for many reasons. I do similar research, and I worked in the same lab as Taija during our Ph.D. education. Unnecessary to mention that Taija graduated faster than I did …

OMG: T. rex did not have VEGF-B!

Wed, 05 Apr 2023 00:00:00 +0000

Our work on the evolutionary origin of the PDGF and VEGF growth factors has just been published in Angiogenesis: https://doi.org/10.1007/s10456-023-09874-9 . We analyzed both PDGFs and VEGFs, but our focus was naturally on the VEGF side of things. It’s just a coincidence that the PDGFs happened to be a subgroup of the VEGFs and not vice versa, but that’s of course just our biased point of view :-)Since we do lymphatic research, we can proudly announce that the phylogenetic oldest VEGF likely resembled VEGF-C and featured the enigmatic silk homology domain. It makes intuitive sense (and had been proposed before by Jörg Wilting), because the most simple vascular systems that we know of are the so-called hemolymph systems (e.g., in insects), which share many features with the lymphatic system.With this publication, we did not do something exceptional that only a few can do. We did something everybody could do but nobody had done so far: looking systematically at which animals have which PDGFs and VEGFs. Actually, we did something new: we developed a crowdsourcing method for classifying PDGFs and VEGFs. Instead of asking people, we asked databases. There are many PDGF-like and VEGF-like sequences in databases, which are only recognizable as such by the homology of their amino acid sequence. In order to know whether we are dealing, e.g., with a VEGF-C or a VEGF-D, we are running many (PSI)BLAST searches, and then we tally up the majority opinion (as determined by the top hits).Many surprises waited for us after the bioinformatics script had finished its job after two weeks of finding and comparing PDGF- and VEGF-like sequences:

Bad vibes from the new tram

Sat, 01 Apr 2023 00:00:00 +0000

Our showers were banned from use due to the new tram line running in front of my workplace, the Helsinki University Viikki campus. During the trial runs of the tram, I noticed cracks in the changing room’s wall and the showers. I reported these cracks sometime in February to our janitors. Apparently, the structural damage includes the wastewater pipes, and that’s why we can’t have showers anymore. That is a bummer, especially in the summer. To my understanding, the condition of the university buildings had been documented before the construction of the tram line started. Now the investigation is underway to determine whether the additional damage was caused by the construction or the trial runs (and who has to pay for the damage repair).Since I either cycle or run to work, I need to take a shower every morning. My morning routine has become more difficult since the replacement showers have no place where I can hang my wet clothes and towel for drying. While this causes some inconvenience, there will be more serious consequences if there is a causal connection to the tram operation: The university has expensive research equipment, which is sensitive to vibrations. It is incomprehensible how the top university administration could have agreed with the city of Helsinki to run the tram line directly in front of the University building. In fact, the tram now makes a detour to go along Viikinkaari. The more natural and shorter route would have been about 200 meters South of the current track (along Viikintie), avoiding all this trouble. In order to build the tracks directly in front of Biocenter 1 and 2, millions of additional Euros were wasted on vibration-dampening elements to protect our high-end equipment from vibrations. And perhaps all that money was wasted if it should appear that the efforts were insufficient.

GPT-3 is hallucinating again

Tue, 07 Mar 2023 00:00:00 +0000

On the weekend, I needed to finalize my report for UP (University Pedagogy) 3.1 course. Since we had talked much about the usefulness of formal supervision agreements, I wanted to see whether some empirical research supported our ideas. Since our University had discontinued its subscription to Iris AI (an AI-driven literature research tool), I decided to ask GPT-3. I headed over to the GPT-3 playground and asked:"Can you find me five literature references that show the usefulness of a supervision agreement in an academic environment?"It quickly returned five references (see picture). I then asked for the DOIs (I am using Zotero for reference management, and Zotero can easily pull down full-text references if you give it a DOI provided the paper is not behind a paywall).When I tried to download the references, Zotero complained “Zotero could not find a record for the specified identifier. Please verify the identifier and try again.“So I VPNed into the university network to access the article directly from the paywalled publisher’s (Taylor & Francis) website. However, when I browsed the correct issue of “Studies in Higher Education” (2005, volume 30, issue 5), there was no such article. No such author. Nothing remotely looked like the reference it had promised.GPT-3 made up these superficially sound-looking references out of thin air. However, on close inspection, the articles are weird: each has only one author (rare, but not impossible), all authors are doctors (IRL most authors are Ph.D. candidates), and all authors list exactly one middle name (possible, but unlikely). When confronted with the fact that the DOIs are bogus and that they do not resolve to any published article, GPT-3 first claimed that I was not able to access the articles because they were behind a paywall. When I repeated this experiment for the sake of taking screenshots, GPT-3 apologized and promised to fix the mistake. When pointing out that the mistake cannot be fixed since the articles were fictitious, GPT-3 crashed.This behavior makes sense: Similar to how it finds information on any topic and nicely merges it into an answer, it found many references and merged them into a “new” answer. But since the algorithm doesn’t “understand” anything, it doesn’t realize that literature references must not be modified in any way. I am expecting this to be fixed soon as it is an easy thing to fix. GPT-3 is just a clever amalgamator and regurgitator, and this seems to be just a special case of hallucination.Take-home message for students: Do never trust GPT-3 to give you accurate information. Others have also reported that GPT-3 hallucinates often and quite badly .

Showdown: GE Healthcare's Äkta versus Bio-Rad's NGC

Tue, 07 Feb 2023 00:00:00 +0000

I have been purifying proteins since 1996. I worked on an Äkta Explorer until 2015, when we upgraded to the Äkta Avant . In 2020, my lab moved, and we inherited a Bio-Rad NGC , which we have been using now for 2 years.We encountered many problems with the Bio-Rad NGC. At first, I thought that this might be normal when switching systems. I expected the problems to disappear one by one. After all, we also had problems when we switched from the Explorer to the Avant.However, even after two years and dozens of purification runs, the problems with the NGC don’t seem to stop. Whenever ẃe solve a problem, a new, previously unknown problem appears. And differently to GE Healthcare, Bio-Rad’s customer service is not even close to what we have experienced with GE Healthcare. When our IT could not connect the Äkta to our university’s network, GE Healthcare sent an engineer from their Munich crew to Helsinki to fix the problem. Appreciating the learning curve, GE Healthcare also offered free participation in one of their courses for somebody from our team. And their support was not limited to the warranty period! They really wanted us to be happy with their device. We don’t experience the same amount of support from Bio-Rad. It always feels like we have to coerce them into solving the problems we have with the NGC, and their response time is well below any customer expectations.This is the first of several blog posts about Äkta versus NGC. I hope will find the time to write in more detail about all our issues over the next few months.We decided in 2015 that we finally needed a new FPLC. Our Äkta Explorer was reaching end-of-life, and we had received about 100k funding to renew the FPLC of our core facility . The device was expensive enough that we needed to go through the official tendering process (at the time, the limit was 30,000 €, but it has been increased to 60,000 € by now). There were only two contenders: The Bio-Rad Discover NGC and the GE Healthcare Äkta Avant. The Bio-Rad was cheaper (82,810 € versus 95,470 €), but we decided to purchase the GE Healthcare device. One important reason was that all our users had been using the Äkta Explorer and its Unicorn software. Switching would simply be disruptive and require lots of support and time from our side. However, there were also technical reasons that made us prefer the Äkta over the NGC:Äkta Avant’s advantages

Review: Wenger Synergy rucksack after 5 years of daily use

Sat, 21 Jan 2023 00:00:00 +0000

I am a fan of rucksacks with many pockets. No wonder I like the Wenger Synergy , which has been on the market for over 10 years with only minor modifications. However, I had my fair share of quality issues with this model. Unlike my >40-year-old Swiss knife, this rucksack kept breaking within its warranty period or soon after. It was never a problem exchanging it when it broke within the warranty period, but I got fed up with the exchange hassle after doing it twice. The rucksack’s failing part was always the same: the seams of the shoulder straps started to open. I reported the issue directly to the producer, hoping they would change something to improve the shoulder straps. However, when also the third rucksack developed the same problem, I decided not to exchange it but to fix it. My fix is optically not very pleasing, but it has lasted long enough that I can report the second point of failure: the bottom pane. It ripped where the bottom piece contacts the backplane of the rucksack. I also repaired that one because I was interested in which part would fail next. The upside: these repairs were quick and easy, and they have already lasted for 4 months without any sign of failure due to the high-quality material. The zippers limit the ultimate lifetime of perhaps all rucksacksNow I know: the zippers are starting to have problems. I am surprised that the zippers are still sort of working. The zippers have been the Achilles heel with almost all of my other rucksacks. And unlike a shoulder strap, it takes quite an effort to fix (= exchange) a badly failing zipper. This rucksack is now five years old. I have been using it literally every single day. I cycle or run with it to work, and I do my shopping with it. I travel with it and take it to the summer cottage. Am I expecting too much of a ~100€ rucksack? Is five years’ lifetime the maximum I can get out of a rucksack these days? Sustainability is mostly just lip service, whatever the industry. I am determined to keep this rucksack for another 5 years, but exchanging the zippers will cost me at least 2 to 3 hours of work. As a quick fix, I used pliers to tighten the top and bottom wings of the metal slider (like in this youtube video ). That has been working, but according to my experience, this tightening needs to be repeated in increasingly shorter intervals, and finally, the metal will break. To avoid replacing the whole zipper, you can add buttons to create a new closure , which is perhaps less work if you are not very skillful at sewing.

Why are most scientists coffee addicts?

Wed, 04 Jan 2023 00:00:00 +0000

Last week I went electric after perhaps 25 years of making coffee without a coffee maker directly powered by electricity. I have made my coffee with the iconic Italian-style stovetop espresso maker I bought in 1990 in Debrecen, Hungary. Or with the Aeropress . Or, perhaps mostly, with a $2 coffee funnel. My espresso maker is a knockoff, but it still works perfectly today; I just had to replace the seal once. The espresso maker, the Aeropress, and the$ 2 coffee funnel make excellent coffee, and the OBH Nordica has therefore serious competition.The first thing that I learned was that the Swedish/Danish OBH Nordica is not anymore Nordic, but a part of Tefal , which in turn is part of Group SEB . Now that is not in itself a bad thing. But whenever you buy a European brand kitchen appliance, you will mostly buy from the same company independent of the brand name: Krups, Moulinex, Rowenta, Tefal, OBH Nordica, and WMF: they are nowadays all part of the French Groupe SEB.Of course, you should buy European instead of buying from a low-priced Chinese competitor. But I still wanted to know which of these Group SEB products are manufactured “in Europe” versus “for Europe in China”. At least on this machine - the Blooming Coffe Maker - I could not find any “Made in” marking. When I went to obhnordica.com/blooming , I was greeted with a “Read more about the Blooming Coffee Maker - Choose your country” and when I clicked the Finnish flag (since I live in Helsinki), I end up in . So I decided to contact OBH Nordica via their web form to ask where exactly my coffee machine was assembled, and they very promptly answered that the device is made in China. So much for buying European, and I am feeling guilty now.

Mastodon

Fri, 30 Dec 2022 00:00:00 +0000

**You can ignore the following if you read this on Mastodon.**I have not been leaving Twitter yet. If it’s well-engineered, Elon Musk won’t be able to break Twitter, but it can still die a slow death (like Skype has been slowly dying ever since Microsoft bought it). But as a precaution, I have started an account on Mastodon. More specifically, on mastodo.fi . And it has been so far a pleasant experience. Most of the people I follow on Twitter are not on Mastodon (yet), but I am working on that! The science community has embraced Twitter ever since , and I get a big chunk of my science news via Twitter. It will take some effort to replace it.The one thing that might be putting off some users is that you actively have to find content. Nobody and no algorithm pushes content to you. And there is no single place to open an account. You can open an account on hundreds of different Mastodon servers ( https://www.pcmag.com/how-to/how-to-pick-a-mastodon-server ). I briefly contemplated running my own Mastodon server, but then I joined mastodo.fi because it is - like me - located in Finland. I am still learning how stuff works. Seriously: if you are not yet on Mastodon, please consider joining! And after joining, follow me @mjeltsch@mastodo.fi !

Turing test with exam answers: Can I sniff out the AI?

Thu, 29 Dec 2022 00:00:00 +0000

In the Finnish daily newspaper Helsingin Sanomat, GPT-3 and Laura Ketonen from the University of Jyväskylä discuss how AI will affect student assessment ( Tekoäly ravistelee opiskelijoiden arviointia , English: Artificial intelligence shakes up student assessment). One of the obvious “applications” of AI would be exam cheating.Laura’s opinion piece provoked quite a few reactions. Some answered that AI produces hollow text . Others mentioned that AI does not have courage and initiative . It feels like we, as a human species, will soon be struggling with a generalized inferiority complex.In a natural science exam situation at the BSc or MSc level, the initiative is with the teacher, and the students are, by definition, reactive. How do you define hollow text when asking to explain glycoengineering? In life science, courage and initiative are essential features for any aspiring scientist. But without a solid body of knowledge as the foundation, courage and initiative rarely will lead to impactful new developments. At this moment, we cannot yet outsource this foundation to AI. Hence, we require from students a solid body of knowledge from which courage and initiative can draw to flourish. Perhaps, low-hanging fruits can be picked with courage and initiative alone. But solving today’s problems requires, in addition, a solid body of knowledge (“standing on the shoulders of giants”).When judging AI, we likely make the same mistakes as humans do with all new technologies: We overestimate its impact in the short run but underestimate its impact in the long run. Over and again, (narrow) AI has managed to break into fields that were previously reserved for humans. There is no reason to assume that this development will not continue. It may well be that the presently dominant approaches to AI (deep learning, machine learning, neural networks, statistical approaches) will not lead to major future breakthroughs toward human-like general AI, perhaps even self-aware AI. We don’t even know how human consciousness comes about. On the other hand, I agree with Daniel Dennett’s idea that there might be no hard problem of consciousness: Consciousness is what you get when you have solved all the easy problems. In any case, if a non-self-aware AI becomes indistinguishable from a self-aware AI, what’s the difference, and how would we be able to know? I am sure that at one point, we will also be able to outsource our knowledge completely. With Google, we have even started to make baby steps in this direction, but we need a better computer-brain interface to fully embrace the concept of knowledge outsourcing. Deep Blue beat international grandmaster Garry Kasparov in 1997. I did not want to accept this human defeat and declared the game unfair: Deep Blue crashed and needed to be rebooted once during the 6-game tournament, which - in my opinion - was equivalent to the human dying during the game (or at least being reanimated by CPR). In 2016, computers surpassed humans in the game Go, and today, they beat humans even at games like poker, requiring sophisticated psychological trickery like bluffing. To test how AI compares to students in an exam situation, Patrick added one AI-generated answer to the students’ responses in a recently written exam. This idea gave the grading an exciting spin! I think I knew what the AI answer was. However, I had played with GPT-3 before and knew that - untweaked - AI is overly correct and systematic in addressing questions.E.g., in a 3-part question, the AI normally systematically answers all three parts. Also, the AI did not know the exact content of my lectures, which made identifying the AI answer relatively easy. Patrick still needs to reveal whether I identified the AI correctly…The AI (or what I identified as the AI) performed worse than the best student, but overall it did really well. Clearly, our future exam questions need to focus even more on critical thinking and fictional examples, which the AI cannot know from its vast pool of training material.But given the increasing amount of information that AI will access in the future, AI can rely on other people’s critical thinking. The next generation of AI (ChatGPT-4 and Google’s LaMDA) is already waiting for public release… With some tweaking, Patrick could have easily fooled me. Maybe he did already… If he instructed the AI to break the answering pattern intentionally and if he did train GPT-3 with my lecture slides as reference material, all my bets are off.I’ll let you know whether I succeeded in identifying the AI correctly when Patrick reveals which answers were AI-generated. UPDATE: I (as well as the other teachers) did correctly identify the AI answers. The general opinion among us was that if we had not been alerted to the fact that one of the answers was AI-generated, we would not have noticed. The quality of the AI answers depended on the type of question. It appeared that (at this moment) a relatively easy way to throw off the AI is to give information needed to answer the question in a graphical format. But I am sure AI will learn to integrate images with text very soon.

Inflation of Finnish postal service prices

Sun, 25 Dec 2022 00:00:00 +0000

The Finnish Postal Service (“posti”) justifies the sharp rises in letter postage prices with the sharp decline in letter volume. On the other hand, the volume of parcels has been compensating for the decline in the letter business. Notwithstanding their lucrative parcel business, Posti has also kept increasing prices for parcels. Unfortunately, equally neat statistics for parcel prices are impossible to assemble because Posti has constantly been changing the pricing structure. If you ask me, they also did this to obscure the price increase. With the last increase (19.04.2022), they, e.g., lowered the maximally allowed weight for parcels. Other previous changes include the maximum parcel dimensions and buying from the post office (versus the web), which has become significantly more expensive.The above graph shows the prices for the so-called “ikimerkki”. The ikimerkki is a stamp that pays for a regular letter up to a weight of 20g. This stamp has no fixed value but pays for the service also after future price increases. The pricing structure has also been changed a few times for letters, but much less so than for parcels. The last significant change was in 2017 when the postal service abolished the difference between priority and economy transport for domestic letters (the above statistics were assembled using the pre-2017 prices for priority letters).

Innoopeli Prize 2022

Wed, 21 Dec 2022 00:00:00 +0000

We - the steering group of the International Master’s Programme in Pharmaceutical Research, Development and Safety - received the Innoopeli Prize 2022 !The Innoopeli Prize is given for a significant contribution to teaching in our Faculty. Although biased, I think the award is well justified since we offer many new courses, update existing courses, and translate courses from Finnish into English. It’s been heavy lifting, but we can already see some results in the form of really smart and engaged students, which we managed to recruit!From our programme director Leena Hanski: “In January 2021, we started the work as a steering group, with no learning objectives, curriculum, admission criteria, or even website, not to mention a single decision on practical arrangements for running the programme. We still have plenty of work in front of us, but I am convinced we can keep up the pace and make this programme a great place to polish the future stars of pharmaceutical research, development and safety. Our first set of students has been a great source of inspiration and motivation for many of us, and I also want to specifically thank them for their openness and willingness to share their stories, thoughts and expectations.”

Winter cycling is not for the faint of heart

Sat, 10 Dec 2022 00:00:00 +0000

Helsinki planned to make private car ownership unnecessary by 2025 . In the image, you can see reason no. #534 why this won’t work: The streets and pavements are kept snow-free in winter, but the bicycle roads are made for storing snow and parking cars. Cycling to the city center is always a pain, but in winter, it’s only for suicidal masochists. About every 50 meters, you encounter an obstacle that requires utmost alertness and creativity to bypass unharmed. Helsinki city center is dying as a result of Covid-19. Good so! The less I have to visit it, the better. The cycling conditions South of Sörnäinen are prohibitively appalling, with the only exception of the 1.3 km long baana between Kiasma and the edge of Ruoholahti (where I rarely need to go). Transport and food are the two biggies when it comes to the responsibility of the individual for global warming. Consequently, Helsinki - a pioneer in sustainable urban development - will increase ticket prices for public transport next year to encourage people to switch from car to bus or metro.

Bioactive VEGF-C from E. coli without in-vitro folding!

Fri, 28 Oct 2022 00:00:00 +0000

Our article Bioactive VEGF-C from E. coli has been published in Scientific Reports. Read here: https://doi.org/10.1038/s41598-022-22960-0.As a matter of fact, I did the first experiments expressing VEGF-C in E. coli in 1999, but never got active protein. In the following 15+ years, we exclusively used eukaryotic cells (yeast, S2/Sf9/Hi5 insect cells, CHO) to produce VEGF-C. We reactivated the “VEGF-C in E. coli” project a few years back and we finally reached our goal last year. However, it was much more work than we originally anticipated. In the beginning, all attempts went South, and to rescue the project, we developed an in-vitro folding protocol. It was perhaps more luck than ability that we stumbled upon a combination of solubility tag and redox-modified E. coli strain that can pull off the trick to produce directly bioactive VEGF-C without the need for an in-vitro folding step. We decided to include also our unsuccessful attempts (CyDisCo and periplasmic expression) in the results section to avoid the file drawer effect.

Making the cut: Why VEGF-C != VEGF-C

Wed, 28 Sep 2022 00:00:00 +0000

Yesterday, I talked about VEGF-C in the Zoom Lymphatic Seminar series, which is organized by Young Kwon Hong . Since there was not much time to ask questions, I am happy to answer them via email. If you have missed the link to the presentation slides, here it is: https://mjlab.fi/c . The take-home message: Many different mature forms of VEGF-C can be generated from pro-VEGF-C by proteolytic processing (and the same is true for VEGF-D). These forms behave VERY differently from each other. The extreme case is activation by Cathepsin D (CTSD): When activated by CTSD, VEGF-C becomes almost exclusively lymphangiogenic, while after activation by the same protease, VEGF-D becomes exclusively angiogenic. The detection of CTSD-activated VEGF-C is difficult because all well-functioning antibodies recognize epitopes N-terminal to the cleavage site (or they straddle the cleavage site). The second talk was by Barbara Garmy-Susini , and her topic was a nice fit since she talked about using VEGF-C in the therapy of lymphedema. But as we know already from VEGF-A, vascular growth factors alone might be not sufficient to generate a functional vasculature…

The evolution of PDGF/VEGF growth factors

Thu, 22 Sep 2022 00:00:00 +0000

We have uploaded a preprint of our most recent manuscript about the evolution of PDGF/VEGF growth factors to bioRxiv. We comprehensively analyzed the PDGF/VEGF part of the proteome in all animal species for which data is available. We have had some of this data already for a while, but now we enhance it with a detailed look at fishes. The vascular biology of fishes has become even more facinating after the publication of Das et al. earlier this year ( read more about this exceptional piece of work ).The remarkable heterogeneity of vascular systems in fishes seems to be supported by a similar extensive heterogeneity at the molecular level. Often, but not always can this genetic heterogeneity be traced back to whole genome duplications. Fishes tolerate full genome duplications better than mammals. At least there have been quite a few such duplications in various branches of the fish phylogenetic tree resulting in polyploid or even tetraploid species. That has resulted in some fish species featuring 4 times as many PDGF/VEGF genes compared to humans, and much more opportunities to diversify the functions of these molecules.The very first PDGF/VEGF-like molecule appeared likely more than 800 Million years ago during the Precambrian period when marine organisms started to show signs of tissue organization. If we set out to reconstruct this molecule, it would look remarkably similar to a modern VEGF-C. Specifically the C-terminal “silk homology domain” seems to have been invented early on in evolution. In fact, a large number of extant morphologically simple organisms feature such VEGF-C-like molecules still today (e.g. the nematode C. elegans). Beyond these insights into the evolution of PDGFs and VEGFs, there are some useful take-home messages for vascular biologists: For example, we did not find any functional VEGF-B genes in birds. Similarly, there seem to be no PlGFs in amphibians. Then, on the other hand, the VEGF-Fs - identified from snake venoms - appear to exist more broadly also in non-venomous lizards. This poses some limitations on some animal models (Xenopus, CAM assay), but it would be nice to know what VEGF-F is doing in geckos…Have a look at the manuscript and please comment or criticize, if you have any thoughts! The idea is to make this manuscript still a bit better before submitting it to a journal for the traditional peer-review.

Doing research without deep knowledge

Mon, 12 Sep 2022 00:00:00 +0000

Dear Professor Jeltsch,My name is Shahid, and I am studying Medicine. I am interested in molecular biology and biochemistry. Sadly, my curriculum does not include many modern molecular biology research techniques. Still, I want to learn about this area to the extent that makes me comfortable putting forward a hypothesis and a possible treatment for a disease. My goal would be to test this hypothesis with the help of a research team of molecular biologists and other experts. Therefore, I don’t need deep knowledge. With this letter, I am asking a professional researcher like you to point me to resources that would allow me to acquire the necessary expertise for such an endeavor. What would be suitable books or materials to study? I should also mention that I have access to all the significant scientific publishers via our university library.Thanks for our assistance,ShahidI received the above request via email a few months back. I always encourage students to go beyond what the curriculum offers. That is not to say that a good “run-of-the-mill” education does not enable you to be part of a productive team. But without going beyond the curriculum, it isn’t easy these days to have any lasting impact on anything. So far, so good. The red flag in the above email is this sentence: “Therefore, I don’t need deep knowledge.“When treating most diseases, low-hanging fruits have been picked. There are two approaches when trying to reach the high-hanging fruits:

The 12-month embargo falls

Wed, 07 Sep 2022 00:00:00 +0000

Under Barack Obama, the 12-months-rule was instituted, which demands that any research that is using US-federal funding must become freely accessible to the public at the latest 12 months after its publication ( https://www.science.org/content/article/white-house-unveils-long-awaited-public-access-policy ). A new executive order by Joe Biden is now getting rid of the 12-month-rule requiring immediate availability starting at the latest on December 2025. Other notable improvements of this executive order concern the requirement for machine readability, metadata annotation, and raw data availability. Furthermore, these new rules do not only affect journal articles but include from now on also book chapters and conference proceedings ( https://www.theverge.com/2022/8/26/23322194/white-house-ostp-open-access-federal-research-policy-update ).Many for-profit publishers object because their license to print money is slowly eroding. What they do not mention is, that the highest-skill work done in the whole publishing business - namely article writing and peer review - is still done entirely for free by academics around the world. If publishers would need to pay market prices for authors’ and reviewers’ working time, they would - without exception - all go bankrupt within a year. Every academic spends a significant amount of working time on writing and reviewing other academics’ manuscripts WITHOUT ANY REIMBURSEMENT. In fact, many of us do this job in the evenings and on weekends, because we are fully booked with grant application writing, administration and teaching during our regular working time. Many of these manuscripts are then published by for-profit publishers, which go on to monetize the results of research write-ups and the peer review process, which has been paid by taxpayers’ money.Some for-profit publishers do a valuable and fantastic job to improve the accessibility and quality of their authors’ works. Others seem to be in it mostly for the money. Among the latter are unfortunately also many Open Access journals . The elephant in the room is SciHub. Even though my university pays for access to most journals I need, the access is so obfuscated and temporarily dysfunctional, that I frequently have to resort to Sci-Hub in order to get a PDF article from a journal, to which my university subscribes. Alternatively I have used ResearchGate and #icanhazpdf to get electronic reprints, but SciHub is by far the fastest and most reliable option. More about Sci-Hub: https://www.zmescience.com/other/feature-post/sci-hub-effects-academic-publishing/ .

Putin wants you to drive fast and much!

Tue, 19 Jul 2022 00:00:00 +0000

I drive rarely, and these days, I rent when I need a car. This summer we decided to spend a two-week vacation in a cottage at a lake in the middle of the Finnish forest. You need a car if you want to get around in the Finnish countryside. Public transport might be working well in the Finnish capital Helsinki, but it is for all practical purposes absent from the Finnish countryside. Filling up the tank of our rental car cost me more than 150€.Given that I could fill up the same tank for less than 75€ still a year ago, I expected that people adjusted their driving habits to save energy, the planet, and their wallets. But I was mostly wrong.Driving slower and driving lessEverybody, who has not been living under a stone, knows that the most efficient driving speed is somewhere between 50 and 90 km/h. The air resistance increases with the speed. This increase is not linear, but exponential. By speeding, you save a minimal amount of time by wasting an incredible amount of energy. Even though most drivers complain about the horrific gas prices, hardly anybody seems to adjust their behavior either by driving slower or by driving less. I would like to know what the reason is for this paradoxical behavior, it’s inexplicable to me. I know that some drivers like to drive fast (I belonged to this category when I was 18). But hey: then you should shut up and just pay for the “fun”!Infantile requests for state subsidiesSuddenly, people who usually defend our market economy are calling for state intervention to lower gas prices. WTF? Just because for the first time you realize that you yourself are subjected to the powers of demand and supply you forget your free market values and call for state intervention. The only way to solve the problem of rising gas prices is to trust the market. Unfortunately, in many countries, the governments are exactly acting against all experts’ advice and are artificially trying to lower gas prices, e.g. by lowering taxation (e.g. France, Austria, Netherlands). That keeps the demand artificially high, further widening the gap between supply and demand, which was causing the high prices in the first place.

"Bioactive VEGF-C from E. coli cytoplasm" preprint online

Fri, 01 Jul 2022 00:00:00 +0000

The preprint of our manuscript is online. We show how to produce bioactive mature VEGF-C in the cytoplasm of E. coli bacteria without the need for a folding step. It took us quite a while to get there, and we tried many things that did not work before we found a way how to do it. We describe also the methods that failed. It looks as if VEGF-C has simply too many cysteine residues that all have to pair up in the correct configuration. In the same manuscript, we also report a workable refolding method. Please have a look and give us some feedback: https://www.researchsquare.com/article/rs-1776636/v1 .

The eLabFTW electronic lab journal: ready for prime time?

Fri, 03 Jun 2022 00:00:00 +0000

Some love it and some hate it: the electronic lab journal (ELN). Already a decade ago, the prediction was that in 10 years the paper lab notebook would be a thing of the past. In reality, the majority of academic labs are still using paper in 2022. The transition has not been helped by literally hundreds of commercial offerings that are all mutually incompatible. We started to experiment with ELNs in 2013, testing a few commercial and open source solutions. The worst of the pack did not even allow us to test drive them before buying (e.g. LabVantage seems to think you won’t buy once you have tried it, and they are spot-on!). We settled on eLabFTW , an open-source project with the main development happening at the Institute Curie in Paris, France. It’s a web application built with PHP and MySQL. There is also a peer-reviewed publication describing it: https://doi.org/10.21105/joss.00146 and a general Nature Protocols review article, that discusses ELN implementation: https://doi.org/10.1038/s41596-021-00645-8 .Deployment for teaching at University of HelsinkiWith the recent update to version 4.3 , the final hurdle for large scale deployment has been taken. Everybody with a helsinki.fi account can now log into the system with university account credentials. This makes the onboarding of many new users much easier. I am planning to use the system for our new course “Recombinant DNA technology and genetic engineering”. At the moment, the server is only reachable from inside the university network. If you want to use it from home, you need to use a VPN. Over the years we have been accruing about 25 users, and it will be interesting to see how the system performs when the user numbers will double or quadruple. The system runs in a docker container on an Ubuntu 20.04 LTS virtual server, which we, unfortunately, cannot upgrade or extend without additional financial support. So if you are interested to use an ELN, secure your spot today by logging into https://elab.ltdk.helsinki.fi , using the “Login through your institution” option on the bottom. You will have the option to choose a team. The team administrator needs to approve you before you can use the system. If you cannot find your lab among the teams, it means that you are the first user from your lab using this system. In that case, you should choose the team “Helsinki University” and contact me via email ( michael@jeltsch.org ), because I will need to register a new team for your lab, and you will be the administrator of this new team.Access for visitorsIf you do not have a University of Helsinki account, you can still use the system if you are inside the Helsinki University Eduroam network, but you will need to use the “Register now” link, and your account needs to be approved by a system administrator.Running it on your local machineThe system requirements of eLabFTW are fairly low, and your laptop is likely to have no problems running a local copy of the docker container. While installing eLabFTW on a recent Windows or macOS computer is possible, it is somehow counter-productive as it does not provide network accessiblity and team functionality. Even if you don’t need any of that, I would suggest that you repurpose an old desktop computer for this task and run it on a regular Linux server installation. I am happy to answer all possible questions that you might have (from a system administrator’s and end-user’s perspective).

Lymphatics as the origin of the fish secondary vascular system

Thu, 26 May 2022 00:00:00 +0000

In zebrafish, the blood vessels of the anal fin develop from lymphatics by transdifferentiation. Karina Yaniv presented unorthodox, but very compelling data supporting this conclusion last September at the Kloster Seeon Angiogenesis meeting .Now her paper has been published in Nature .

PhD thesis defense about hepsin's role in breast cancer

Sun, 24 Apr 2022 00:00:00 +0000

Last Saturday, Denis Belitškin defended his Ph.D. thesis. The topic was The role of type II serine protease hepsin in breast cancer signaling . I thoroughly enjoyed the discussion with the opponent Karin List , which happened over Zoom with only a small real-life audience. Proteases have slowly become one of my favorite protein classes. In the old days, they mostly were appreciated for their degradation function, but it is meanwhile clear that they are much more complex. My own interest is their role in the activation of signaling molecules. In this context, proteases are signaling molecules, playing at the same level as hormones, cytokines, and growth factors. Thanks, Denis for a convincing performance and the karonkka!

Best poster award for Khushbu (annual GeneCellNano flagship meeting)

Fri, 22 Apr 2022 00:00:00 +0000

Last week, with a delay of 2.5 years, the GeneCellNano flagship partners finally met for the first time in real life. This meeting was overdue, and there were many very interesting talks among others from the Finnish Red Cross (about cancer immunotherapy) and UPM Biomedicals (about their biocompatible cellulose products). Lots of new ideas and some concrete plans for further collaboration. We participated with two posters, and - a bit unexpectedly since the project is still in its infancy - Khushbu Rauniyar from our lab won the best poster prize. Congratulations!

Wake on LAN from pfsense commandline

Sun, 17 Apr 2022 00:00:00 +0000

Pfsense is an extremely powerful firewall/router OS. I use the SG-1100 device and you can get lots of customized functionality due to the many packages that you can additionally install on top of the base configuration. I have just learned that I can use it to remotely switch on other computers that are on the same local network. Requirements:

Risk versus hazard

Sun, 10 Apr 2022 00:00:00 +0000

Last week I failed to explain the difference between risk and hazard. Perhaps because the distinction does not exist that clearly in my mother tongue (German). Both hazard and risk are somewhat exchangeably translated to “Gefahr” or “Risiko”.Anyway, when I went to the kitchen this morning to make my morning coffee, I realized there was a hazard: somebody had left some flammable items on the hot plate. This is a hazard. It has the potential to cause harm. However, it might never cause any harm.But is leaving flammables on the hot plate also a risk? Sure! The risk is the likelihood of harm happening. If the hot plate is never used because nobody ever cooks, the risk might be low. However, if small kids are around who get a kick out of switching on and off electrical devices, the risk might be high. Risk can be quantified. Playing Russian roulette comes with a risk, which can be quantified: 1/6 for every pull of the trigger. A hazard has always a probability of 0 or 1 (it either exists or doesn’t). On top of the probability, risk also implicitly includes the severity of the mishap. Therefore Russian roulette is very risky, but jumping from the 3-m diving board is not so much, even though there is a risk that you injure yourself.

How to reset the admin password in Drupal 9

Sat, 09 Apr 2022 00:00:00 +0000

Go to the base folder of the drupal installation
Generate the hash for your password: php core/scripts/password-hash.sh ’newpasswd'
Execute in mysql: UPDATE users_field_data SET pass=‘hash_result_from_previous_command_goes_here’ WHERE uid = 1;
Clear the cache: DELETE FROM cache_entity WHERE cid = ‘values:user:1’;

University helpdesk recommends Zotero, but does not provide meaningful support

Sun, 20 Mar 2022 00:00:00 +0000

With the end of last year (31.12.2021), the University of Helsinki discontinued licensing its default bibliographic software tool RefWorks . Strangely, you cannot license RefWorks as an individual. That means when your academic affiliation ends, there is no way for you to continue using the software. Perhaps, the current owner of RefWorks (Clarivate) will kill it completely because RefWorks is a direct competitor of Endnote , which is the reference management solution that Clarivate is focussing on, given Endnote’s integration with Publons and the Web of Science (WoS), which is best known for its Impact Factor . Not coincidentally, Clavivate is owned by Thomson Reuters, which is the company that litigated against Zotero for offering its users the possibility to convert proprietary EndNote citation style sheets into the interoperable and standard CSL format . The recommended replacement for RefWorks is Zotero . I have no problem with this since I like Zotero and have been using it as my default bibliography management tool for now more than 10 years. On top of the fact that it is free, it combines two important features, which make it unique and superior to commercial solutions:

Northern lights everywhere

Sun, 13 Feb 2022 00:00:00 +0000

Northern lights seem to be normal these days in Helsinki, Finland. The frequency and visibility of the Northern lights are directly correlated with the 11-year solar cycle. It has been known for many hundreds of year that the number of sunspots waxes and wanes in a cyclic fashion with an average time of about 11 years.Even though we are far from the maximum of the solar cycle (which is predicted to be sometime between 2023 and 2026), the number of observable Northern lights in Helsinki seems to be increasing. Maybe the Solar Cycle 25 Prediction Panel was not entirely correct in predicting that cycle 25 would be similar to cycle 24. So far, the number of sunspots is well above the predictions . Cycle 24 was by the way the weakest cycle since cycle 14 (which peaked in 1906).An unpleasant and dangerous side effect of a strong solar activity is a coronal mass ejection (CMEs). A CME happens when the sun spits out large amounts of sun plasma (hundreds to thousands of billion tons). Such ejections happen during the peak of the solar cycle a couple of times per day, but during the solar minimum once every couple of days. Because these CMEs are directional, most of them more or less miss our earth. The magnitude of coronal mass ejections (CME) and thus the intensity and visibility of the Northern lights at lower latitudes is not dependent on the solar cycle, but the frequency of such events is.A big CME can become problematic because it can interfere with our electric grid. A couple of smaller grid outages have already occurred over recent years (e.g. in Denmark and in Canada) as a consequence of smaller CMEs. It is assumed that a big enough CME might be able to take down the electric grid of most of the planet. During the period 2010-2020 (encompassing much of the weak solar cycle 24) the probability of a large CME had been estimated by scientists to be around 12% ( https://agupubs.onlinelibrary.wiley.com/doi/full/10.1029/2011SW000734 ). The last big CME happened in 1859, and it is known as the Carrington event after the astronomer who first detected it. During the Carrington Event, the “Northern lights” could be seen as far south as Colombia (8° North of the equator; https://arxiv.org/abs/1508.06365).Our problem is not that all electronic devices will stop working when a Carrington-size solar storm hits the earth. Rather a few important but difficult to replace pieces of infrastructure will be knocked out. This might initiate the falling of dominoes eventually reaching every aspect of our life. If the CME is big enough, Covid-19 will appear to have been a walk in the park. Even small solar storms can sometimes cause trouble: The same solar storm that caused the Northern lights seen in the image (from Thursday 10th of February) knocked out 40 of the 49 most recently launched SpaceX satellites for good.

Why would anybody get vaccinated?

Sat, 22 Jan 2022 00:00:00 +0000

As you can clearly see from these statistics, the smallpox vaccination did not work: It did not end the frequent epidemics that swept through Sweden (and all other countries for that matter). The epidemics continued for more than 100 years despite the vaccination!* The vaccination was introduced more than 200 years ago in England. The figures are from Sweden because they were one of the few countries that early on kept relatively good statistics. In typical smallpox epidemics, 10-20% of the infected people died. In populations that had not been selected for resistance by frequent epidemic waves, the death rates could rise up to 70%. So why would anybody get vaccinated? With the last smallpox-infected human dying or recovering, the virus would go extinct, and humankind managed to eradicate smallpox this fashion. We got close to the same goal with polio but did not reach it (yet). Despite the differences between polio, smallpox, and SARS-CoV2, the graph seem to indicate that we are in for the long haul.*Note added for those living in an alternative reality: These sentences contain irony!

Happiness or life satisfaction?

Sun, 16 Jan 2022 00:00:00 +0000

No pressure to be happy

Finland is perhaps the only country in the world where you can be yourself. If you don’t have a reason to smile, you don’t have to smile here. Especially in the US, everybody wants you to be happy. After all, the persuit of happiness is written into their constitution! At times, people might even feel offended if you don’t show outwardly that you are cheerful and positive. In Finland, there is no social pressure to be happy. Maybe that lack of pressure makes you a little bit happy, too…

Finally boostered

Fri, 14 Jan 2022 00:00:00 +0000

Hooray, I am finally boostered! I did not mind what I would get, but ended up for the 3rd time getting the BioNTech/Pfizer mRNA vaccine.UPDATE (23.01.2022):I received some feedback concerning this 2-sentence blog post. I never really think much about the vaccination anymore. To me, the situation appears very clear from a science-based medical perspective. Below, I will keep adding answers to some questions and statements.

Finding the annual return on investment (ROI) for assets at OP bank

Sun, 09 Jan 2022 00:00:00 +0000

I am a customer of the Finnish OP bank . Like many other people, I had more leftover money than normally during the coronavirus pandemic. And like many others, I also invested some of that money into the stock market. I do not follow the stock market, but at the end of the year, I want to know how my investments performed: I want to know the annual return on investment (ROI) or the IRR (internal rate of return) for my whole portfolio and also for my individual stocks.

Opening old plasmid map files

Sat, 01 Jan 2022 00:00:00 +0000

For a new cloning project, we needed to access the plasmid maps of an old construct of mine (pSecTagN2, which was a precursor of pMosaic , aka pSecTagI) which I had composed from many different sources in 1999. In 1999, I was working in Kari Alitalo’s laboratory as a Ph.D. student. We were at the “cutting edge” of technology because we used a software program called Gene Construction Kit (GCK) to keep track of our clonings. Last Wednesday, I spent 4 hours of my working time opening one file created with GCK version 2.5 in 1999.

Meet the teacher!

Fri, 31 Dec 2021 00:00:00 +0000

Almost 30 years after starting my academic career, I started to teach at the Faculty of Pharmacy (without much pedagogic experience and education). Mostly, I teach stuff that I have real-life research experience and expertise with: Recombinant DNA technology, genetic engineering, protein production and purification, and - most notably - protein drugs. Following the University of Helsinki motto Researchers teach, teachers research . Despite my lack of experience, I was part of the Helsinki University “Meet the teacher!” feature, which is aiming at the prospective International Master’s students: https://www.facebook.com/HelsinkiUniversity/posts/10160122296028083

KLK3: tumorigenic or not?

Wed, 22 Dec 2021 00:00:00 +0000

We have just published our latest review about the role of KLK3 as an activator of VEGF-C and VEGF-D in prostate cancer . Prostate cancer is one of the most common cancers in males. It is not a question of whether you will get it but only when. Once you reach your 80s, the likelihood of you having prostate cancer is bigger than not having it. In a 2013 autopsy study of Japanese males , who died of other causes, 59% of those older than 80 had prostate cancer. It is likely that many of these cases were indolent and would never have caused any problems. Only a few of them might have become symptomatic had these men lived longer. So, there is a significant interest in distinguishing those cancers that are going to cause problems. Many prognostic markers have been proposed to do exactly that: to predict which cancers would become problematic.From the vascular biology point of view, angiogenesis and lymphangiogenesis are two hallmarks of cancers that have been previously proposed to have prognostic value. When we stumbled upon the fact that prostate-specific antigen (PSA, also known as KLK3) is able to activate VEGF-C and VEGF-D , we thought that this might have significance for prostate cancer. Meanwhile, further research has clarified some questions, and it really seems to be that both VEGF-C and VEGF-D are involved in cancer progression. it is not clear yet which proteases are responsible for the activation of VEGF-C and VEGF-D in real human cancers. KLK3- or Cathepsin D (CTSD)-activated VEGF-D might be a possible cause of the resistance of tumors to bevacizumab (Avastin) treatment. The consequences of VEGF-C activation, on the other hand, are more difficult to predict because activated VEGF-C does simultaneously both good and bad: On the one hand, it facilitates metastasis. On the other hand, it enables an enhanced immune response against the tumour. Interesting research lies ahead. Read more in our review: https://doi.org/10.3390/ijms222413545

Language boost

Fri, 17 Dec 2021 00:00:00 +0000

I am having a new attempt at learning Finnish! Until very recently, my career has progressed in Meilahti at the Faculty of Medicine, University of Helsinki. After the Research Fellow period financed by the Academy of Finland, my career prospects at Meilahti were meager at best, as almost all vacancies require good Finnish or Swedish language skills. In Finnish medical schools - unlike in many other study programs - you have to be able to teach in Finnish or Swedish. In other EU countries, there are many universities where you can study medicine without knowing a word of the local language, but Finland does not (yet) recruit foreign students for medical degrees.Before I started to study at the university, I was already once in similar language trouble. In the autumn of 1989, when the political changes in Eastern Europe made free travel possible, I decided to visit Hungary. My interest in Hungary originated from several Hungarian friends of mine, who were living in exile in former West Germany. When I arrived in Hungary in the spring of 1990, I did not speak a single word Hungarian. However, none of my Hungarian friends ever spoke anything to me but Hungarian. I remember with particular fondness Tomi and Timea and all their family and friends who patiently listened to my ramblings and corrected grammatical errors in my speech. Learning Finnish in Finland is different. Why does nobody want to put up with my bad Finnish? I have come across the idea that Finnish people are not used to foreign accents. I don’t subscribe to this explanation. The former Eastern European countries were at the time also isolated and linguistically homogeneous - in much the same way as Finland. Is it perhaps because nowadays nobody seems to have time for anything? In the autumn semester, I took part in a Finnish language course offered by the University of Helsinki. The course was part of the language boost (kielibuusti) project. Studying languages takes time. We always wonder how young children are so good at learning languages, but we forget that they are learning full-time. The Finnish language course has certainly affected my other work, and for this reason, I fully understand those foreign researchers who do not even waste a single second learning Finnish.As far as learning Finnish is concerned, I think the problem is not so much with the course offerings, although they could be better. The problem is rather that you don’t get to exercise your Finnish in real life because there is always someone around who - for very good reasons - doesn’t know Finnish or doesn’t want to learn it. In my own lab, all the native languages of the lab members - including Finnish - are minority languages. And without exception, all the people I talk to speak excellent English. It takes real effort to use any other language than English (that also applies to my own mother tongue, German). One of the goals of the Language Boost course was to get ourselves a language buddy, someone with whom we could communicate regularly in Finnish. After half a year, I am still without a language buddy. Although the teachers on the course were excellent, two hours of Finnish a week is unfortunately not enough.I know several researchers who have come to Finland from abroad and who speak excellent Finnish. However, most of them have family ties to Finland. Therefore, they have had to deal with Finns who do not speak English. They were forced to learn to speak Finnish. The same thing happened to me in Hungary 30 years ago: most people did not learn English at school. We had only one language of communication, and I used it all day long in all situations.This post was inspired by Reetta Vairimaa's article "Claudia and Celia" in the magazine Yliopistolainen (1/2018), which unfortunately is not available online.``Here is another aspect of the problem: There is simply not enough time to study Finnish for most foreign researchers. Compared to their native counterparts, they have already a higher workload even without learning Finnish. Building up a network - both professionally and privately - is lots of work. The numbers of Finnish learners at universities (20-30%) that were mentioned in this Acatiimi article ([Too few people study Finnish or Swedish](https://acatiimi.fi/2022/02/07/too-few-people-study-finnish-or-swedish/)) sound very high to me. I know lots of foreign researchers but very few of them have substantial knowledge of Finnish (but perhaps that is only true for Ph.D. students, which are overrepresented in my distorted view).

Missed a TV broadcast?

Fri, 26 Nov 2021 00:00:00 +0000

If you have missed a TV show, that is not available online, you might try this service: https://www.onlinetvrecorder.com/v2/signup/1905125 .

Competing with immigration country heavy weights

Wed, 24 Nov 2021 00:00:00 +0000

There are about 10-11 Mio. foreigners living in Germany (12/2019) which is about 13% of the population. On top of this, there are 1.4 Mio refugees (statistics) .The new German government has serious plans to ease work-based immigration to Germany. There is hardly any country in Central or Northern Europe, which has not recognized the need to import workforce. Germany has experience with importing workforce. In fact, the 13% number feels low to me, but many of those foreigners that have entered Germany a long time ago have meanwhile German passports. Over the last centuries, there have been several massive waves of work-based immigration to Germany (the last major one between 1955-1975 mainly from Turkey and Italy). Perhaps that’s why you get the World’s best döners and pizzas not in Turkey or Italy, but in Germany (New Yorkers might disagree concerning the pizza).For me, it is unbelievable that the question of work-based immigration is even asked these days in Finland. There is no expert who disagrees that Finland needs work-based immigration*. Not in the future, but now. The problem is that Finland seemed to have competed successfully for being the least attractive place for work-based immigration in Western/Northern Europe. I am not talking about the weather (yes: the cold and dark are occasionally a PITA), but I am talking about the bureaucratic hurdles that even highly educated foreigners have to face when they want to come to Finland. Some progress is being made (e.g. students’ residence permits can be now as long as their studies last), and the current government’s goal is to double the rate of work-based immigration. But in the competition for the workforce, all other European countries up the ante. In order to be remotely competitive, much more has to change as Tuula Haatainen wrote in a recent opinion piece for the largest Scandinavian daily newspaper Helsingin Sanomat . Unfortunately, the present system does not serve the industry well as another opinion piece from an affected entrepeneur demonstrates.*Experts who claim otherwise let their ideological biases trump their expertise. Because of their conflict of interest, their opinion should not count. It’s only an opinion; unbiased experts have the facts on their side.

How to manually encrypt a second hard drive in Ubuntu 20.04

Fri, 19 Nov 2021 00:00:00 +0000

You have added a second hard drive to your encrypted Linux system. The Debian installer makes it easy to encrypt during system installation, but how do you encrypt this new drive?

Cycling to the airport

Thu, 14 Oct 2021 00:00:00 +0000

The Helsinki international airport is located about 14 km North of our apartment. Actually, the airport is not located in Helsinki, but in its Northern neighboring city Vantaa. Already on my last conference trip before the pandemic I had decided not to use the taxi, but instead to cycle to the airport. This was easier said than done for two reasons:1. There is not dedicated parking space for bicycles at the airport. The whole concept of an airport seems to be built on the premise that nobody ever cycles to the airport. I was asking the Finnavia customer service and they suggested the bicycle parking space of the Hotel Hilton Airport .2. While there are plenty of bicycle roads, the road signs are so infrequent, wrong or missing, that it is impossible to find your way without using the navigation app from your mobile phone. The situation gets worse if you make the trip in the dark which is almost guaranteed since most of the planes leaving to and arriving from continental Europe do so in the early morning or late evening.However, I have cycled to and from the airport three times by now. Every time I try to find my way without the Google Navigator, and every time I loose my way. One problem with the voice navigation is that the Google navigator cannot pronounce any Finnish road names. Another problem is that Google maps are simply not kept up to date. Due to the constant construction, many of the suggested routes are impossible to ride. And it’s not fun to stop every 500 meters and pull out the phone from my pocket, rip off my gloves in order to use the touch screen, which does not react properly because it is raining cats and dogs.The problem with missing and wrong road signs on major bicycle roads is apparently wide spread. A similar impossible area to navigate for cyclists is the Helsinki Central Park. If you know Finnish, you can read about it in the daily newspaper Helsingin Sanomat ( https://www.hs.fi/kaupunki/art-2000008227424.html ). The story is about the futile attempts of a Finnish politician from the Greens Party, who tried to cross the Central Park by bike. Despite millions of Euros being poured into updating the park’s road signs, help from the indigenous population is apparently necessary to make it from one side to the other without getting lost. I always calculate 2 hours for the 14 km ride, which would be enough for me to make it even by foot - provided I do not get lost. I have not found the bicycle parking space of the Hilton Hotel yet. I will have another try next time…

Reset Wirelesstag's outdoor probe's flash memory

Sat, 09 Oct 2021 00:00:00 +0000

I really like the products from https://wirelesstag.net/ . However, the product documentation is sometimes less than complete and their staff less than professional. E.g. there is no information how to reset the outdoor probe when you need to associate it with another tag manager (and you have no access to the previous tag manager). They have information (and images) on how to do that for their wireless sensor tags, but not for the outdoor probe. Customers have already asked for this, but it doesn’t seem to be a priority for them to add this bit of information.So here’s the image which pins to short-circuit. How do I know? I found out by try and error.

Kilometrikisa

Fri, 08 Oct 2021 00:00:00 +0000

Kilometrikisa (“kilometre competition”) is a cycling competition for workplaces, which aims to encourage bicycle commuting and cycling in general. Team members record their daily cycled distance on the website https://www.kilometrikisa.fi and the team with the most kilometers wins. Additional prizes are raffled between all participants (I actually for the first time got lucky this year and won a free massage at UniSport ).There is a summer competition, running from May to September, and a winter competition (“talvikilometrikisa”), running mostly throughout January and February. Do not ask me why there are no spring and autumn events. I have been riding throughout all year for the last decade, with the exception of winter 2012/2013, because I broke my leg when cycling home from work. For me, October, November and December as as good cycling months as January and February. Actually they are better because due to global warming they tend to be snow-free in the recent years. If you commute early in the morning, before the snowplough has removed 30 cm of fresh snow, you know that you will get stuck many times, even with the 57-622 Schwalbe Ice Spiker Pro tires.My performance in this competition has collapsed since my lab moved from Biomedicum in Meilahti to the Biocenter 2 in Viikki, because my commute has shrunk from 14 km/day down to a meager 4.5 km/day. I still score very high on the list when it comes to the number of cycling days (109 for the last season), but according to the cycled distance, I am just slightly above average (place 58 with 1031 km). Our team (“Helsingin Yliopisto”, University of Helsinki) placed 143th this year in the competition for big workplaces.I am always wondering whether the total amount of cycled kilometres and the number of participants are increasing over the years, which should be the case if we are serious about combatting global warming. The first kilometrikisa event was held in 2014, so there is enough data to see trends. Unfortunately, the website does not give this information. It would be possible to scrape it and calculate it from the individual results, but I have enough other things to do atm. Maybe sometime in the future.

Why I am running Windows 11 now

Sun, 03 Oct 2021 00:00:00 +0000

My work computer broke in early summer: the graphics card failed. I used it without a graphics card since, but a few weeks ago the hard drive started to make problems. I ordered a new machine, but since the new Lenovo models will be coming soon, IT asked whether I want to wait for a few weeks in order to get the newer model (the P350 instead of the P340). So I have to bridge this time with something. I tried the old desktop that controlled the Äkta Avant, but it was pretty unusable (boot time ~ 3 minutes), but the solution appeared to be our old HP Elitebook G3. Most people who know me know that I am a big fan of open source software. Many of the best open source programs can run on Windows OS: Firefox, VLC, Inkscape, Blender, Scribus, Zotero. However, some open source software has never been ported to Windows. And often, the Linux version of the software runs better than the Windows version. One example is Gnumeric, Gnome’s spreadsheet calculator, which has an excellent chart export function to SVG. I have often recommended to my Windows-using students to install the Linux Subsystem for Windows (WSL) in order to run Linux programs, but only now have I done so myself. In order to do this, I needed to upgrade Windows 10 to Windows 11. I followed these instructions: https://docs.microsoft.com/en-us/windows/wsl/tutorials/gui-appsStrangely when I tried to upgrade, Windows complained that my hardware is not “compatible” with Windows 11, but nevertheless started and succeeded with the upgrade.Here you can see a Win 11 running on a decomissioned HP Elitebook G3, which my university had refused to upgrade from Windows 7 to Windows 10 in 2019 (even though it was technically one day within the limits). I did a fresh install of Win 10 with the official installation media which I downloaded from Microsoft. For some strange reason, it never asked me for a license (even though the I had exchanged the SATA-SSD for an NVMe SSD). In fact the computer is actually very fast and usable, and I will definitely keep it around for a few years as my only Windows machine, because there are still rare occasions when I need a physcial Windows installation.On the downsider, the Win 10 install was a PITA because my university IT locks the BIOS, and once the machine is decomissioned, they don’t feel the responsibility to give these machines a second life. IMHO, this is totally against the sustainability goals of our university. Fortunately, one can mostly work around a locked BIOS. In the worst case, one needs to exchange it against a spare BIOS from China.

3. Swiss Lymphsymposium

Fri, 17 Sep 2021 00:00:00 +0000

The English translation of the German talk (slides and abstract) is available from here: https://doi.org/10.5281/zenodo.6034307 . The 3. Swiss Lymphsymposium took place on September 4th in Zürich. It is sponsored by Juzo , a producer of garments for complex physical decongestive therapy (CPDT), which is the main therapeutic option for lymphedema therapy. CDT cannot heal but it keeps the symptoms under control. I really liked the talk by Prof. Erich Brenner, since it nicely addressed the issue of blind-ended “lymphatic capillaries”, which, with some exceptions, do probably rarely exist in the steady-state adult human anatomy. I had discussed this previously with others such as Johannes Grünzig ( https://doi.org/10.1016/j.aanat.2018.08.004 ), who specifically looked at the shape of the initial lymphatics in the eye. I was asking Erich where the concept of blind-ended capillaries originates from and it seems to have its origins in early drawings from German physiologists. As a matter of fact, I myself have been perpetuating the blind-ended initial lymphatics in my schematic drawings, e.g. here , without paying much attention to the issue. As a defense, I can argue that the low magnification shows only the larger collectors and the high magnification suffers from the narrow depth of field. In fact, the depth of field can indeed give sometimes the impression of blind endings, while in reality, the vessel might simply make a turn. However, I have also seen convincing images with blind-ended initial lymphatics. From a functional perspective, which geometry would be the better choice? I guess nature is good at optimizing structures…Of course many of us molecular scientists have seen real blind-ended lymphatics. Obviously, during development and other situations of lymphatic expansion (wound healing, VEGF-C application), such lymphatic blind-ended sprouts do exist. We often also look at lymphatics in places where such finger-like structures do de-facto persist throughout adulthood (i.e. in the villi of the digestive tract). However, here the constant high supply of VEGF-C is likely involved in maintaining these unusual structures ( https://doi.org/10.15252/emmm.201505731 ).In my talk, I was addressing the current status of therapeutic lymphangiogenesis. Using VEGF-C, we can induce the growth of new lymphatic structures, but the current gene therapy (Lymfactin) is only able to deliver a short burst of VEGF-C because the delivery vector (an adenovirus) is rapidly inactivated by the immune system. Hence, the clinical studies were well chosen: to jump-start the integration of lymph node transplants into the local lymphatic network. But given this relatively narrow indication, the business decision by Herantis Pharma to focus on its neurodegenerative pipeline and to discontinue the Lymfactin development is even understandable. IMHO, we would need molecular nudging in order to make an impact in most human lymphedema conditions, which are - for the most part - chronic. A low-level, distributed stimulation of lymphatic collector contraction would need to be combined with a higher capacity network. VEGF-C could do the trick, but at this moment, we do not have any technology that could reliably deliver such a molecular nudge for a long time, although there are many ideas on how one could pull this off.The Ketoprofen/Bestatin trials have shown, that there is a big difference between acute and chronic lymphedema. The mouse lymphedema, which was treated surprisingly effectively with ketoprofen, is very different from human chronic lymphedema. One thing we certainly need is better animal models for chronic lymphedema. Interestingly, chronic lymphedema is a common problem in horses.This seems to be an old hat for those familiar with horses, but for me this was new: The same conservative standard treatment is used for horse and human lymphedema: complex physical decongestion therapy. I was just surprised that there are enough equine patients in order for some researchers and practitioners to specialize in the lymphedema treatment for horses: https://www.equicrown.de or https://horsephysio.at/uber-uns.htmlFrom a scientific point of view, this type of edema is likely much more similar to human lymphedema than all the mouse models that we have: it’s a big animal with high hydrostatic pressure in the legs and it’s a chronic condition. I am wondering what are the molecular causes for horse lymphedema, and whether this problem was caused by domestication/breeding, i.e. whether wild horses/zebras have also lymphedema? I would love to talk to somebody who knows something about this!Thanks to Sonja Eham & Dr. Michael Oberlin for the additional info concerning horse lymphedema, and Sonja Eham & Dace Zanker for an impeccable organization. I guess I should immediately start to clone horse VEGF-C…

Web tools to learn Finnish

Thu, 16 Sep 2021 00:00:00 +0000

Tools for learning Finnish

https://deepl.com DeepL
https://presidencymt.eu/#/text
https://chrome.google.com/webstore/search/sanastorm?hl=en
Not for Finnish: https://conjugator.reverso.net/conjugation-english.html

How attractive is Finland for international students?

Sun, 29 Aug 2021 00:00:00 +0000

One apology upfront: All the links in this post are to Finnish sites, demonstrating one of the problems that foreign students face in Finland: a language that doesn’t resemble any other European language (apart from Estonian and Hungarian, which also belong to Finno-Ugric language family ).Foreign students are generally having a good time in Finland. Although not everything is perfect, the University of Helsinki (and Finland in general) is worth considering when you want to study abroad. This is the bottom line from a feedback survey among more than 800 international students from the years 2020 and 2021. Especially the high quality of the teaching was appreciated. Other points in which Helsinki University excelled were the safe environment and the handling of the Covid-19 pandemic.However, the latter has also a downside, as more encounters and discussions with the academic staff were on the wish list of the students as well as more social support. This is hardly surprising given that international students cannot fall back on the same networks as the locals when they arrive in the country. The worst single issue appeared to be the reception of the students. Arriving and dealing with an unknown and incomprehensible bureaucracy is often too much for newcomers. Discrimination was only experienced by 4% of the respondents and among them, language discrimination and loneliness were the most common.I always warn students who tell me that they plan to apply to the University of Helsinki. You want an honest opinion on whether to start your studies in Finland? Ok: It can get pretty cold and it will get REALLY dark in the winter. However, Helsinki is still one of the more livable places when it comes to the cold and dark season. It rarely gets below 0°F (-17.8°C), and being on the South coast it’s also one of the least dark places. And global warming is doing its best to increase the temperatures. Finland is already the insider’s bet for long-term real estate investments: still cheap enough, but with extreme growth potential once climate change converts Southern Europe into a smelting furnace. However, these scenarios will fully realize only the current political decision-makers have already kicked the bucket. But if you are in for the long haul, Finland might be THE place to be. But again, if the gulf stream collapses, you’ll be thrown back to square one. Thank your parents for the mess they have left you ( https://www.theguardian.com/environment/2021/aug/05/climate-crisis-scientists-spot-warning-signs-of-gulf-stream-collapse ).Unfortunately, as good as Finland might be for studying, staying in Finland for good is a different story. Even though Finland needs to boost immigration to make up for its declining and aging population, there are still unfortunately too many hurdles to overcome before settling down becomes a realistic option for most foreigners. The language is only one of them, others being mentioned in a recent article in the largest Finnish daily newspaper (Helsingin Sanomat) are the difficulty to become integrated into the Finnish society, the for foreigners incomprehensible bureaucracy, and the low salary levels. But also growing resentments towards foreigners within the Finnish population, manifested in the success of the “Finns Party” (formerly known as “True Finns”), are not helping. Most other European countries also fight with right-wing political currents. In my home country Germany, the AfD (roughly equivalent to the Finns Party) is not considered by any of the democratic parties as a possible coalition partner (wishful thinking on my part?). But here in Finland, the Finns Party has been already in a coalition government, and only the social democrats and the leftist coalition have a clear “no” position in this matter.Just recently, the newly elected major of Helsinki Juhana Vartiainen commented on the attractivity of the Finnish labor market for foreigners:“A miserable failure on Finland’s part. The political consciousness has been very slow to even grasp that we need labor immigration at all.” ( Helsingin Sanomat, 28.08.2021 ).But all that aside, academic teaching is at a very high level. And it is free for EU/EFTA residents (and holders of qualifying degrees from those countries). For paying students, the tuition fees are a bargain compared to many other universities that play in the same league (between 13000 and 18000 Euros per year, depending on the study program). However, the university staff will have to pay a high price to maintain this quality. For the current decade (2020-2030), the ministry of education has the goal to increase the number of completed university degrees by 100000 ( https://www.acatiimi.fi/4_2021/15.php ). At the same time, the university budget has been cut. The government will probably compensate for the cuts in a media-attraction gathering “rescue the university” move to distract from the fact, that we need dozens of millions on top of this to provide the same high level of teaching for those 100000 additional degrees over the coming years. At the research level, academic staff has been fighting an uphill battle since 2005, when the inflation-adjusted budget for R&D decreased for the first time. But meanwhile, students start to feel the lack of sufficient funding e.g. when their teachers simply do not have anymore the same amount of time for them as they used to.I have no other choice than to advise students against an academic career in general. Most other European countries have similar problems, but perhaps not at the same level as Finland. And the students know that academic funding is especially bad in Finland .

Searching for a lymphedema drug

Wed, 11 Aug 2021 00:00:00 +0000

More than 20 years ago, I cloned the VEGF-C cDNA into an adenovirus shuttle vector. Even though we had the vectors for the AdEasy system from Bert Vogelstein’s lab to make adenoviruses in-house, we preferred to team up with gene therapy expert Seppo Ylä-Herttuala to make the first adenovirus with VEGF-C cargo (AdVEGF-C). This and other VEGF-C-expressing adenoviruses have been used by Seppo and us in several preclinical studies to show that VEGF-C can be successfully used to treat the underlying cause of certain types of lymphedema.In 2018, Herantis Pharma started Phase 1 clinical trials with AdVEGF-C, which was branded under the name Lymfactin. After Eiger Biopharmaceuticals ’ Phase-2-trials with bestatin failed to show any effect on lymphedema, Lymfactin was the only drug in clinical trials that was aimed at lymphedema. This spring, Herantis announced that it is discontinuing the clinical trials with Lymfactin in order to focus on their neurodegenerative ( CDNF ) drug pipeline. On top of this bummer came the news that the assignment of patients for the phase-2 trial had been non-random and that the Phase-2 results are therefore inconclusive . This is bad news for lymphedema patients just when gene therapy, on the whole, is making a comeback after an almost two-decade-long hiatus.What is the way forward? Even though the small molecule drug bestatin was shown to increase VEGFR-3 expression and activation , it was never a pro-lymphangiogenic therapy. The mouse experiments had shown clearly that it merely supports the endogenous lymphatic repair that is naturally kicking in after acute lymphatic damage. It specifically counteracts too high leukotriene B4 levels, which inhibit lymphangiogenesis, but it does not carry any own lymphangiogenic signal.The strategy to inhibit an inhibitor was also used in mouse studies that were published today in Science Signaling by Kataru et al.: Kataru et al. Kataru et al. used genetic modification of lymphatic endothelial cells to block PTEN, an intracellular inhibitor of VEGFR-3 signalling. The results are convincing: Lymphangiogenesis without any of the drawbacks that are inevitably associated with growth factor therapy, such as having too high growth factor concentrations at the site of delivery, which can lead to vessel leakiness and other unwanted responses. Small molecule PTEN inhibitors do exist, but they are pretty toxic. If a reasonably non-toxic PTEN-inhibitory compound could be found, all that is left is to specifically target it to lymphatic endothelial cells. However, neither finding nor targeting are easy tasks, although there are enough ideas that could be followed if funding was available. Read more about this topic in our opinion piece about searching for a lymphedema drug in Science Signaling: doi-link , e-print link for those who have no access to the full text.

Where the Soviet Union was conceived

Wed, 11 Aug 2021 00:00:00 +0000

We did a bit of historic sightseeing in summer. In July we went for a city vacation to Tampere, the third biggest city in Finland and the biggest Scandinavian inland city. Tampere has a very industrial history and some important decisions influencing world history have been made here, such as the decision to found the Soviet Union. The latter took place when Lenin and Stalin met each other for the first time in 1905 in the Tampere Worker’s Hall, which today hosts the perhaps (?) only Lenin Museum in the world. Finland was an autonomous part of the Russian Empire at the time and enjoyed more freedom than perhaps any other part of the Empire. For that reason, many of the early communist leaders operated out of the Grand Duchy of Finland.

Erichsen Geld & Gold

Sun, 01 Aug 2021 00:00:00 +0000

This post was originally only available in German because I was writing about what I consider to be the best German-language podcasts on the subject of money and finance. Money and finance are country-specific topics. When it comes to things like pensions or health insurance, advice from US podcasts is pretty much useless. Who here has a 401(k) plan (1)? But even within Europe, countries differ so greatly from one another that you should think carefully before adopting well-meaning advice from another country. A simple example is the differences in the use of cash: Here in Scandinavia, EVERYTHING is paid for by card , regardless of the amount. Cash is mainly only around here because of German tourists! As I live in Finland, I should therefore listen to a Finnish podcast about money and finances. Unfortunately, I haven’t found an interesting one yet. You probably need a certain amount of choice so that you can a) find something that suits your own life situation and b) something that is of high quality in terms of both content and production. Life circumstances, age and, not least, social attitudes create for all podcasters a (more or less) limited perspective, from which it is difficult to break free. That’s probably why my clear number one among finance podcasts is Erichsen: Geld und Gold . Why do I think “Erichsen Geld & Gold” is better than all the others? Probably because, apart from our professions, my life situation and Lars Erichsen’s are strikingly similar – from our age and family circumstances right down to details in our CVs and our social outlook. If I’d stayed in Germany, I’d be a Northern Light too (2). The fact that I can draw this comparison also says something about the podcast: although it’s a finance podcast, as a regular listener you quickly get the feeling that you know Lars Erichsen well as a person. It is this quasi-personal connection that has helped podcasts achieve their breakthrough, and it’s something that television – or even the professionally produced podcasts from media conglomerates, of which there are more and more – simply cannot compete with. The Handelsblatt ? Forget it!

50 cucumbers and counting

Sat, 03 Jul 2021 00:00:00 +0000

Pandemic + staycation = balcony gardening. While our tomatoes are all still green, the cucumber harvest has started about 2 weeks ago. So far, we have harvested 50 cucumbers, 25 of them today. There is at least the same amount still hanging on the plants. Last year, the cucumbers got infested early in the season with spider mites and we harvested only very few. The only thing I did differently from last year is that I included fertilizer with every watering. I tried two different biological fertilizers, but they did not fly for two reasons: the nettle-based (fermented) fertilizer was so stinky that we could not use the balcony for three days after I had applied it. The second fertilizer I tried was worm tea, a byproduct of our worm farm . It is essentially odor-neutral, but our worm farm is too small to produce enough fertilizer for the cucumbers and tomatoes, which both have high nutrient demands. So I used essentially only the Biolan liquid fertilizer and I am happy with it. It contains apart from the usual NPK (nitrogen, phosphorus, potassium) also a lot of microminerals.

Ways how to keep a process running after logging out

Sat, 26 Jun 2021 00:00:00 +0000

There are many ways how to keep a process running after logging out. Each if them has its own advantages and disadvantages: nohup, disown, screen, tmux, ssh2go, etc. Screen is certainly not the most feature-rich and modern solution, but it is available by default on all Linux installations. That’s why I use it. Here’s how it works:

Installing perl modules

Tue, 22 Jun 2021 00:00:00 +0000

I have not done this for perhaps a decade or more. But apparently, things are still the same on Ubuntu 18.04:

Where to move to from RefWorks?

Thu, 10 Jun 2021 00:00:00 +0000

I never understood why our university pays for proprietary reference management software. Perhaps some old people in the administration still live in the 90s of the last millennium when EndNote was de-facto the only decent reference management software for WYSYWIG text processors. But those times are long gone. Finally, our university is at least dumping one of its proprietary reference managers:

TuKoKe success for our TET interns!

Wed, 09 Jun 2021 00:00:00 +0000

Here in Finland, 8- or 9-graders make a one- or two-week “Introduction to working life” internship at a workplace of their choice ( TET, työelämään tutustumisjakso ). The Covid-19 pandemic has also screwed this one thoroughly up, but our lab did manage to host a few interns when the Covid-19 numbers were pretty low in the autumn.One group, consisting of Pessi Bask, Rasmus Pouta and Okko Siljander from the Käpylä Primary School did study the suitability of run-of-the-mill plastics used for 3D printing for the culture of mammalian cells . Under the supervison of Niklas Koppatz, they entered with this project the TuKoKe nation-wide science- and technology fair and not only won the third price , but also additionally the Aalto University’s Design Factory Award and a stipend from the Finnish Invention Foundation (Keksintösäätiö) for the inventive nature of their work. Congratulations!

Directory hard links in Linux

Thu, 03 Jun 2021 00:00:00 +0000

Directory hard links in Linux are forbidden because they would:

create cycles in the directory hierarchy.
break the assumption that directories form a tree.
complicate deletion and reference counting.
make filesystem traversal and maintenance much harder.

Instead, Linux allows hard links for regular files and symbolic links for both files and directories. To emulate something similar to directory hard links, you can mount any file system path into any other directory (bind mount). However, you need to be careful because you can get the same problems as with directory hard links, namely circular and thus infinite file paths…sudo mount --bind /home/user/Documents/Desktop/ /home/user/Desktop/. Such a link disappears after a reboot. If you want to make it permanent, you can add the mount to /etc/fstab:/home/user/Documents/Desktop/ /home/user/Desktop none bind. Some say this does not work with LVM, but at least, on Ubuntu 20.04 it does. Obviously, this entry should be at the bottom of the fstab!

Covid-19 vaccination

Sun, 23 May 2021 00:00:00 +0000

UPDATE (August 6th, 2021) I am now fully vaccinated according to the CDC’s definition !

Randomized controlled potato chip tasting trial

Sun, 16 May 2021 00:00:00 +0000

We did a blinded randomized controlled potato chip tasting trial (RCPCT) yesterday. Unfortunately, everybody wanted to participate and therefore, we could not do it in a double-blinded fashion. We went for the plain type, for which we could find in Prisma three different brands: Estrella, Taffel, and Xtra.We only evaluated taste, and the results were clear and a bit surprising: Xtra and Estrella shared the first place and Taffel took the third/last place in the opinion of all four contestants. Given the fact that both Taffel and Estrella are almost twice as expensive (8.49€ and 8.18€ per kg, respectively) as the Xtra brand (4.3€/kg), it seems to be a no-brainer to buy the Xtra brand. What about nutritional aspects? Both Estrella and Xtra have 1.4% salt, while Taffel gets away with 1.1% salt. And the fat? Xtra uses exclusively sunflower seed oil, while both Taffel and Estrella use a mix of sunflower and rapeseed/canola. Consequently, Estrella and Taffel both have a healthier fatty acid composition that Xtra, and Estrella takes the lead with the least amount of saturated fatty acids.Which one to choose is not really clear: You get good taste for the least money buying Xtra, but it’s not the most healthy choice. On the other hand, it is not really clear whether Taffel or Estrella takes the lead in the health category (if we can speak about such category when evaluating chips at all). Taffel has less salt, but more saturated fatty acids. Estrella has more salt, but less saturated fatty acids. Since the price is roughly equal, let the taste decide.PS: Both English and German do not distinguish between the two different Brassica species, that are used to produce rapeseed/canola oil (Brassica rapa and Brassica napus). However, in the Finnish language, Brassica rapa translates into rypsi, while Brassica napus translates into rapsi. The nutritional values with respect to the fatty acid composition are similar for both plants.

Multiple Python versions on Ubuntu 20.04

Fri, 30 Apr 2021 00:00:00 +0000

Adding a new python version to Ubuntu 20.04 (for my system it is the 3rd version after 2.7 and 3.8): sudo update-alternatives --install /usr/bin/python python /usr/bin/python3.6 3

Master's Programme in Pharmaceutical Research, Development and Safety

Mon, 12 Apr 2021 00:00:00 +0000

The University of Helsinki is expanding its repertoire by offering a new International Master’s Programme in Pharmaceutical Research, Development and Safety . The year 2020 has shown how immensely important pharmaceutical science is for human societies. And this importance will only grow in the future! Besides emerging novel viruses, there are many challenges in front of us. The list below is just a start…* *

Scholarly Community Encyclopedia

Tue, 30 Mar 2021 00:00:00 +0000

We have added an entry for VEGFs to the Scholarly Community Encyclopedia . I do not know more about the project than is available from their About page . The service is backed by the MDPI publisher, the entries are mostly created in association with and based on articles published in MDPI journals. You can create different types of entries: Topic reviews, biographies and “others”, but all entries I have seen are topic reviews derived from articles in MDPI journals.I do not see which niche this encyclopedia is aiming to fill. Even though many entries are based on peer-reviewed articles, there is no peer-review of the entries themselves, and - not surprisingly - the encyclopedia contains quite a few questionable entries. However, unlike e.g. in Wikipedia, there is no established community of crowd-sourced quality control. However, when modifications are done to an entry, the original authors are notified. However, I do not know how editing wars (which have been e.g. quite common for controversial Wikipedia entries) would get resolved in this system. MDPI states that all authors are highly qualified experts, but in reality, everybody can create an account and edit existing entries. MDPI tries to incentivise the creation of entries with discounts on their article processing charges (APCs) via a point system . However, the ephemeral character of the point system does arguably not create sufficient incentive for high profile researchers or for researchers from developed countries that have mostly sufficient financial resources to pay for APCs.MDPI has also an associated service for scientists called “SciProfiles”, which - similar to Mendeley, ResearchGate, ORCID, Publons, Google Scholar, Loop, and many others - hosts researcher profiles. However, unlike most of the other services, SciProfiles is only visible to members, which makes it pretty useless imho.

Why Finland should take on more debts

Sun, 07 Mar 2021 00:00:00 +0000

The financial deficit of the state has been rising steadily since the financial crisis of 2007/2008. So it is incomprehensible that the same parties that are responsible for the growing state deficit are now arguing AGAINST taking more debts. The Corona-caused increase in state deficit might be much higher than the increases in previous years, although until Q3/2020 I see no change in the rate increase, yet.In order to have enough money to keep the country alive through the pandemic, the state SHOULD take on new debt. Anybody arguing against new debts (be it national debts or integrated into a European solution) MUST present a feasible alternative plan. In my opinion, all possible alternatives are much worse than taking on new debts. Comparing the state budget to a private person’s budget is not fair. As a private person, you cannot continuously increase your debts. But a state is not a private person as it has many more financial tools at its disposal than any private person. That is even more true for the EU and the European Central bank.What alternatives do we have to increasing the state financial deficit?InflationInflation is already part of the EU strategy to handle the increased debts. This doesn’t reduce the nominal value of the debts, but their real value. In a high inflation environment (NOT hyperinflation, but something like 5%, which was a quite “normal” inflation rate in my home country Germany in the early 1970s, 80s, and 90s), the state can easily reduce its debts. There are two problems with this solution: 1. The European Central Bank has not even managed to reach its 2% inflation target despite trying for many years. 2. In the long run inflation is not a good solution, because it increases the advantage of those who own substantial tangible assets (real estate, shares, precious metals, etc.). If you have the majority of your savings in the stock market, real estate, precious metals or other tangible assets, you do not need to be afraid of inflation. On average, all these things will maintain or even increase their value during times of high inflation. However, those without tangible assets cannot compensate for the inflation. The number of those that need to be supported by the state will rise, thus money will be spent anyway (but just after a delay). Inflation also worsens the wealth gap: The rich get richer. The poor do not always get poorer, but the rich get richer much faster than the poor and thus the income gap is widening. For the same reason, the poor did not profit much from the financial rally at the stock markets which has lasted now for more than 10 consecutive years. So what are the alternatives to increasing the budget deficit?Higher taxesReally? We already have a fairly high level compared to many other countries. But from whom do you want to take? You only can take money from those who have money. A dedicated tax for the rich is a question of definition. Who is rich? 99% of the population would not oppose increasing taxes for the 1% of the population that profited most from the bull market of the last 10 years. There are many more millionaires today in Finland than still 10 years ago. Most of these people have skimmed the cream and it seems appropriate that they would contribute back to a country that has enabled their success. While this sounds very leftist, most people would probably consent, if they only agreed with what the taxpayers’ money is spent on. Close to nobody in this country would oppose investing into the future, into better infrastructure, better schools, research and development, etc. But as long as this remains a pain point, higher taxes can be only a tiny part of the solution.Reducing spendingThis is essentially the same issue as the previous one. Wait, it’s actually even worse because we started from the premise that we need MORE money to get the country through the pandemic. Being too hesitant and not spending enough is considered to be the reason why Europe did not recover as quickly as the US from the 2007/2008 financial meltdown. Unfortunately, there are some signs that the same mistake is about to happen again.**Four possibilities: Inflation, higher taxes, spending cuts, new debtsThe problem won’t go away by sticking your head into the sand, but it rather will get worse. Austerity policy is the opposite of investing in the future. We have an investment deficit, which has built up in Finland over the last 15 years. We have it in education, in digitalization, in research, and in infrastructure.At the moment, new debts are the only possibility. Debts are cheap (actually with negative interest rates, the state even wins when taking on more debts). Even Germany got rid of their black-zero policy. Finland should not be Europe’s wrong-way driver. For this reason alone, it would be stupid to be the exception. And - dear Finns Party - it is an illusion that any country can exit the Euro-zone at this moment. Instead of arguing whether or not to take new loans or lamenting the ever-increasing public deficit, we should discuss how to use the money wisely. We should be using it with the goal to increase the GNP sustainably in the long term.UPDATE: One day after writing this, the major Finnish daily newspaper Helsingin Sanomat was publishing a story which was discussing very much the same issues: https://www.hs.fi/visio/art-2000007843750.html

Martin Jeltsch (1933-2021)

Wed, 03 Mar 2021 00:00:00 +0000

This morning, my father, Martin Jeltsch, died from Covid-19 at age 88. He had the opportunity to get vaccinated already starting from January 25th, but he decided not to. If he had taken the first opportunity to get vaccinated, he would have most likely been already partially protected, when he contracted the disease. However, it is no secret that he opposed vaccinations, and his professional affiliation with complementary and alternative medicine was just one of the many things that have made our relationship very complicated. Herd immunity through vaccination will also protect the unreasonable. Hopefully, we will get there soon.UPDATE: According to our mother, my father did actually plan to get vaccinated. However, vaccine roll-out in his county started in the end of January only and he had not even received the first shot yet. That first shot would have given him already partial immunity and most likely would have prevented a serious disease course.

MDPI peer review reviewed

Wed, 24 Feb 2021 00:00:00 +0000

Finally, our most recent review got published in the journal Biology. For my taste, its title is too long: Proteolytic Cleavages in the VEGF Family: Generating Diversity Among Angiogenic VEGFs, Essential for the Activation of Lymphangiogenic VEGFs . On top of this, the title contains an abbreviation: VEGF.Most publishers are in for the moneyThis is the first time we published with MDPI . Although the criticism of MDPI has not entirely gone away after its 2015 vindication from Beall’s List , the critique is now mostly centered around the accusation that MDPI is after the money and not the quality. That said, most publishers are in it for the money. Especially the stock-market listed publishers are by law forced to be in it for the money: Elsevier, John Wiley & Sons, etc. And many others such as Springer Nature are desperately trying to become also a member of the stock-market listed club. We as scientists could probably use a little bit of this attitude because we are naturally bad at making money (we can generate knowledge, but not revenues).Concerns over review qualityAdditionally, MDPI’s review process has been criticized as being not very rigorous. What was our experience? Our paper was apparently scrutinized by four reviewers and you can read the reviewers’ comments here: https://www.mdpi.com/2079-7737/10/2/167/review_report .**How did we experience the reviewers’ quality of feedback?**Three out of the four reviewers gave real feedback. Reviewer 3 could be - for all what matters - replaced by Grammarly.com or the Microsoft Word spell checker. Reviewer 2 focuses also almost entirely on style and presentation. Don’t get me wrong: Good style and presentation are very important! But, first of all, let’s get the science right! The remaining two reviewers were apparently not extremely familiar with the research topic vascular biology. This agrees with my own experience, that I often get requests from MPDI journals to review papers outside or only tangential to my area of expertise (which I immediately reject since I anyway have too many papers to review).You could argue in favor of MDPI, that our manuscript was already quite good when we first submitted it. But please: we cobbled this together in a hurry during the month of December and I know that there are still quite a few errors (which we realized a few minutes after the paper was published).We wanted to try an Open Review, but failedIt strikes me that we had opted for open review (i.e. only to use reviewers that were agreeing to publish their identity together with their reviews). However, none of our reviewers revealed their identity. There is probably some fine print somewhere that says that the editor can override this choice when no reviewers are found that agree to give up their anonymity. To a certain extent, I can feel the editor’s pain. It is difficult enough to find good peer reviewers in the first place, because - despite many attempts for a change - reviewing manuscripts is not rewarded in the current scientific system. Is it fast? Imho, some of it was too fastThe review process was fast. The revisions were even faster. And the publishing was much too fast. I was terrified when I saw that we might not get a second set of proofs. The first proofs had to be modified extensively because the layout had changed the image placement. As a consequence, almost all the references needed renumbering. Moreover, during the proof generation, some parts of the figure legends got mistaken as body text. Therefore we had to shift large portions of text around during the proofing. And if you ever have used Word, you know that this is nothing to be excited about. At least, MS Word doesn’t crash anymore as it used to do in the old days. Back then, pushing the Crtl-S key combo after every minute of editing was outsourced from the brain to the spinal cord. But also this time, Word did not disappoint us by introducing unwanted formatting changes that were impossible to undo.None of us managed to have even a look at the second proofs this Monday before the paper went online, after which the link to the second proofs expired. We have lots of other things to do: prepare lectures, participate in faculty meetings, take care of students, and - last but not least - we occasionally also like to do some research. Fast publishing is not a virtue in itself. But it certainly helps to keep the expenses in check.**After the game is before the game.**And this time it’s not a review, but original research and we will choose another publisher. The experience was definitely not a catastrophe, but I can clearly see that such an over-streamlined process can go wrong once in while with less scrupulous authors. And there are many examples (see the Wikipedia entry ).For those interested, here is the link to the translation of the Norwegian article discussing the MDPI quality issue.**UPDATE (15.01.2022)*After this experience, a scientific analysis of MDPI journals was performed, looking at self-citations, citation cartels, special issues, APC charges, and review- and acceptance times: https://doi.org/10.1093/reseval/rvab020 . I only became aware of this article more than half a year after its publication. The take-home message of it is that MDPI , as well as the publisher OMICS Interntional , engage in editorial behaviours that fall under the umbrella of predatory practices. At the same time, their operation “has reached such a level of sophistication that they totally or partially comply with the formal criteria that serve to differentiate between predatory and legitimate journals”. The authors of this analysis use the term “non-evident/hidden predatory publisher”.At the same time, many legitimate and respected scientists are working on the Editorial Boards of MDPI journals. I personally know quite a few. As always, the truth is not black or white but some shade of grey. Besides, this article was published by the reputable publisher Oxford University Press , which could be interpreted as a conflict of interest. *

Eduroam installation on Linux

Tue, 23 Feb 2021 00:00:00 +0000

This morning it took me an hour to get Eduroam working. Eduroam is the international WLAN roaming service for university students and staff. I brought in my (non-university managed) laptop to work and tried to get connected. I finally found the instructions on the IT Helpdesk site on place place 19 (from 21 results shown on the first page when searching for “Eduroam Linux”): https://helpdesk.it.helsinki.fi/en/instructions/logging-and-connections/networks/installation-eduroam-network-on-ubuntuAs usual, the instructions are from many years back and no longer work on a “recent” system such as Ubuntu 20.04 LTS. On top of this, I had some old, dysfunctional Eduroam settings lingering around from a previous failed attempt. For the instructions below, you will need the Eduroam configuration tool, which you can download from https://cat.eduroam.org . To make it work, I had to do the following things:

Our first OER (Open Educational Resource)

Wed, 03 Feb 2021 00:00:00 +0000

When I started my new position at the Faculty of Pharmacy, it was clear that I would be going to do more formal teaching than before. Even though I have lectured before, I typically was only modifying a conference presentation in which I presented the research work from our laboratory. However, that does not fly for undergraduate students, and hence I am assembling lectures from scratch. Although there is much hype about Open Science, there are few or no open educational resources for the topics that I know to teach: genetic and protein engineering, protein drugs, biologics. Because I think, that there should be more openly available teaching material, I decided to make my lectures openly available. However, I soon realized that it is very difficult to replace copyrighted material with free alternatives such as public domain or Creative Commons -licensed material. 80% of the images and illustrations are easy to replace, the next 15% take you as much time as the first 80%, and for the last few images it seems impossible to find copyright-unencumbered alternatives. In the end, I generated the lion share of material myself. For this specific lecture, I have not found any usable image of Judah Folkman . Needless to say that if money was not an issue, I could just buy one for a few hundred bucks, but it still would not be possible for others to reuse it. As a temporary solution, I drew an image myself. I am not good at drawing, help me out it if you can!Today, I have finally uploaded my first lecture to the Library of Open Educational Resources : https://aoe.fi/#/materiaali/1212 . It was an introductory lecture to Protein Drug Discovery & Development for BSc students of Pharmacy (course PROV-105), which dates back to September 9th, 2020. The Library of Open educational Resources is maintained by the Finnish Ministry of Education. I also made an entry to Merlot collection (which is perhaps the biggest OER catalog): https://www.merlot.org/merlot/viewMaterial.htm?id=773405613.However , I am not entirely satisfied with the situation, since I prepared the lecture using Google Slides. Why Google slides? Sadly, it is the only functioning real-time collaborative presentation software. Due to this, the original version of the lecture slides is not available from aoe.fi. However, there is a link to the Google Slides. I have obviously included the same presentation in PDF and ODF format after converting it and all the editable source files (mostly in SVG format). And if the collaborative online editing of LibreOffice should finally become usable, we will probably switch to using that instead of Google Slides. The live online version is the more useful resource. In addition to the fact that this is the original version of the slide show, it will be also updated regularly (since I will give this lecture repeatedly), while the uploaded PDF/ODF file will become more and more obsolete over time.UPDATEI have meanwhile managed to upload another lecture to https://aoe.fi . All of my future contributions will be available from my collection page .* *

Preprint and Open Review

Mon, 18 Jan 2021 00:00:00 +0000

In February 2020, Henry Kwok from the University of Macau asked me whether I want to contribute to an upcoming special issue in the journal Biology*. He was guest editing this special issue on the topic of Proteases — From Basic Structure to Function to Drug Design as Targeted Therapy. The topic is exactly what we are researching at the moment: whether we can target the lymphangiogenic growth factor VEGF-C via its activating proteases. So I tentatively agreed to contribute a review on the activation of VEGFs. We decided for the first time to simultaneously make the manuscript available as a preprint AND to ask for open review. Open review means that the reviewers’ comments and our rebuttal will be published together with the article if the article is accepted.

Cycling during the Finnish winter

Tue, 05 Jan 2021 00:00:00 +0000

Finally, snow has arrived in Helsinki! So far I was using my summer bicycle and it does not look nice. My daily commute has only perhaps one kilometer of dirt road, but during the mud months, that’s enough to undo any cleaning in a few seconds and to remove any lubrication from the chain. The mud months are nowadays in Helsinki at least three - thanks to global warming: October, November, and December. Cyclists who advise cleaning one’s bike weekly have just too much time on their hands… Most of the bicycles that are sold are not really built to be used all-season and I am still looking for something, that is really low-maintenance also during the mud months. And I am getting worried about the amount of chain lubrication that I distribute into the environment. I have heard that some cyclists are using biodegradable chain saw lubricant, and I will probably try that out.

Low-budget PCR-based mutagenesis kit

Thu, 26 Nov 2020 00:00:00 +0000

If you need to modify your DNA construct, one frequently used method is the PCR-based mutagenesis, where you incorporate the mutation into the middle of two complementary primers. Alternatively, you can use a primer tag for longer insertions. Then you simply amplify the whole construct by PCR.This works reasonable well for constructs smaller than ~10kb. There are several commercial kits available for this purpose that differ in the details. Among them are the QuickChange kit from Agilent and the Q5 SDM kit from NEB and the Phusion Site-Directed Mutagenesis kit from ThermoFisher. The QuikChange kit is the most expensive (also because you always buy it together with competent cells) and the NEB kit is rather on the budget side (168€ for me here in Finland). Most of the kits are sized for 10 reactions. But what do you do if you want to do only one or two mutagenesis reaction. Do you buy the whole kit? I faced this question two weeks back. I went to our enzyme freezer and realized that we have T4 DNA ligase, Polynucleotide kinase (PNK) and Phusion polymerase. That is all what you need to make your own site-directed mutagenesis kit!

Editing Zoom recordings of teaching sessions with FFmpeg

Wed, 25 Nov 2020 00:00:00 +0000

Based on student feedback, we have been organizing a new course for the TRANSMED MSc program about drug discovery and development. It is what you call in German a “Schupperkurs”. I never have found a satisfactory translation of this word in English. It means that we just want to raise the students’ interest in this course. If they like it, they can take any of the many in-depth courses that are offered e.g. at the Faculty of Pharmacy , where there will be more teaching in English in the coming years due to the planned International MSc program in Pharmacy.

GeneCellNano Flagship

Wed, 18 Nov 2020 00:00:00 +0000

The GeneCellNano program was selected as an Academy of Finland Flagship. The idea behind the flagship is to make progress in the treatment of important diseases using advanced biologic technologies. Target diseases include ischemic heart disease, selected cancers, and retinopathy. The application was spearheaded by Seppo Ylä-Herttuala from the University of Eastern Finland and Seppo Vainio from the University of Oulu. In addition to groups from these two universities, the consortium features also groups from Aalto University (Olli Ikkala) and the University of Helsinki (groups Marjo Yliperttula, Timo Laaksonen, Hélder A. Santos, Tatu Lajunen, and my own).Link to the Academy of Finland press release: https://www.aka.fi/en/about-us/whats-new/press-releases/20202/academy-of-finland-selects-four-new-finnish-flagships/

Exponential growth

Wed, 11 Nov 2020 00:00:00 +0000

Talking to people that are genuinely concerned about the survival of mankind, I frequently have heard the sentiment “It’s politically not correct to say so, but the Covid-19 pandemic is the best thing that ever happened to the green agenda”. If SARS-CoV-2 had turned out to be as infectious as measles and as deadly as Ebola, it would have been an inhumane solution to the problem of global warming.I predict that in the near future, a militant environmental activist with an excellent synthetic biology education will develop such a virus to rescue planet Earth. If this person does a good job, (s)he will replace Hitler as the incarnation of evil for all generations to come. SARS-CoV-2 was an accident, but perhaps already the next pandemic will truly be man-made, intentionally by a mad man. With PCR, Gibson Assembly, and CRISPR/Cas, all the tools are available to everybody on this planet.Exponential growth is understood by everybody, who has not been living under a stone for the last 9 months. Strangely enough, the only exponential functions that seem to be of interest at the moment are those of viral spread.Everybody with basic mathematical understanding knows that the description “% growth per year” denotes an exponential function. And every scientist knows that any exponential growth in the real world must level off at some point because everything is a limited resource. Therefore any economic model that requires constant economic growth to keep the system going is doomed in the long run. The question is not WHETHER, but only WHEN the collapse will happen and HOW it will happen.Exponential growth in nature levels off in different ways: It can gradually slow down approximating linear growth before coming to a standstill. But it can also almost instantaneously stop and fall back to the baseline. The first is true e.g. when bacteria grow in a test tube. The latter is true e.g. for the growth of cancer cells in an organism.Read more: http://www.igbp.net/globalchange/greatacceleration.4.1b8ae20512db692f2a680001630.html

Assembly of an OCAA collection Entry vector (pENTR221)

Fri, 30 Oct 2020 00:00:00 +0000

This article is for people, who do molecular cloning. More specifically for people who need to deal with Gateway vectors. Let’s assume you received a Gateway clone from somebody. You know the insert sequence and you know the backbone. One of the most common backbones is pENTR221. Let take as an example insert the human CTSL1 cDNA, more specifically the clone id 100010639 from the OCAA clone collection. You know the insert sequence from its Accession Number (BC012612).You want the full DNA sequence of this vector in order to be able to use smart cloning software like SnapGene to help you with your cloning design. But this software requires you to have the full sequence of the construct (or at least the full sequence of its important parts). So how do you figure out the full sequence of the pENTR221-CTSL1 clone?The insert sequence you can get from NCBI : Just type in the Accession number that you got for your clone. Download the sequence in Fasta or Genbank format.Very interestingly, the otherwise smart SnapGene software does not know the pENTR221 vector. So you need to google the vector backbone “pENTR221 DNA sequence”. You get many hits and here are just four of them:1. http://dnasu.org/DNASU/GetVectorDetail.do?vectorid=2792 . https://plasmid.med.harvard.edu/PLASMID/GetVectorDetail.do?vectorid=279 3. https://www.genomics-online.com/vector-backbone/48/pentr221/4 . http://yrgene.com/documents/vector/pentr221.pdfMatthias , the author of the 4th source gives the sequence in a PDF file, which is not advisable. If you copy the DNA sequence from this file, it will be all scrambled up, because PDF does not read the groupings of 10 nucleotides line-by-line. Dear Matthias, do not use a PDF for distributing or documenting DNA sequences! If you MUST do so, please attach a plain text file of the nucleotide sequence to the PDF! Of course, you can extract the DNA sequence with a smart PDF tool like PDF Studio Pro in the correct order. For some strange reason, the sequence of the 3rd URL deviates from the other four being the only one that has the full attachment sites (attL1 and attL2). However, it does not matter which one of the sequences you use for the assembly, because the differences are all in the area that is removed during the assembly process (I don’t know how the pENTR221 vector was prepared for the library cloning of my specific example, but it looks to me that the original vector was opened with a single DraI digest (which creates blunt ends) and then first the linker were added and thereafter the insert.I suggest you use the sequence from the 3rd URL (because it is in Fasta format) and import it into SnapGene and let SnapGene detect common features. Now you still need the linker. How do you know which linker have been used? We get most of our Gateway clones from an in-house replica of the OCAA clone collection and you can download the full list of clones as an Excel spreadsheet from here . The data includes for each clones the linker that have been used (there are 8 different 5’-linker and 16 different 3’-linker). Unfortunately, it seems to be that this Excel sheet contains some errors, because some linker contain a stop codon, but are nevertheless marked “without stop” and vice-versa.For our example clone the following linker have been used:5’-linker:GTACAAAAAAGCAGGCTCCACCATG3’-linker:TAGGACCCAGCTTTCTTGTACAlmost all of the 5’-linker contain the Kozak sequence (CACC) as the last nucleotides before the insert starts and a few contain in addition to the Kozak the ATG itself (like the one above). At the other end of the linker you can easily identify the homologous sequence with the end of the attL1 of the pENTR221 backbone (GTACAAAAAAG).The 3’-linker are more heterogenous but they all contain the CTTTCTTG sequence from the attL2. When they are used to make clones with a stop codon, then they all start with that very stop codon (TAG, TGA or TAA).Now you just need to copy the open reading frame from your insert sequence in between the linker sequences. If your 3’-linker contains the initiation-ATG, you need to skip it. Also do not copy the stop codon, because in the “with stop codon clones” it is always included in the linker and in the “without stop codon clones” you don’t want to have it. For our example this sequence comprises nucleotides 202-1197 of Accession Number BC012612 . That would be:AATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGNow we add the linker (first and last row):GTACAAAAAAGCAGGCTCCACCATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGTAGGACCCAGCTTTCTTGTACNow we have the first problem: There is a stop codon in the 3’-linker (immediately in the beginning of the last row) even though the clone is according to the information that we received “without stop codon”.We have sequenced the clone and determined that the only difference between the with and without stop codon clones is a mutation, that converts the TAG stop codon into a TTG (leucin) codon.So we change one A nucleotide in the sequence above into a T nucleotide:GTACAAAAAAGCAGGCTCCACCATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGTTGGACCCAGCTTTCTTGTACThe last operation is to insert this sequence into the empty pENTR221 sequence that we have opened in SnapGene. Practically you select the 32 nucleotides from 652 to 687 and replace them with the sequence above. Voila! Unfortunately, the fact that the linker are not always correctly indicated gives me a bad feeling. However, according to our own experience the library replicas of the Orfeome contain sufficient errors that it is anyway advisable to sequence the complete insert using T7 or M13 rev primers from the 3’-end and M13 fwd primer from the 5’-end. This way, you will figure out any linker mistakes that have been done in the annotation of the clones.

For Science to Finland

Mon, 26 Oct 2020 00:00:00 +0000

When you think about going abroad to learn or do science, you mostly think of Anglo-American countries. Although still very attractive, the US and England have been losing some of their appeal. Staying in Europe is not anymore a dead-end for your scientific career. Finland is certainly not on the top of the list when looking at potential European destinations. However, especially among students, Finland gained a reputation as an insider’s tip for exchange periods abroad. Among these, German students form the biggest group, followed by French, Spanish, Dutch, and Italian students. Most of these come via the European Union-sponsored Erasmus exchange program. I recently wrote a guest blog on Claudia’s Helsinki about coming to Finland as a scientist. The blog post is in German, but its bottom line can be summarized in one sentence: there are several scientific areas, where Finland does world-class research. And Finnish universities are increasingly offering international study programs (mostly M.Sc. and Ph.D. programs). These study programs have a tuition fee, but if you come from an EU country (or the degree you apply with is from an EU country) you are exempt from the tuition fee. See what M.Sc. and Ph.D. programs are offered at the University of Helsinki: https://www.helsinki.fi/en/admissions/explore-our-international-masters-programmeshttps://www.helsinki.fi/en/research/doctoral-education/doctoral-schools-and-programmes

Grub2

Mon, 19 Oct 2020 00:00:00 +0000

Grub2 has been the default boot loader for Ubuntu for more then 10 years now. Its configuration file is nowadays /boot/grub/grub.cfg, but you MUST NOT edit /boot/grub/grub.cfg in order to modify the Grub boot menu. Instead, you need to add your own entries to the file /etc/grub.d/40_custom. Some general preferences are also set in the the file /etc/default/grub and any file under /etc/default/grub.d/.

Tiszta szívvel

Mon, 19 Oct 2020 00:00:00 +0000

Tiszta szívvel

Nincsen apám, se anyám,
se istenem, se hazám,
se bölcsőm, se szemfedőm,
se csókom, se szeretőm.

Harmadnapja nem eszek,
se sokat, se keveset.
Húsz esztendőm hatalom,
húsz esztendőm eladom.

Hogyha nem kell senkinek,
hát az ördög veszi meg.
Tiszta szívvel betörök,
ha kell, embert is ölök.

Elfognak és felkötnek,
áldott földdel elfödnek
s halált hozó fű terem
gyönyörűszép szívemen.

József Attila; 1925, maaliskuu

Én fekszem itt

Sun, 18 Oct 2020 00:00:00 +0000

Én fekszem itt

Én fekszem itt a kihűlt földön:
eleven kincse még a nyárnak,
vétkek s rossz jelek rohamozva
édes húsomra idejárnak.

Igazán s végleg téged várlak,
érdes tüllben gyere lassúdan,
horzsolj végig s hagyj itt örökre
izzó kikerics-koszorúban.

Nagy László

Szeptember végén

Sun, 18 Oct 2020 00:00:00 +0000

Szeptember végén

Még nyílnak a völgyben a kerti virágok,
Még zöldel a nyárfa az ablak előtt,
De látod amottan a téli világot?
Már hó takará el a bérci tetőt.
Még ifju szivemben a lángsugarú nyár
S még benne virít az egész kikelet,
De íme sötét hajam őszbe vegyűl már,
A tél dere már megüté fejemet.

Elhull a virág, eliramlik az élet...
Űlj, hitvesem, űlj az ölembe ide!
Ki most fejedet kebelemre tevéd le,
Holnap nem omolsz-e sirom fölibe?
Oh mondd: ha előbb halok el, tetemimre
Könnyezve borítasz-e szemfödelet?
S rábírhat-e majdan egy ifju szerelme,
Hogy elhagyod érte az én nevemet?

Ha eldobod egykor az özvegyi fátyolt,
Fejfámra sötét lobogóul akaszd,
Én feljövök érte a síri világbol
Az éj közepén, s oda leviszem azt,
Letörleni véle könyűimet érted,
Ki könnyeden elfeledéd hivedet,
S e szív sebeit bekötözni, ki téged
Még akkor is, ott is, örökre szeret!

Petőfi Sándor; Koltó, 1847

Medical research in Finland

Sun, 11 Oct 2020 00:00:00 +0000

Want to become a researcher in Finland? Why not? At the University of Helsinki , there are quite a few professors from German-speaking countries. Increasing the proportion of foreign researchers is an explicit goal of all Finnish universities. As far as the quality of academic research is concerned, Finland ranks in the middle of the pack in Europe. Only one of Finland’s 10 universities ranks among the world’s top 100: the University of Helsinki (74th in the 2020 Shanghai Ranking ). In contrast, four German universities make it onto the list, which is otherwise dominated by Anglo-American institutions (Ludwig Maximilian University of Munich, Technical University of Munich, Heidelberg University, and the University of Bonn, ranked 51st, 54th, 57th, and 87th, respectively). It should be noted, however, that these rankings represent an average across all of a university’s research fields.

University Pedagogy (UP2.2, 2019): Assessment of Learning and Giving Feedback

Fri, 02 Oct 2020 00:00:00 +0000

Becoming a qualified teacher in FinlandThe degree requirements for the 60-credit module in University Pedagogy (UP) consist of 25 credits of basic studies and 35 credits of intermediate studies. Although UP focuses on teaching at the university, the completed module qualifies you also for teaching at schools. The Pedagogy Center of the University of Helsinki organizes the courses of the basic study modules (25 ECTS credits) in English. However, if you want to complete the whole module, you will need to take courses which are only offered in Finnish or Swedish. That means you cannot become a qualified (“pätevä”) teacher without knowing Finnish or Swedish. I do not know whether my Finnish is meanwhile good enough to be able to do that. For the time being I stick to the courses taught in English.**University Pedagogy 2.2 (2019)**In the 2019 autumn term, I took the UP2.2 course (without taking UP2.1 first). We had a very nice teacher (Jokke Häsä), but I still don’t understand why he switched from doing Mathematics to teaching Pedagogy. Certainly a gain for pedagogy since he understands the statistics and we had some interesting forth-and-back about the statistics of the Johnston & Miles paper that we were reading. They paper is also attached to this post and the reporting about their statistical methods leaves much room for interpretation. I actually sent an email to the first author, but she had just retired a few months ago. Although I did not get an failure-of-delivery error, she perhaps did not anymore feel the need to respond.Blind flyingFor me, one of the biggest issues was, that I had nothing to compare too when I was preparing my assignments. When I am writing manuscripts for journals, I have thousands of examples which I can study and to which I can compare. So I decided during the course that I would make all my assignments public. Embarrassment included. But maybe some future participants of UP2.2 will have something to compare to. Sort of an exemplar. Not perfect, but passable. I only post my own assignments.**All my assignments available under CC0 (= no strings attached)**All this stuff is shared under the CC0 : Use it as you wish, no need to acknowledge me. The group assignment is the only thing missing here since I would need to get everybody’s green light, which is not going to happen. I should have done this 9 months ago, but I simply forgot. There was just too much other stuff happening.I did ok in the course, but I still don’t know anythingWhat grade did I get? Our group assignment got a 5 (on the scale of 1 to 5, where 5 is the best grade) and my own stuff a 4. Thanks to all the great members of team Carbonara! That averaged out as a 5 for the whole course. For some strange reason, the Moodle course page still shows that I only completed 66% of the course assignments, but WebOodi shows that I received the credits. So much for the wonders of our IT systems…

Michael Jeltsch: Wikimedia, Wikipedia and ResearchGate contributions

Tue, 29 Sep 2020 00:00:00 +0000

By contributing to Wikimedia and Wikipedia , I, as a researcher, can make reliable knowledge more accessible to society and strengthen the connection between science and the public. But why would I contribute to ResearchGate , aka “Facebook for Researchers”? Since its inception, scientists have been speculating about the ulterior motives behind starting the ResearchGate project, especially since it is a venture-capital-backed, for-profit company that has raised tens of millions of dollars from investors such as Bill Gates, Goldman Sachs, Peter Thiel’s Founders Fund, and Benchmark. Investors do not invest that kind of money without expecting a future return. For sure, ResearchGate is a convenient place to share, find and request papers that are not Open Access. That’s how I mostly interact with it.

Nudossi, what else?

Sun, 13 Sep 2020 00:00:00 +0000

I do not know exactly when Nutella appeared on the shelves of Finnish super markets. However, I remember clearly that when I first moved to Finland in 1989 to work at Rajamäen kalkkitiilitehdas, the quintessential German bread spread Nutalla was unknown here. However, guessing from its two main ingredients (sugar and palm oil), Nutella is a heart-attack in a jar. In Germany, there is a slightly more expensive, but massively better product available: Nudossi. It’s like Nutella, but instead of a meager 13% nuts, Nudossi has 36% hazelnuts. Although I had promised to myself to minimize my use of Amazon (see here why: https://www.newyorker.com/magazine/2019/10/21/is-amazon-unstoppable) , I ordered a big (1 kg) jar of Nudossi during the corona spring. However, when I clicked “Order this again” in summer, I received the dreaded “This article cannot be shipped to the selected address. You can either change the delivery address or delete the item from your order.“While Amazon can be life saver for niche products that never will reach a peripheral market like Finland, both Amazon’s own and their seller’s bottom line is profit and not to serve the customer. Luckily, often, but not always, these two goals go hand-in-hand. However, this was not the first time that I only once was able to order an Amazon product, after which Finland promply disappeared from its list of possible delivery destinations. I have the feeling that some malevolent AI is behind this pattern.What did I do? I ordered it directly from the Vadossi factory ( https://www.vadossi.de/shop/kategorien/nudossi/ ). Although the factory’s web shop did not explicitly mention shipment to international destinations, I had not problems to arrange this via email. On top of this, the final price was much below what I would have paid at Amazon.de.I know that Amazon will open an Amazon.se to serve the Scandinavian market and they also have already bought a warehouse in Finland ( https://translate.google.com/translate?sl=fi&tl=en&u=https%3A%2F%2Fwww.hs.fi%2Ftalous%2Fart-2000006611380.html ). But given their malevolent AI, I probably should continue to minimize the amount of my orders.

Protein Drug Discovery & Development

Wed, 09 Sep 2020 00:00:00 +0000

Yesterday, I had my first Zoom lecture about protein drug discovery and development. I hope that the students did get at least something out of it. My goal is to cc-license the complete presentation but there are still a few images that I need to replace. A first attempt is rarely a great performance, and we had our fair share of technical problems. My headset failed for the first time since I bought it at the beginning of the Covid-19 pandemic. And the Zoom polling functionality disappeared before the students had any chance to use it and we did not manage to bring it up again.Here is the link to the live Google Slides: https://mjlab.fi/pddd . These will keep changing (= improving). Below you find the PDF snapshot of the presentation from the actual lecture day. The whole presentation is CC-licensed. So feel free to reuse it. All source files (mostly in Inkscape SVG format) are also available from here: https://mjlab.fi/pddd-files . I have done all the SVG files in Inkscape , but you can also open them in any browser or edit them in Adobe Illustrator. If you want to edit or extract images, the easiest is perhaps to download the presentation in Microsoft PowerPoint, LibreOffice Impress, or PDF format. I still have not figured out how to share the Google Slides presentation without making the original editable for everyone (after all, I need some control over the content of my lectures).Be aware, that at this moment, the presentation still contains eight images on Fair Use or with unknown licensing terms (even though the legal concept of fair use does not really exist outside the USA). All image sources (excluding my own images) are listed in the file README.txt with their respective licenses and source URLs. Some images are so old that I was not anymore able to locate their original URLs. Hence I am not sure about their licensing terms. I will replace these over the next few weeks when I manage to get hold of CC-licensed or public domain equivalents.

Listing all active internet connections on Linux

Wed, 02 Sep 2020 00:00:00 +0000

netstat -natp

However, it is not always easy to figure out what the actual program is that is responsible for the connection. E.g. my Brave browser shows up as

Review published in Duodecim: Lymphatics and the eye

Fri, 28 Aug 2020 00:00:00 +0000

English is overwhelmingly the number one language in science. Nevertheless, sometimes there is a need to target audiences different from academic researchers. In Finland, the bi-weekly Duodecim is arguably the medical journal with the biggest reach among domestic medical professionals. Hence, the idea for a Finnish language review was born. Viewed from three different angles (from the laboratories of Sirpa Loukovaara, Kaisa Lehti, and Michael Jeltsch), we are looking at proliferative diabetic retinopathy (PDR), which is an eye complication that develops slowly over decades in diabetic patients and which is still a major cause of blindness. The treatment of PDR is often less successful than it potentially could be. Importantly, we present also advances in PDR research, from which new ideas might emerge of how to improve current treatment regimens.The original Finnish language version of the review just went online: https://www.duodecimlehti.fi/lehti/2020/16/duo15739 . An English translation is available from Zenodo: https://doi.org/10.5281/zenodo.4005517 .

VEGF-C protects blood cell production

Fri, 28 Aug 2020 00:00:00 +0000

Vascular endothelial growth factor-C (VEGF-C) has been originally described as the primary growth factor for the lymphatic system. And not surprisingly, a constitutive inactivation of both VEGF-C gene alleles in mice is lethal.However, over the years, researchers have uncovered additional functions of VEGF-C. In 2016, it was shown that VEGF-C is necessary for the production of red blood cells (erythropoiesis) in the fetal liver. During embryonic development, the production site of red blood cells shifts twice: First from the yolk sac to the liver (in humans between the 3. and 4. month) and then, three months later, from the liver to the bone marrow, where it stays for the rest of the life. Vegfc appeared essential for the mobilization, maturation, and enucleation of primitive erythroblasts. When Vegfc was deleted on embryonic day 7.5 (E7.5), the liver colonization by erythro-myeloid progenitors and the macrophage/erythroid expansion was defective ( https://doi.org/10.1182/blood-2015-12-687970 ).Some, but not all of the effect was due to the VEGF-C that was produced by the hematopoietic cells themselves, which is not surprising since several blood cells are known to produce or contain VEGF-C (e.g. macrophages, platelets). In the 2016 paper, adult hematopoiesis appeared unaffected when VEGF-C was deleted in 8 week old mice. Also when erythropoiesis was upregulated by phenylhydrazine (PHZ)-stimulated anemia or when the bone marrow hematopoiesis was abrogated with fluorouracil (5-FU), no major changes had been seen. However, in the new paper, we show that VEGF-C does play an important role in the bone marrow recovery from radiation damage, and that it also is able to pro-actively protect the bone marrow when administered before the radiation damage occurs. The effect was partly due to bone marrow endothelial cells and LepR+ stromal cells, which, when stimulated with VEGF-C, produced factors favorable for the regeneration of hematopoietic stem cells ( https://doi.org/10.1182/blood.2020005699 ). However, the effect on LepR+ cells was likely indirect as they do not express receptors of VEGF-C. Considering that previous data show expression of VEGFR-2 on hematopoietic stem cells ( https://doi.org/10.1038/nature00821 ), and avian VEGFR-2 and-3 during in developmental endothelial/hematopoietic differentiation ( https://www.pnas.org/content/94/10/5141 and http://dev.biologists.org/content/125/4/743 ), also a direct effect of VEGF-C cannot imho be excluded although it was not analyzed.

Apache forward proxy

Fri, 31 Jul 2020 00:00:00 +0000

Anyway: What is a forward proxy (and what is a reverse proxy for that matter)? If the proxy is a forward proxy, the server thinks the proxy is the client. If the proxy is a reverse proxy, the client thinks the proxy is the server.

Fat can make your arteries clog, but also the drainage of your kitchen sink

Sun, 19 Jul 2020 00:00:00 +0000

Professionally, I am dealing with the drainage system of the human body: the lymphatics . Last week, I needed to deal with the drainage system of our kitchen sink. And lo and behold, similar to the blood vessels of the human body , fat seemed to have also played a role in creating the blockage of our kitchen sink drainage pipe. The flow had become more and more sluggish over the last weeks and it was finally completely stuck. First, I cleaned - as usual - the U-bend, but it was surprisingly clean. Then I thought that the overflow drain might be the culprit. It was indeed completely stuck. It is easy to remove it completely for cleaning: you only need to loosen the screw where it’s attached to the sink, at the other end it’s not even connected to the main drain with a hose clamp, you can just pull it off. The clot that caused the blockage was gross, but cleaning it did not improve the situation at all.Then I opened the pipes at the very bottom where they leave the apartment and cleaned them with a 2 meter long drain cleaning brush, but I could not sense any blockage and that did not help either. However, it was clear that the blockage was downstream because when I poured water into the pipes, it quickly filled up the pipe to the top and only very slowly, the water level was falling. Then I remembered the 130 ton fat clump that was blocking a major sewer in London a few years back ( https://www.theguardian.com/environment/2017/sep/12/total-monster-concrete-fatberg-blocks-london-sewage-system ), and perhaps, a fat clump was as well to blame. To dissolve the fat, I decided to pour quickly lots of hot water (not boiling but the hottest that our hot-water system could provide, which is 54°C) down the drain (perhaps around 100 liters). With this treatment the blockage disappeared instantly and completely.

Human versus bovine methane production

Sun, 19 Jul 2020 00:00:00 +0000

A while ago, a friend of mine argued that, for him, changing to a meat-free diet wouldn’t make a big difference for global warming. When some humans replace animal protein sources with plant protein sources humans, they’d start farting much more thus offsetting the benefits of reduced greenhouse gas emissions by life stock.I had no clue whether there was any merit to that argument, but finally, I made a rough calculation. Even under the most generous settings, this argument falls flat because the numbers for greenhouse gas emissions are vastly different for humans and cows. For the sake of simplicity, I only looked at methane as it is much more important in this context compared to carbon dioxide.It appears that on a fiber-rich diet, humans produce about 10 mg of methane per day ( http://dx.doi.org/10.1136/gut.32.6.665) , while grass-fed cows produce about 250 g ( http://www.fao.org/3/a0701e/a0701e00.htm , https://blogs.agu.org/geospace/2019/01/09/scientists-breathalyze-cows-to-measure-methane-emissions/) . A cow produces 25 thousand times more methane than a human. Even if we assume, that a meat-eater does not produce any methane and that he eats only the equivalent of a single cow in his lifetime the argument falls short by the factor of almost 1000 (cow’s lifetime: 2 years, human’s lifetime: 80 years).However, the assumption that a meat-eater eats only the equivalent of one cow during his lifetime is very generous. In reality, this is highly unlikely as there are only e.g. 5 sirloin steaks in one cow but 85 pounds of ground beef.A cow weighs about 450 kg when slaughtered, out of which barely 200 kg is usable meat. If that is used to fulfill the meat hunger of the average person (80 years of 70 kg meat consumption/year, https://en.wikipedia.org/wiki/List_of_countries_by_meat_consumption ) this translates into 30 cows during the lifetime if all the meat comes from cows. Therefore, the assumption of needing one cow over one lifetime is overly optimistic even for people with minimal meat consumption.Another interesting fact that I did not know was that freely grazing cows produce 3 times the amount of methane compared to cows in meat factories that are fed with maize/corn. So much for “organic meat”.

The evolution of garbage

Wed, 08 Jul 2020 00:00:00 +0000

Disposable coffee cups have taken over beverage cans and bottles in the thoughtless littering competition a long time ago. That is true at least for Finland and those few other EU countries that managed to establish a somewhat sensible return system for cans and bottles. However, used face masks are becoming a strong competitor for coffee cups thanks to COVID-19.

Dr. Sawan K. Jha: Mechanism of VEGF-C Activation […]

Mon, 01 Jun 2020 00:00:00 +0000

My first Ph.D. mentee successfully defended his thesis on the topic Mechanism of VEGF-C Activation and Effect on Lymphatic Growth and Regeneration . Due to the COVID-19 situation, we organized the event remotely and used the Zoom virtual meeting software. The opponent was Prof. Jonathan Sleeman from the University of Heidelberg. Both the defendant and the opponent did a fantastic job, and the discussion brought to light several new directions for future research, which I had not been thinking about before. VEGF-C is a tricky protein and I am sure it still holds some surprises for the diligent researcher. Unfortunately, there was no reception, no dinner, and no karonkka (after-dinner graduation party), but we are planning to have a party later this year when the COVID-19 situation permits!

Counting files (list and word count, ls & wc)

Wed, 29 Apr 2020 00:00:00 +0000

How do you count the number of files in a directory? That becomes non-trivial if you have thousands of files in a directory. Your file manager chokes on counting them, especially if they are not local. On the Linux command line, this task is fast and easy:ls | wcls lists your files one per row and wc returns three numbers: lines, words and bytes. In the file counting example, lines and words are the same and equal the number of files in the directory. To count all files recursively in the directory tree “backcheck”:find backcheck/ -type f | wc -l

Future-proofing

Mon, 13 Apr 2020 00:00:00 +0000

Will the Covid-19 outbreak result in more than just temporary changes to the way our societies prepare for the future? Will we future-proof the way we organize our economies, our industry’s supply chains, our public health care, the way we travel, the way we consume? If history is of any guidance, I fear that not much will be learned from this crisis. Likely, our governments will make sure we have enough face masks and a better infrastructure to set up new virus tests for coming viral epidemics. Virologists and epidemiologists have been asking to prepare for a pandemic with less success than we wish now. Since the Spanish flu, it was clear that in a globally connected world viral pandemics are inevitable. The question was never if, but only when the next would happen. We had enough warning shots: SARS, MERS, ebola, and swine flue, just to mention a few.Other experts have been and are still warning to prepare for global crises of other types. Similar to a viral pandemic, the question is not if, but only when the next major asteroid impact or CME ( coronal mass ejection ) will happen. Similar to Covid-19, we got an ample amount of warning shots for both: The Tunguska event , the Chelyabinsk meteorite , the Carrington event , the 2012 solar storm just to name the more known ones. Despite this, we are not prepared for such disasters and I fear that governments don’t see the similarities between the Covid-19 outbreak and a CME. Unfortunately, astronomic events can be orders of mangitude worse than any pandemic.

Repairing our refrigerated centrifuge

Tue, 17 Mar 2020 00:00:00 +0000

Refrigerated tabletop centrifuges are quite expensive. Although discontinued, a refurbished Eppendorf 5415R (the model we use) still sells for $1-2K. The second of our two Eppendorf 5415R broke already more than a year ago and since then, we have been either centrifuging in the cold room or using the neighboring lab's cold fudge. But having two broken centrifuges of the same type, but different failure symptoms begged to assemble one functioning out of the remains.One of the centrifuge rotors was stuck (could not be turned even by hand) and the other fuge was giving sparks and smoke when starting a run. I had postponed this repair since I thought it might take much time. However, when I opened the first centrifuge, I immediately could identify the part that I needed to graft from the other fuge. The whole repair lasted less than one hour. There was a blown resistor next to the cooling fan, which was easily replaced with the part from the second fuge. You can see the broken brass-colored resistor (CGS HSA50 resistor, available from Amazon for$ 13) in the front of the picture left to the rotor.The failure of both centrifuges was apparently caused by liquid getting into the inner workings of the fuge. The rotor of the second centrifuge could not turn anymore because it was corroded from the salt and water. Also, the resistor had apparently been soaked (it is located immediately below the cooling grill on the top back of the fuge).The centrifuge works again including the cooling. I do not know for how long we will enjoy it, because it was already 2nd hand when we bought it in 2014. But even if it lasts only for another year, the repair was worth it.This type of repair might become easier in the future because if I am not mistaken, the EU is planning to mandate that manufacturers make service and repair manuals available to third party repair shops (this mandate exists already for car manufacturers to ensure that independent car repair shops can survivce).Depending on the coronavirus, I will perhaps get around repairing even more broken lab equipment. Next in the queue is the fraction collector of our old FPLC (GE Healthcare Äkta Explorer Frac-950).

Updating GE's Äkta Avant to Windows 10

Tue, 18 Feb 2020 00:00:00 +0000

The Avant is the flagship of GE Healthcare’s Äkta line of FPLC (fast protein liquid chromatography) devices. We use it on a regular basis and it is available to everybody from the University of Helsinki.Our University decided to play nice with Microsoft and to disallow all network traffic for Windows 7 computers. Because our Äkta (bought in 2015) is in use by many different researchers, we rely on Microsoft’s Active Directory to authenticate users and to track the device usage. When the University really did shut down Windows 7 traffic in late January, we finally updated the HP computer from Windows 7 to Windows 10 . Before we did that we contacted GE in order to be sure to have a working FPLC. Although the build number of Win10, that our University is using (Windows 10 Enterprise version 1809, build 17763.1039) was not supported by any of the Unicorn 7 versions that GE has released over the years (see this software compatibility chart, which I cannot find anymore from the GE website: https://drive.google.com/open?id=1cA33lEqfEr0MIaA8r9TyoQFcxiHWuZsp) , we were assured that the software would continue working. Unfortunately, this was not true.**In-place upgrade or clean install?**We performed an upgrade of Win7 to Win10 in place. I never liked these. Even on slightly superior operating systems like macOS and Linux , the in-place upgrades have not always been smooth. A fresh start has always been the safer (and also faster) bet.Connection problemsAfter the upgrade, Unicorn 7 started to lose the connection to the Äkta Avant during ongoing protein purification runs. We clearly could see during manual runs, that specific commands would trigger a disconnect. The Äkta LCD display would black out and the device would reboot. Naturally, we suspected that this was a consequence of the upgrade to Windows 10. Because Unicorn 7.0.2 had not been tested to work with our version of Windows 10, we first wanted to try to upgrade to a Unicorn 7 version that had been tested with our Win10 build. I had already asked in December for that update from GE, but my request had been ignored and I had many other things to do at the time and never bothered to come back to the issue (in hindsight a big mistake).Software updatesSomething that Chrome and Firefox do weekly silently in the background (without the user noticing) takes in the case of GE almost 2 weeks full-time engagement by the user. A simple download might work for Bio-Rad , but GE requires a complicated, obfuscated, non-transparent, user-unfriendly, constantly changing, GDPR-non-compliant syastem, which is in addition hosted on servers that feel so slow that you constantly wonder whether your browser tab has frozen. What it’s worth, GE’s web pages have always been like this despite multiple redesigns and GE’s digital transformation. The email thread between me and various GE support addresses comprises as of today 60 emails (starting with my first support request on December 2nd, 2019). On top of this, there are also quite a few phone calls (since email seems to be often regarded as “non-urgent” by default).Privacy concerns about GE’s handling of customer dataAfter placing an order for the download, receiving a quotation, confirming the order and receiving an order confirmation, I finally received the “permission” to download the newest version of Unicorn (which is 7.5). I logged into GE’s “eDeliveryPortal” only to realize that I could see the software entitlements and downloads for many other GE customers, but none of my own. After some back-and-forth the 7.5 version finally showed up under my downloads. My license is still missing as of today. But why bother? I could use any of the other licenses (after faking the MAC address of my computer as the software apparently is locked to specific computer via the computer’s network card’s MAC address). This is clearly a violation of the GDPR as there is absolutely no reason why my data (entitlement ids, MAC addresses, Names, e-mail addresses) should be available to other customers. It might be that GE considers the University of Helsinki as a single customer; that would be a violation of the GDPR by design.**Searching for the system configuration files (i.e. firmware)**However, we had not updated the system configuration files, because I had not been able to find them from the GE LifeScience website . We were running version 3, while version 3.6 was the newest one. Notably, these files do also contain the firmware for the individual Äkta components. It appears that this download is nicely hidden. I needed help from GE in order to locate it. The GE life science website has a search function and the search even finds the download. However, it is perhaps the last item in a list of nearly 1000 hits (10 hits/page). One tip to GE: Google knows search! If you just would let Google index your complete web site, customers would find everything via a Google search. Many companies are using Google for their internal web site search. However, GE seems to expose only their product pages to search engine crawlers, but not their support pages.**Where are our licensing files?**After updating the instrument configuration, the problem persisted. After sending a system report (and then sending a second “extended” system report), GE concluded that most likely our in-place upgrade from Win7 to Win10 was to blame, because they could see some irregularities in the SystemEventLog.xml file. I had no reason to doubt this explanation and therefore requested a clean Windows 10 install from our IT guys. I then installed Unicorn 7.5 only to see that the problem had not disappeared. Just as a side note: We had a self-inflicted issue with our license file (.lic). The Unicorn installer software requests the installation of a license file, which I have never seen for download anywhere in the eDelivery portal (we have received these license files as attachments to e-mails directly from GE support staff, why are they not available for download as these are prone to be lost?). We should have made a copy of our license file before we erased our computer for the clean Win 10 install, but we missed that and I had to dig out the license file from a system backup, which I had luckily made in 2016 from the machine. And I am still searching for our license files for different system components (Classic Evaluation and Column Handling), which were not yet installed when I did the system backup.Down-grading to Windows 7In order to be sure that we did not deal with a hardware failure, we decided to downgrade the system back to Windows 7 and Unicorn 7.0.2. That was more difficult than expected, because we cannot anymore install Windows 7 on university machines. Luckily we had still one old, unused Dell desktop, that was runninig Windows 7. Unicorn 7 requires two network cards (one to communicate with the outside world and one for a separate 10. network to communicate with the Äkta Avant). We swapped the network interface card from our default computer to this old Win 7 machine. However, installing and running Unicorn requires access to the internet because the software is “phoning home”. Exactly that is disallowed for Win7 machines at our university. Hence I needed to set up a private network via my phone to allow Unicorn 7 to communicate with GE headquarters. Even worse, I needed to clone the MAC address of our default computer, because our Unicorn 7 software is apparently locked to a specific computer via the computer’s MAC address. And wireless internet access was a no-go, because the original MAC address was from a wired NIC. It is not possible to clone MAC addresses between cabled NICs and USB wireless adapters, because MAC addresses from wireless cards have a fixed prefix. Hence, I had a complicated setup from my phone via a computer to a (cable) router to the Win7 Dell computer.Windows 10 is not to blame - F-Secure is the culpritTo my surprise, the Äkta Avant kept crashing when Unicorn 7 under Win7 issued commands like “pause” or “end”. But then I realized that - unlike our old Äkta Explorer - the Avant uses regular NICs for the device communication and the University of Helsinki Win10 version is by default “enhanced” by remote control and security software. I went to the Control panel and uninstalled all software add-ons that had been installed by the university. Most notably F-Secure’s Client Security Premium was among the programs, that I uninstalled. After a reboot, I was unable to make the Äkta Avant crash. To confirm the finding, I popped the NIC back into our original default computer, rebooted and got stuck at the Windows BitLocker screen. Changing the hardware configuration inevitably triggers Windows to refuse booting. This did slow me down because it required me to engage our university’s IT department, which is chronically overworked and difficult to find. I selectively disabled the firewall from F-Secure Client Security Premium and the crashes instantly ceased also on Windows 10. It is very difficult to argue why our university would need F-Secure’s products. Windows itself comes (since XP SP2) with a very capable firewall and also has its own anti-virus software ( Windows Security Essentials / Windows Defender ), which is at least as good as its best competitors in addition to the fact, that it is free and fully integrated into Windows (and it does not require to stick third-party hooks deeply into the OS).Windows 10 is too slow on our 2015 hardwareThe only thing left is to upgrade our default computer to newer hardware. Our faculty had replaced older Win7 computers in 2019 with new machines, but this computer was 1 day too new to be included in the upgrade. However, it is already 5 years old and especially after the Windows 10 upgrade, it is very slow. When your protein elutes during your purification, you do not want fraction collection to start after a few seconds, but you want it to start instantly.

Copying with rsync

Mon, 17 Feb 2020 00:00:00 +0000

Reasons why you should (not always, but often) prefer rsync over cp:

Resume Interrupted Transfers If you are copying a large file and your terminal session crashes or the power cuts out, cp will simply fail, and you have to start over. rsync can pick up right where it left off, which is a massive time-saver for large datasets.
Efficiency (Delta-Transfer Algorithm) rsync is designed to be smart. If you are copying a file that already exists at the destination (e.g., you are updating a backup), rsync only copies the parts of the file that have actually changed (the “delta”) rather than overwriting the entire file. cp, by contrast, always copies the whole file every single time.
Real-time Progress Monitoring rsync provides excellent visual feedback. By using the -P (or –progress) flag, you get a real-time progress bar showing the percentage complete, transfer speed, and estimated time remaining. cp is famously silent, leaving you guessing whether the process is still running or has hung, requiring you to check at the destination via the size of the arriving file, whether anything is progressing (ls -lh filename, or du -hs filename)
Seamless Remote Transfers rsync is natively built to work over SSH. You can use it to copy files directly to or from a remote server as easily as copying files on your local machine. cp cannot do this; to use cp for a remote server, you would first need to mount the remote filesystem locally, which is far more complex and prone to errors.

Here is a common use case, the transfer of a directory, including all of its content:

Lymphatics and the eye

Wed, 12 Feb 2020 00:00:00 +0000

Our shared review about the eye lymphatics has been accepted for publication by Duodecim . In addition to review our current understanding about the eye lymphatics, it focuses on proliferative diabetic retinopathy (PDR). PDR is the advanced stage of diabetic retinopathy, which is one of the slowly developing complications of diabetes and which can result in blindness.It has been known for a long time that damage to the blood vessels in the retina is a central event in the disease development. Antiangiogenic therapy, targeting the major angiogenic growth factor VEGF-A, is a cornerstone of the therapy. However, the recent discovery of lymphatic-type vessels in the disease indicates, that it might be helpful to target also the lymphatic growth factors VEGF-C and VEGF-D. This is my first contribution to an article that is written in Finnish. While I even wrote some of the sentences in Finnish myself, big thanks go to Ani and Timo for weeding out the mistakes. However, my take-home message for similar future endeavors (i.e. writing with a team where key members are not very proficient in the target language) is that one should write everything first in English and then have it translated into the target language. If common languages are concerned, the best tool for the automated translation of scientific articles is DeepL . However, DeepL does not know Finnish, and adding Finnish is certainly not high on the developer’s priority list…

HSL indirectly increases ticket prices

Thu, 16 Jan 2020 00:00:00 +0000

According to the news, the most popular point of sale for HSL tickets (the R-kioski chain) will start to take a commission for loading travel cards. Travel cards are the RFID cards that you need to use Helsinki public transport.However, in reality, this is a hidden price increase, because HSL decided in 2019 that they will stop paying their distribution partners a fee for their service of loading the travel card. No commercial enterprise can offer services for free, hence this is an indirect price jump initiated by HSL.According to changes mandated by the law, HSL had to start competing the sales of their tickets. However, in their call for tender, HSL announced from now on not to pay any commission to any of their distribution partners. This was entirely their own decision, and hence, it is justified to regard it as a covert but deliberate price increase. Besides, there is not much information about these service fees. I could neither find any specific service fee lists from the S-group nor from the K-group. Only R-kioski’s information was easy to find and concise: R-kioski: kausi: 3.5% of ticket price, max. 5 €; arvolippu: 1€/kpl, kertalippu/vuorokuasilippu 3€ 40 cents.The K-group (K-citymarket, K-market) had announced that the fees would range between 0.5-2€, but still, as of today, I could not find more specific information. I even contacted the S-group, but - typically for such companies - they take their time. I would be surprised to get a reply within a week. Considering the big picture, the negative aspect of making environmentally-friendly transport more expensive is dominating the small improvement of increasing the amount of POS for HSL tickets.Read about it in Finnish in Helsingin Sanomat: https://www.hs.fi/kaupunki/art-2000006355404.htmlRead about it in English on the HSL pages; https://www.hsl.fi/en/news/2019/hsls-ticket-sales-network-set-expand-beginning-next-year-18242UPDATE (01.07.2020): Meanwhile the number of HSL-operated ticket vending machines has increased. These machines support topping off the balance of your travel card WITHOUT taking a commission. Additionally, you can also now (something that had been promised for years) top off your balance online . The system has still lots of bugs (according to HSL still about 1% of transactions fail), but hopefully HSL will work out these kinks over the next few decades.

Suojaus UV-valolta

Thu, 12 Dec 2019 00:00:00 +0000

** UV valot luokittellan seuravasti UV-C (100 / 200-280 / 290 nm, lyhytaalto, kova UV)UV-B (290-315 nm, keskiaalto, keskimääräinen UV)UV-A (315-400 nm, pitkäaallon UV, pehmeä UV, “musta valo”)Erityisesti UVC:n suhteen käytetään usein erilaisia aallonpituusrajoja eri UV-tyyppien välisten rajojen määrittelemiseen. Alle 200 nm:n UVC:n aallonpituudet kutsutaan myös “vakuumi-UV (VUV)”. Toiset erottavat UVC-spektrin ja viittaavat aallonpituuksiin välillä 10 - 200 nm “UVC-VUV”. “Extreeminen (äärimmäinen) UV (EUV)” tarkoittaa aallonpituuksia välillä 10-121 nm, ja tämän alueen lyhyessä päässä säteilyä pidetään ionisoivana (niin kuin röntgensäteilyä). En kuitenkaan tiedä mitään selkeää aallonpituusrajaa, jota käytetään ionisoivan ja ei-ionisoivan säteilyn erottelun määrittämiseen. Molekyylibiologia Useimpia molekyylibiologian UV-pöytiå käytetään etidiumbromidilla värjätyn DNA:n kuvantamiseen agaroosigeeleissä. Nämä UV-pöydät käyttävät noin 300-nm aallonpituutta (enimmäkseen 302 nm), mutta joillakin on myös pidempi aallonpituusvaihtoehto. Esim. Alpha Innotech/UVP, Inc/Ultra-Violet Products Ltd./Analytik Jena LM-26E UV-pöytää voidaan käyttää aallonpituudella 302 tai 365 nm). Nyrkkisääntö on, että mitä pidempi aallonpituus, sitä vähemmän se vaurioittaa DNA:ta (samalla myös DNA-interkaloidun etidiumbromidin signaali heikkenee). On myös 254-nm UV-lamppuja, mutta ne eivät sovellu DNA-töihin, koska ne aiheuttavat DNA:ssa mutaatiot jo muutamassa sekunnissa. Tämä ei ole yllättävää, koska DNA:n oma absorptiomaksimi on 260 nm ja se tarkoittaa, että DNA absorboi suurimman säteilymäärän. Siis 302 nm on kompromissi herkkyyden ja DNA-vaurioiden välillä.Työskenteleminen UV-pöydän kanssa ei ole vaaratonta, ja olettaisin, että UV-vaara on suurempi kuin etidiumbromiidivärjäyksen vaara. Jotkut tutkijat irrationaalisesta syystä pelkäävät etidiumbromiidia liikaa (https: //bitesizebio.com/95/ethidium-bromide-a-reality-check/, http://rrresearch.fieldofscience.com/2006/10/heresy-about-ethidium-bromide.html , https://blogs.sciencemag.org/pipeline/archives/2016/04/18/the-myth-of-ethidium-bromide) . Olen nähnyt “auringonpolttaman” yhdessä kollegassani liian pitkältä altistumiselta UV-pöytien UV-valolle. Kasvonaamari suojaa kasvojasi, mutta voit silti polttaa käsiäsi tai dekolteeasi. UV-läpäisevät ja UV-läpinäkymättömät materiaalit Materiaalin (näkyvästä) valon läpinäkyvyydestä ei voida tietää, kuinka tehokkaasti materiaali absorboi UV-valoa. Tavallinen akryylilasi (“Plexiglas”) on läpinäkyvä suuremman aallonpituuden UV-säteilylle (kutsutaan myös UV-A, 315-400 nm) eikä siksi sovellu silmien suojaamiseen ( https://www.gsoptics.com/transmission-curves / ). Akryylilasi voidaan tehdä UV-läpinäkymättömäksi lisäämällä UV-säteilyä absorboivia lisäaineita. UV-suodattavalla akryylilasilla (“museolaadullinen akryyli”) on erilaisia ominaisuuksia. Jos UV-aallonpituus on alle ~ 375 nm, mikä tahansa UV-suodattavaa akryylia käytetään. UF-4-akryylilasi suojaa vähiten: 80% 400 nm: n UV-säteestä johdetaan 2 mm: n levyn läpi. UF-3 suojaa paremmin ja UF-5 absorboi melkein kaiken hyvin näkyvän ultraviolettivalon (> 390 nm). Polykarbonaatti (PC) on ystäväsi Kun tarvitset suojaa UV-säteiltä, polykarbonaatti on kuitenkin ystäväsi. 3 mm paksu polykarbonaatti on käytännöllisesti katsoen täysin läpinäkymätön UV: lle useimmista UV-lähteistä, joita käytetään molekyylibiologiassa 400 nm asti. Siksi UV-suojaavat kasvonaamarit ja aurinkolasit valmistetaan pääasiassa polykarbonaatista.2 mm, joka on hiukan paksumpi kuin polykarbonaattisten aurinkolasien tyypillinen paksuus, on enimmäkseen riittävä, mutta vähemmän tehokas absorptio paksumpiin polykarbonaattiaineisiin verrattuna vain UV: n ollessa yli ~ 385 nm (siis hyvät aurinkolasit suojaavat silmiäsi molekyylibiologian UV-lampuilta , mutta kasvosi iho altistuu silti). Itse asiassa 2 mm paksuissa polykarbonaattisissa aurinkolaseissa on vähemmän kuin 2 mm polykarbonaattia, koska polykarbonaatin molemmilla puolilla on naarmuuntumaton, UV-säteilyä vaimentava pinnoite, koska polykarbonaatti on erittäin pehmeää ja naarmuuntuu helposti. Valitettavasti polykarbonaattimuoveja on vaikea tunnistaa, koska niiden lukumäärä on “7” hartsin tunnistuskoodien (RIC) luettelossa, joka on “Muu” -sekoitettu pussi. Tuottajien tietojen tulkinta **Kun tarkistat lomakkeilla läpinäkyvien materiaalien optiset ominaisuudet, huomaat pian, että niitä on vaikea tulkita. Huomaat pian, että tuottajien verkkosivustojen lähestymistapa on vähemmän tieteellinen, mutta enemmän mainontaa. He puhuvat UV-säteilystä prosenteissa, mutta eivät missään nimessä mainitse materiaalin paksuutta, mikä on yksi tärkeimmistä imeytymisen / läpäisyn näkökohdista ( https://en.wikipedia.org/wiki/Beer%E2%80%93Lambert_law ). Epäilen voimakkaasti, että he käyttävät 2 mm valotieä (paksuus), toinen mahdollisuus on 1 cm (mikä on toinen “vakio” pituus). Jos sinulla on sisäpiiritietoa, ota meihin yhteyttä!

Free digital signing of documents under Linux - an impossibility?

Sun, 01 Dec 2019 00:00:00 +0000

The whole story started when I tried to sign a LibreOffice document. When you belive the internet, document signing is inbuilt into LibreOffice. I still have to find the person that managed to digitally sign a LibreOffice document. This experience shows, that despite Edward Snowden most people do not proactively care about security and privacy. Debian removed scdaemon from the gnupg2 package and as usual, one needs to be a command line ninja to fix this. The scdaemon gives smartcard support (which I do not have, but without the scdaemon the Kleopatra key manager refuses to run). I am using the default Ubuntu 18.04 installation and it was quite an odyssey to get a document signed. In fact, I still do not have a satisfactory way to do this. However one does it, something’s not right. Ubuntu 19.10 has fixed at least the invokation of the key manager from LibreOffice and I can invoke SeaHorse from the document signing dialog, but I still have no clue how to make my gpg keys visible to LibreOffice. Anybody figured this out? Until somebody shows me how to sign with LibreOffice, I use the very good, but proprietary software PDFStudio to import my GPG keys and sign my PDF files.Signing services (DocuSign, HelloSign) So what do you do if you need to sign e.g. a PDF and you have no means or do not want to subscribe to one of the document-signing certificate service like DocuSign ? Even with DocuSign’s budget plan a single digital signing costs $2. DocuSign has a 30-day free trial, but I do not know whether the certificats that you generate during the trial with continue to be valid after the end of the trial. HelloSign ( https://www.hellosign.com , now owned by DropBox ) has also a free tier (allowing to sign 3 documents/month) and when signing, it embeds an invisible signature (which was invalid for some strange reason when I tested it even though HelloSign is in Adobe’s approved trust list).Self-signing, cacert and StartSSLTechnically you can created your own signatures (self-signed certificates), but if such PDFs are viewed with Acrobat Reader, the signature will be flagged as invalid and the fact of self-signing is displayed. There used to be http://www.cacert.org/ , but to my knowledge, all browsers have removed the CAcert certificates and the same is likely true for Acrobat. StartSSL used to give out free certificates, but they do not exist anymore (they were seriously challenged with their own security).PDF Viewer supportInterestingly many PDF Viewers do anyway ignore the signing (e.g. the inbuilt PDF viewer from Firefox does not display anything). Other PDF viewers will display the signature, but NOT indicate, that it is not trusted (e.g. the Chrome Browser’s PDF viewer and Ubuntu’s default PDF viewer Evince). Since you have no idea what viewer your target will use to display your signed PDF, you are anyway in a bad situation (even if you subscribe to a document signing service). LetsencryptTo increase the trust in the signing, one can use a Letsencrypt certificate for signing. This signature certifies that the author of the document controls a specific website (in my case jeltsch.org). That is more than a self-signed certificate (and if the website is trusted, this is arguably also more than buying a subscription from DocuSign), but the re-purposed Letsencrypt certificate is not being trusted by Adobe since obviously the Letsencrypt endeavor was never meant for document signing (“Signer’s identity is unknown because it has not been included in your list oif trusted certificates and none of its parent certificates are trusted certificats”). However, the maximum lifetime of such a certificate is 3 months, after which it becomes invalid. It can still be used, but it will display that it is not valid because it has expired (or is not valid yet).How to misuse the Letsencrypt certificateFirst, you need a web server, that uses Letsencrypt certificates to verify the web site identity. This is out-of-scope for this blog post, but there are several good tutorials (e.g. from the Let’s Encrypt people themselves or from Digital Ocean ). Once you have your Let’s Encrypt certificates, this is the process to “misuse” them for signing documents:Since Letsencrypt requires certificate renewal every three months, there will be lots of fullchain.pem and privkey.pem files in the same directory and they are numbered. You obviously want to use the newest (the only valid) certificate and perhaps you want to renew the Let’s Encrypt certificate immediately before exporting it for document signing:certbot --apache --force-renewal -n -d jeltsch.org or if you want to renew all certificates: certbot --apache --force-renewal If you choose to renew all certificates, certbot will try to issue a single certificate for all domains that exist on your server (this possibility did not exist in the beginning of the Letsencrypt ecosystem, but was introduced later). If your server serves more than one domain, you need to manually specify the domain name, for which you want the certificate.For more details about how to use the certbot script, see https://certbot.eff.org/docs/using.html#certbot-commandsThis is the command, that converts the certs into a PKCS#12 file:openssl pkcs12 -export -out signing_certificat.p12 -in /etc/letsencrypt/archive/website-name/fullchain1.pem -inkey /etc/letsencrypt/archive/website-name/privkey1.pemThe PKCS#12 file stores the certificate and the private key in one encrypted file (with the file extension .p12). Therefore, the command will ask from you a keyphrase, which you absolutely need to remember to be able to use the certificate. Then you can transfer the p12 file to your desktop computer and use it to sign PDF files.Time stamping serversIf your PDF application asks for a time stamping server, you can use one of the free services, e.g. ca.signFiles.com/TSAServer.aspx or http://zeitstempel.dfn.de . However, also these time stamping services are not trusted by Adobe Acrobat.Here the commands to generate a self-signed certificate (it asks for a (temporary) passphrase, just make up something and remember it, you need it in the second step):openssl req -x509 -newkey rsa:4096 -keyout key.pem -out cert.pem -days 3650Conversion into a signing certificate (it first asks you for the temporary passphrase from above and then for the final passphrase, which you need to remember in order to use the certificate:openssl pkcs12 -export -out signing_certificat.p12 -in cert.pem -inkey key.pem

Bullying from the top

Fri, 22 Nov 2019 00:00:00 +0000

Some numbers from the Nature 2019 graduate survey ( https://www.nature.com/articles/d41586-019-03535-y ) are discomforting. Very few of the respondents were from Finland, and therefore the aggregate from Finland has to be taken with a grain of salt. But every single incidence is one incidence too much. What worries me most is a) that bullied PhD students in Finland feel that they cannot speak out about their experiences without repercussions, and b) that bullying from the top might be more prominent in Finland as opposed to bulling from peers (if one includes other academic staff into the “top”). One student reportedly experienced bullying from the programme director (which falls under “other”, which was not separately listed by Nature in the graph). Numbers do not add up to 100% due to rounding and multiple mentionings.

Protection from UV light

Fri, 15 Nov 2019 00:00:00 +0000

First, some definitionsUV-C (100/200-280/290nm, short-wave, hard UV)UV-B (290-315nm, medium-wave, intermediate UV)UV-A (315-400nm, long-wave UV, soft UV, “black light”)Especially for UV-C, different wave-lengths cut-offs are occasionally used to define the borders between the different UV types. Some exclude the wavelengths below 200 nm from UV-C and refer to them with the term “vacuum UV (VUV)”. Others subdevide the UV-C spectrum and refer to the wavelengths between 10 and 200 nm as “UV-C-VUV”). “Extreme UV (EUV)” refers to wave lengths between 10-121 nm and at the short end of this range, radiation is considered to be ionizing (similar to X-rays). However, I do not know of any clear wavelength border that is used to define a separation between ionizing and non-ionizing radiation. Molecular biologyMost UV tables for molecular biology are used to detect ethidium bromid-stained DNA in agarose gels. They use a wavelength around 300nm (mostly 302nm), but some have a longer wavelength option (e.g. the Alpha Innotech LM-26E can be operated at 302 or 365 nm). Rule of thumb is that the longer the wave length the less damage is done to the DNA (but the signal from DNA-intercalated ethedium bromide becomes also weaker). There are 254-nm UV lamps, but these are not suitable for DNA since they will mutate your DNA within seconds. This is not surprising since the absorption maximum of DNA itself is at 260 nm and meaning that the maximum amount of radiation is absorbed by the DNA. Hence the 302 is a compromise between sensitivity and DNA-damage. Working with a UV-table is not without danger and I would assume that there is more danger from UV than from the ethidium bromide stain, which some people (scientists!) for one or the other irrational reason are too much afraid of ( https://bitesizebio.com/95/ethidium-bromide-a-reality-check/ , http://rrresearch.fieldofscience.com/2006/10/heresy-about-ethidium-bromide.html , https://blogs.sciencemag.org/pipeline/archives/2016/04/18/the-myth-of-ethidium-bromide ). I have seen “sunburn” in one of my colleagues from too long exposure to UV light from UV-tables. The face mask protects your face, but you can still burn your arms or your décolletage.UV-transmissive and UV-opaque materialsThere is no way of knowning from the (visible) light transparency of a material how efficiently the material absorps UV light. Regular acrylic glass (“Plexiglas”) is transparent to higher wavelength UV radiation (also called UV-A, 315-400 nm) and is therefore not suitable for protecting the eyes ( https://www.gsoptics.com/transmission-curves/ ). Acrylic glass can be rendered UV-opaque by adding UV-absorbing additives. UV-filtering acrylic glass (“museum grade acrylic”) comes in different qualities. If the UV wave length is below ~375nm, any UV-filtering grade acrylic will do. UF-4 acrylic glass protects the least: 80% of 400nm-UV is passed through a 2mm sheet. UF-3 protects better and UF-5 absorps almost all of the very near-visible light UV (>390nm).Polycarbonate (PC) is your friendHowever, when you need protection from UV, polycarbonate is your friend. 3 mm thick polycarbonate is virtually completely opaque to UV from most UV sources used for molecular biology up to 400 nm. Therefore, UV-protecting face masks and sun glasses are made mostly from polycarbonate.2 mm, which is a bit thicker than the typical thickness of polycarbonate sunglasses, is mostly sufficient but the less efficient absorption compared to thicker polycarbonate matters only for UV above ~385nm (hence, good sun-glasses protect your eyes from molecular biology UV lamps, but your face skin still gets exposed). In fact, 2 mm thick polycarbonate sunglasses have less than 2 mm polycarbonate since they have on both sides of the polycarbonate a non-scratch non-UV-absorbing coating, because polycarbonate is very soft and gets scratched very easily. Unfortunately polycarbonate plastics are difficult to recognize as their number is “7” on the resin identification code (RIC) list, which is the mixed bag of “Other”.Interpreting producers’ dataWhen you check the data sheets for the optical properties of transparent materials, you soon realize that they are difficult to interpret. You soon notice that the approach of producers’ web sites is less scientific, but more advertising. They talk about UV-transmission in %, but do nowhere mention the thickness of the material, which is one of the most important aspects of absorption/transmission ( https://en.wikipedia.org/wiki/Beer%E2%80%93Lambert_law ). I strongly suspect that they use a 2 mm lightpath (thickness), the other possibility being 1 cm (which is the other “standard” length). If you have any insider knowledge, please let me know!

PXE-booting from Netgate Pfsense SG-3100

Fri, 15 Nov 2019 00:00:00 +0000

To install Linux without the need of a CD/DVD/USB-stick, I now use PXE-booting (“pixie”-booting) on our local home network. I could not find good instructions and had to try out things before it started working, but the process itself is fairly simple. Here are the steps:

University of Helsinki loses court battle about lawfulness of 2015 mass layoff procedures

Wed, 16 Oct 2019 00:00:00 +0000

In 2015, the University of Helsinki sacked around 370 of its employees (and did not prolong temporary contracts of perhaps as many). Many survived only because their contracts did not end around the time when the “central committee” of the university administration overreacted when they realized how bad the university’s financial situation really had become. About 10 years of conservative financial austerity culminated in the spring 2015-elect government led by Finnish businessman Juha Sipilä, who was jointly responsible for the massive funding cuts that led to the massive layoffs at the end of 2015.Last month, a Finnish district court ruled that the layoffs had not been legal in the sense that the University of Helsinki did not adhere to the Finnish law on several accounts (" Yhteistoimintamenettelylaki ", in English something like “Act on Collaboration in Businesses”). Notably, the court rebuked the university for its information policy and their lack of attempts to negotiate alternatives to the layoffs. This was exactly the feeling of most employees at the time: The central administration had cooked up a “solution” in some backroom meetings without consulting any of the stakeholders, and then it carelessly pushed this solution regardless of the consequences.The compensations that were granted to the plaintiffs were 5000 or 6000€ depending on the length of their employment. One can argue about the pros and cons of the US-American legal view on compensations (which aim at deterrence rather than compensation), but even for a financially challenged University, 64000€ (including 35000€ legal costs and 29000€ compensation to the five plaintiffs) will neither help the plaintiffs very much nor deter any university from repeating such actions. And judging from the response, the university’s central administration does not agree with the view of the district court, that the procedure did not follow the law.The largest Scandinavian daily newspaper Helsingin Sanomat reported about this case: https://www.hs.fi/politiikka/art-2000006245821.html and also many other magazines, e.g. http://www.acatiimi.fi/6_2019/12.php .

Lymphologie 2019

Sat, 12 Oct 2019 00:00:00 +0000

A week ago, I visited Germany to participate in the Lymphologie 2019 conference, which took place in Bad Krozingen near Freiburg.The conference is jointly organized every two years by the DGL ( Deutsche Gesellschaft für Lymphologie ) and the GDL ( Gesellschaft Deutschsprachiger Lymphologen ). The meeting is overall very hands-on and clinically oriented with many workshops and practical advice. Therefore, it’s highly recommended for practitioners who are able to understand German. However, there is also a “basic science” track, and the organizers always manage to recruit some decent scientists for this track (see here: https://www.lymphologie-kongress.de/programm/samstag-03-10-15/) . Notably, the talks are delivered in German, which doesn’t make the recruiting task easier. Lymphologists in Germany continue to play a leading role in the treatment of lymphedema (and recently lipedema) with uniquely specialized experts and facilities ( Földiklinik ), but English has become the language of biomedical research also in Germany. However, there is still a need for dissemination of research results in German language and that’s why I contribute occasionally to the German-language journal “Lymphologie in Forschung und Praxis”.

ISK 2019

Thu, 10 Oct 2019 00:00:00 +0000

The International Symposium on Kallikreins and Kallikrein-related Peptidases (ISK) took place on September 25.-27. in Prague. Being not from the kallikrein-field, I learned a lot. E.g. I was not aware that KLK4 can activate plasminogen (a fact that might explain some of our early, inconsistent results where KLK4 occasionally seemed to weakly activate VEGF-C in cell culture). Not surprisingly, many participants were interested in our findings that KLK3/PSA can activate the growth factors VEGF-C and VEGF-D, both of which are implicated in cancer progression, notably in metastasis. They confirmed that there is not very much research on the effect of KLK3/PSA mutations on human fertility, but I am sure that someone is going to look at that.Even though it is considered more prestigious to deliver a speech than to present a poster, I have to reconsider and perhaps will present next time a poster. What I would prefer most: talking AND presenting and poster. Why do so few conferences offer this possibility? What depth can you delve into if you have only 15 minutes on stage? Has the attention span of conference participants really decreased over the recent decades due to Facebook, Youtube and Instagram? Maybe: https://www.telegraph.co.uk/science/2016/03/12/humans-have-shorter-attention-span-than-goldfish-thanks-to-smart/The atmosphere at the conference was really friendly and cooperative, perhaps also owing to the relatively small number of participants. If we really should extend our excursion into the KLK-field, I have many experts to turn to for help. I also met some researchers from the Charles University of Prague, who are doing lymphatic research and it looks like we can help each other out with our specific experimental possibilities. All in all, a very successful trip. Excluding the Lufthansa flight back home, which arrived so late for transit in Frankfurt that I did not manage to do shopping there on my way back as I had originally planned (many shops in Germany do close at 5 pm).

PoGo

Sun, 22 Sep 2019 00:00:00 +0000

If you are looking for the identity of PoGo players MarMiJe or JelMicMar in order to organize an exchange or a raid, just e-mail me at michael@jeltsch.org ! Although PoGo was touted to be a community game, it is paradoxically not possible to send any messages to friends within the software itself. That is not a problem for those friends that are part of your real life, but how can you contact a best friend from another country, with whom you have exchanged presents every single day for 3 months?

Finnish abstract of our recent work about PSA (Prostate-specific antigen) in Duodecim

Sun, 25 Aug 2019 00:00:00 +0000

There is a nice Finnish language abstract about our recent finding that PSA (Prostate-specific antigen) activates VEGF-C and VEGF-D in the Finnish medical journal Duodecim: Eturauhassyövän merkkiaine PSA aktivoi syövän leviämiseen osallistuvia veri- ja imusuonikasvutekijöitä ( https://www.duodecimlehti.fi/lehti/2019/15/duo15024 ). Given the dominant position of the English language in medical science (and life science in general). Duodecim is arguably the only relevant, remaining Finnish language medical journal. Duodecim is the publication of the homonymous Association of Finnish Medical Doctors.

Nautilus (Ubuntu's file manager) and bookmarks

Tue, 06 Aug 2019 00:00:00 +0000

In the very old days, the Ubuntu’s file manager’s bookmarks were stored directly as invisible file in the home folder ($HOME/.gtk-bookmarks). Since 14.04, they have been hiding two levels deep in $HOME/.config/gtk-3.0/bookmarks.And if you wonder where the Nautilus scripts are, they are nowadays at $HOME/.local/share/nautilus/scripts/.

Mounting lvm2 manually

Fri, 02 Aug 2019 00:00:00 +0000

All commands as sudo:

vgscan (--mknodes)
vgchange -ay (volumegroupname)
(lvdisplay or lvs or ls -l /dev/volumegroupname/)
mkdir -vp $PATH/{home,root} (to make a moint point)
mount /dev/volumegroupname/home $PATH/home
mount /dev/volumegroupname/root $PATH/root
(ls -al $PATH/home)

Protein Purification Course 2019

Wed, 31 Jul 2019 00:00:00 +0000

We are again hosting the DPBM protein purification course this December in our lab. Secure your place as this practical course is popular and there are only 16 seats. You can bring your own protein and we will individualize the course program based on your needs!More information: http://research.med.helsinki.fi/corefacilities/b3p/teaching.htmlRegistration : https://courses.helsinki.fi/en/dpbm-135/131042336

How to enable passwordless logins to a server

Wed, 24 Jul 2019 00:00:00 +0000

Enable root login with password on the server. To do so, you need to edit the file /etc/ssh/sshd_config.Modify the lines starting with “PermitRootLogin” like this:#PermitRootLogin prohibit-passwordPermitRootLogin yes
Restart the sshd server:sudo systemctl restart sshd
On the client, copy the public key files to the server with the ssh-copy-id command:ssh-copy-id root@server
On the server, disable root login with password and enable root login with public key authentication:PermitRootLogin prohibit-password#PermitRootLogin yes

Ḿanuscript reviewing by annotating PDFs

Fri, 28 Jun 2019 00:00:00 +0000

Manuscripts for scientific peer-review are delivered as PDF files. Thus it appears most natural to comment the PDF file itself instead of submitting the comments as a separate text (file). However, many submission systems do not allow to submit comments in form of an annotated PDF file.In addition, there is no easy-to-use free/Open Source PDF editor for Linux (my platform of choice). Yes, there is PDFEdit ( http://pdfedit.cz/en/index.html) , but it requires substantial learning and its last release dates back to 2012. There are free online PDF editors (e.g. https://www.pdfescape.com/) , but sometimes I need a local tool. Although not Open Source and not free, the tool of my choice has been PDF Studio Pro . It has all the features I need (actually much more than I need), it is truly cross-platform (Windows, Mac, Linux), easy to use and very affordable for what it offers ($129 single permanent license). Unfortunately, Quoppa software - the maker of PDF Studio - does not offer academic discounts.PDF Studio ViewerA while ago, the makers of PDF Studio started to offer a free version called PDF Studio Viewer . This free version has gotten more useful over time. Since last year, it also supports PDF annotation, which is very important for my work, mostly when I am peer-reviewing scientific manuscripts. For many academic users, the PDF Studio Viewer might be fully sufficient.Libre Office and InkscapeOf course Libre Office Draw and Inkscape can edit PDFs, but they are not specialized for annotating. If you need to do extensive annotations, the process becomes soon very painful. In addition, Inkscape editing can be destructive (i.e. when you modify text), but I have used it e.g. to fill out forms.Apart from the lack of dedicated annotation and reviewing tools (“markups” like “replace text”, “crossout text”, “delete text”, “insert text” or callouts), Libre Office Draw is actually a quite capable PDF editor, but fails still sometimes to correctly open very complex PDF documents (I have had problems with background images/patterns). Strangely, the only reviewing tool (comments) are not exported by default. You need to check the “Export comments” box when you export your edited PDF file as PDF (the “Save” operation creates an ODG file, which you probably don’t want).PDFsamIf you do not have the need to annotate, then you might get away with the Open Source tool PDFsam . Unlike PDFEdit, PDFsam is available from the Ubuntu repositories. PDFsam also has two non-free versions ( PDFsam Enhanced and PDFsam Visual ). PDFsam Basic (the Open Source version) is just a simple GUI on top of some command line utilities, whereas the PDF Studio Viewer offers a true visual editing experience. I canot talk about the non-free versions of PDFsam as they are not available as free trials. In fact, all of the operations of PDFsam can be achieved via the command line (see here for my blog post about how to perform common PDF editing tasks using mostly the command line tool pdftk ).Reducing file sizePDFsam Basic and PDF Studio Viewer do not offer any functionality to reduce file size. The LibreOffice Draw PDF export dialog let’s you reduce image resolution and JPEG compression, which you can use to reduce file size. But at the Open Source front, the only capable tools to reduce PDF size seem to be command line tools. I use ghostscript for this task, but the command is not easy to remember:gs -sDEVICE=pdfwrite -dCompatibilityLevel=1.4 -dPDFSETTINGS=/screen -dNOPAUSE -dQUIET -dBATCH -sOutputFile=output.pdf input.pdfWith PDF Studio Pro, you obviously do not need to remember the different keywords for the different output quality option (screen, ebook, printer, prepress) as you just choose from the drop down menu between the available options. If you are looking for an Open Source graphical wrapper for ghostscript, perhaps try workerPdf . Signing documents and adding signaturesPDF Studio Viewer let’s you sign documents if you have a DocuSign subscription . However, I am mostly concerned about being able to prove myself that I created a certain document (“self-signed signature”) and not that others are able to verify my authorship. For this scenario you are out of luck with PDF Studio Viewer. And apparently, PDFSam does not offer any possibility for signing (neither self-signing nor 3rd party signing). However, Libre Office Draw allows documents signing! I have been looking for an affordable solution (not self-signed, but trusted by other PDF readers) to sign PDF documents, but there seems to be no appropriate solution if you need to sign only rarely. The basic plan by DocuSign ($10/month) appears too expensive when signing only one document per month.Take-home messageIf you want to stay with free or Open Source solutions, you probably need to combine several tools in order to cover all typical PDF editing tasks without pain: PDFsam Basic, LibreOffice Draw, PDF Studio Viewer and ghostscript. But if you edit PDFs often (as I do), buying PDF Studio Pro is clearly the way to go.

Ubuntu 18.04 boot messages

Tue, 25 Jun 2019 00:00:00 +0000

After switching computers (but staying on the same version of Ubuntu), I copied my openvpn configuration (/etc/openvpn) to the new system. And when I booted next time, I received a weird request during boot to type in my username and password. There was no mentioning for what purpose, so I had to guess. Additionally, there is a bug that required me to press twice the Enter key after the username and password. It appeared to be openvpn, which tried - by default - to start up all openvpn configurations that it could find in /etc/openvpn. On my old system I had set it not to start anything automatically. And of course this setting is not in the /etc/openvpn directory, but in /etc/default/openvpn. In order to prevent automatic starting, you need to uncomment the#AUTOSTART="none" line.In order to see what process was asking for the password during boot, I needed to see all the boot messages. This is done by pressing Esc shortly after boot to see the grub boot menu (if you have only Ubuntu installed, otherwise you’ll see the boot menu by default). You just press e to get into edit mode. Here you edit the line that starts with linux and delete the two words “silent splash”. Then you press F10 to start the boot process.

Re-purposing the growth factor VEGF-C

Sat, 22 Jun 2019 00:00:00 +0000

An eLIFE digest features our recent publication about VEGF-C ( https://elifesciences.org/digests/44478/re-purposing-the-growth-factor-vegf-c ). Even though our research did not deeply delve into the function of VEGF-C during reproduction, the reviewers comments and our answers (under the “Author response” heading) give more insight than the publication itself. We did not include the sperm motility data in the manuscript. Although sometimes stunning in its magnitude, we did not always measure increased sperm motility in response to active VEGF-C. As is common knowledge, sperm as a biological sample is of highly fluctuating consistency and quality. Interestingly, a paper in eLIFE published two years ago gives some additional insight in what we might be dealing with: Sperm competition risk drives rapid ejaculate adjustments mediated by seminal fluid . This paper shows that the swimming speed of sperm is rapidly regulated by males depending on the social situation (presence of a female or a male competitor). Imho, such factors seem to be almost impossible to control when dealing with human samples…However, the title ambiguously also refers to cancer. Based on our data, we speculate that VEGF-C can be repurposed from being lymphangiogenic to being angiogenic, and further, to be metastasis-promoting.

No quantum leap towards a car-free city

Fri, 14 Jun 2019 00:00:00 +0000

The public transport company of the Finland’s capital region (HSL) has moved to a new fare system . The system was previously based on the city borders. This was unjust: A one-kilometre trip cost you more than 4 Euros if it happened to cross a city border while a 20-km trip (e.g. from Lauttasaari to Vuosaari) might have been only 2.2 €. Now the capital region is divided into concentric zones around the city center of Helsinki and the fare is determined which and how many zones you are entering during the trip. The trips are paid with an electronic travel card, which can be loaded with “time” (weekly, monthly or seasonal ticket) or “value” (to pay individual journeys).Insignificantly cheaper for most, but not allThe implied promise was that the system does not get more expensive, but this is obviously not true for everybody. For those people that use single tickets, the rise is noticeable. The price of a single ticket within the AB zone rose from 2.2€ to 2.8€ which is more than 27%. On the other hand the ticket is now valid for 80 minutes (instead of 60 minutes) and the region that can be travelled with the new ticket has expanded (mostly into the Western direction to Espoo). However these additional improvements are relevant only for a limited number of customers since the bulk amount of journeys stay within 60 minutes and within the Helsinki area of the AB zone. Moreover, the single tram-only tickets have been abolished. These tram tickets were much cheaper then the regular tickets that entitle you to ride any type of public transport. There are several media stories about the loosers of the ticket reform in the Finnish press, e.g. at Talouselämä: https://www.talouselama.fi/uutiset/hsln-lippu-uudistuksen-haviajat-ratikkamatkustajat-kolmannen-vyohykkeen-kautta-kulkevat-ja-vain-helsingissa-matkustavat/703ca51a-c6b8-3b71-9804-9f35ad89eeaa . PromisesMy own public transport expenses have been sharply rising (by about 25%) as I primarily used single tickets within the Helsinki part of the AB zone. This wouldn’t be a big issue if HSL had kept its promise to offer a substantial discount on users that keep the auto-renewing subscription ticket valid for a year or longer. However, I cannot even find this promise any more on the HSL website. When I asked the customer support of HSL, they told me that they are working on the implementation of such a discount, but they cannot say when it will be ready. This reminded me of the previous fare system update, when HSL promised to introduce a supplementary ticket for owners of monthly tickets valid within Helsinki in order to extend its range without the need to buy a full-price ticket for the whole greater Helsinki Region (“seutulippu”).No quantum leap towards a car-free cityWhile overall perhaps a tiny step into the right direction, the fare-system renewal is far from an attractive offer for car drivers to become public transport users. Much more courage and bigger steps are needed if Helsinki seriously wants to make private car ownership pointless by 2025 . For families with children living in the C zone, the car is even financially still too competitive compared to public transport (ABC ticket for 2 adults & 2 children for one year: ~3500€).

Lymphologische (Grundlagen-)Forschung: wie funktioniert das?

Wed, 29 May 2019 00:00:00 +0000

Vortrag für den 43. Jahreskongress der Deutschen Desellschaft für Lymphologie

PD Dr. Michael Jeltsch Universität Helsinki & Wihuri-Forschungsinstitut Haartmaninkatu 8 FIN-00290 Helsinki, Finnland michael@jeltsch.org

KLK3/PSA and cathepsin D activate VEGF-C and VEGF-D

Sat, 18 May 2019 00:00:00 +0000

Prostate-specific antigen (PSA) is well known - at least among older males - as a prostate cancer marker, but few people know its physiological function: Sperm cells are trapped in fresh ejaculate, which has a jelly-like consistence. In order to release the sperm cells, the ejaculate needs to be liquefied and precisely this liquefaction is the task of PSA.Also surprising for many people is the fact, that scientists still do not know why high PSA levels are associated with prostate cancer. In our latest research published yesterday in eLIFE , we have made a big step ahead in understanding the role of PSA in both reproductive and cancer biology.It appears that PSA (aka as kallikrein-related peptidase 3 - KLK3) and another enzyme called cathepsin D can activate two growth factors which have been implicated in cancer progression: VEGF-C and VEGF-D . These growth factors do likely contribute to tumor angiogenesis and tumor lymphangiogenesis. By inducing angiogenesis - the growth of blood vessels - the tumor ensures its own supply with nutrients and oxygen. Such blood supply is necessary for a tumor to grow beyond the size of a few millimeters. Likewise, tumor lymphangiogenesis happens when the tumor induces the growth of lymphatic vessels and it is tightly linked to the lymphatic spread (metastasis) of the tumor.Both VEGF-C and VEGF-D are produced as inactive precursors (pro-VEGF-C, pro-VEGF-D) and need to be activated in order to induce the growth of blood or lymphatic vessels. With ADAMTS3 , we have identified the enzyme that activates VEGF-C during embryonic development - which also requires vessel growth - in 2014 ( Jeltsch et al. ). However, it remained unclear whether the same enzyme is responsible also for pathological vessel growth. Now it seems likely that patholigical vessel growth uses different enzymes and PSA and cathepsin D have become prime suspects. Our next experiments will test whether we can slow down or halt cancer growth by blocking these enzymes.

1000+ citations

Wed, 15 May 2019 00:00:00 +0000

The first among my publications to brake the 1000 citations-barrier was Gerhardt et al. 2003 . With the “tip cell concept”, it set a paradigm for vascular biology research: Not all endothelial cells are equal and the tip cell is a specialized cell that marks the forefront of the angiogenic sprout. However, my contribution was limited (number 7 out of 11 authors): I produced most of the proteins that were needed for the study. This spring, Jeltsch et al. 1997 crossed the first time the 1000-citation mark. The paper describes a mouse, that overexpresses VEGF-C in the skin. It is the first ever in-vivo demonstration of a lymphangiogenic growth factor. Although not setting any paradigm, it marks the start of the molecular era in lymphatic research . What percentage of papers achieve 1000+ citations? That differs between disciplines, but e.g. according to https://en.wikipedia.org/wiki/Citation_impact on average it is less than 1 in 4000. Compare this to the average paper, which receives 7.8 citations. And even this average is heavily influenced by a few highly-cited papers ( similar to the Impact Factor ). The median number of citations is 4, meaning that about half of all papers have less than 4 citations (see here ).

Is Ubuntu 18.04 still using the SSD drive for swap?

Fri, 10 May 2019 00:00:00 +0000

In an Ubuntu 18.04 two disk setup (/ on SSD, /home on spinning drive), my Ubuntu 18.04 has still defaulted to use swap space on the SSD although there was a swap partition of the same size on the spinning drive. This was not a new install, but a system upgrade from 16.04 (where I had created a swap partition manually on the spinning drive to spare the SSD). Linux is able to determine whether a drive is spinning or not, but apparently the installation/upgrade script was not very smart.What swap partitions are available?sudo fdisk -l[…]Disk /dev/sda: 74,5 GiB, 80026361856 bytes, 156301488 sectorsUnits: sectors of 1 * 512 = 512 bytesSector size (logical/physical): 512 bytes / 512 bytesI/O size (minimum/optimal): 512 bytes / 512 bytesDisklabel type: dosDisk identifier: 0x34836041Device Boot Start End Sectors Size Id Type/dev/sda1 * 2048 148054782 148052735 70,6G 83 Linux/dev/sda2 148056062 156301311 8245250 4G 5 Extended/dev/sda5 148056064 156301311 8245248 4G 82 Linux swap / SolarisDisk /dev/sdb: 931,5 GiB, 1000204886016 bytes, 1953525168 sectorsUnits: sectors of 1 * 512 = 512 bytesSector size (logical/physical): 512 bytes / 512 bytesI/O size (minimum/optimal): 512 bytes / 512 bytesDisklabel type: dosDisk identifier: 0xf6870277Device Boot Start End Sectors Size Id Type/dev/sdb1 2048 8390655 8388608 4G 82 Linux swap / Solaris/dev/sdb2 8390656 1953525167 1945134512 927,5G 83 Linux[…]Checking which drive is the SSD:cat /sys/block/sda/queue/rotational0cat /sys/block/sdb/queue/rotational1Which swap partition is used?more /etc/fstab[…]# swap was on /dev/sda5 during installationUUID=fdb5ad84-f758-4326-a6c8-7adf91d21079 none swap sw 0 0[…]Check whether the UUID corresponds to the SSD:sudo blkid /dev/sda5/dev/sda5: UUID="fdb5ad84-f758-4326-a6c8-7adf91d21079" TYPE="swap" PARTUUID="34836041-05"

Apply successfully to the University of Helsinki

Sun, 28 Apr 2019 00:00:00 +0000

What are my chances to be accepted into a Helsinki University Master’s Program?

This differs greatly from year to year and between the different programs. The admission rates for most individual programs have been anywhere between 5% and 40%, with popular programs like Environmental Change and Global Sustainability or Economics at the low end and e.g. Forest Sciences and Theoretical and Computational Methods at the high end.

Linux copy (cp)

Wed, 17 Apr 2019 00:00:00 +0000

In order to copy all xml files from one directory to another without overwriting existing files with the same name:cp -vnpr /source/*.xml /destination

Denkbar knapper Sieg der Finnischen Sozialdemokraten über die ultrarechten Basisfinnen

Mon, 15 Apr 2019 00:00:00 +0000

Die gestrigen Parlamentswahlen in Finnland verliefen so dramatisch wie lange nicht mehr. Bis in die frühen Morgenstunden hatten viele Wähler gezittert, weil es zeitweilig so aussah, dass die Rechtaussenpartei der Basisfinnen die stärkste Fraktion im finnischen Parlament stellen würde und damit auch traditionell den Vortritt bei den Regierungsverhandlungen gehabt hätte. Der letztendliche Vorsprung der Sozialdemokraten vor den Basisfinnen fiel mit 0.2% hauchdünn aus. Obwohl die Sozialdemokraten nach 1999 erstmals wieder die stärkste Fraktion stellen werden, ist die Freude verhalten. Da keine Partei über 20% der Stimmen erreichen konnte, wird die Regierungsbildung schwierig. Alle demokratischen Parteien hatten im Vorfeld der Wahlen eine Koalition mit den Basisfinnen ausgeschlossen. Die von einigen erhoffte Schwächung der ultrarechten Basisfinnen durch eine Parteispaltung vor nicht einmal zwei Jahren ist nicht eingetreten und macht den Wahlerfolg der Basisfinnen um so verstörender. Das finnische Konzept, die Anziehungskraft der ultrarechten Parteien durch ihre explizite Einbinding in die Politik zu schwächen hat sich somit wahrscheinlich als Fehler herausgestellt. Zwei zentrale Standpunkte der Basisfinnen waren die verschärfte Einwanderungs- und Flüchtlingspolitik und die vielleicht geringste Priorität aller Parteien bezüglich des Umweltschutzes und speziell der Bekämpfung der globalen Erwärmung. In beiden Punkten unterscheiden sich die Basisfinnen grundlegend von fast allen anderen Parteien. Traditionell ist aber die finnische Politik eine Konsenspolitik und mit wenigen Ausnahmen sind Koalitionen jeder Partei mit jeder anderen Partei denkbar. Zur Zeit sieht noch so aus als ob alle demokratischen Parteien sich an ihr Wahlversprechen halten werden, nicht mit den Basisfinnen zu koalieren. Der wahrscheinliche zukünftige Ministerpräsident der Sozialdemokraten Antti Rinne hat in einem Interview nach der Wahlnacht noch einmal die Unvereinbarkeit der Standpunkte der Basisfinnen mit sozialdemokratischen Werten betont und das er eine unterschiedliche Behandlung von Menschen aufgrund ethnischer Zugehörigkeit oder Hautfarbe unmöglich akzeptieren kann.Im Prinzip ging es bei den Wahlen um eine Abrechnung mit der seit vier Jahren im Amt befindlichen Koalitionsregierung unter dem Ministerpräsidenten Juha Sipilä. Juha Sipilä hatte schon vor einem Monat den Rücktritt seiner Regierung bekanntgegeben, und war nur noch geschäftsführend im Amt, weil er zentrale Versprechen zur Erneuerung des Gesundheitssystems aufgrund mangelnder Unterstützung nicht einhalten konnte. Sipilä von der Finnischen Zentrumspartei ist (oder sollte man lieber sagen war) ein Quereinsteiger aus der Wirtschaft in die Politik. Obwohl die konservativen Sammlungspartei und die Basisfinnen (dem finnischen Pendant zur AfD) auch der bisherigen Koalitionsregierung angehörten, wurde nur die Zentrumspartei vom Wähler für die Politik der letzten Jahre mit massiven Verlusten von über 7% abgestraft, ihrem schlechtesten Ergebnis seit 100 Jahren.Ob meine eigenen Hoffnungen nach verstärkten Investitionen in Bildung und Forschung sich erfüllen, steht und fällt mit den Sozialdemokraten und deshalb haben sie auch meine Stimmen erhalten. Obwohl auch alle anderen Parteien versprochen haben die Ausgaben für R&D langfristig zu verdoppeln, ist die Ideologie der schwarzen Null auch in Finnland bei den Konservativen beliebt. Zumindest die Konservativen und die Zentrumspartei haben innerhalb der letzten 10 Jahre jede Gegegenheit verpasst zu zeigen, dass ihnen Investitionen in unsere Zukunft und in unsere Kinder am Herzen liegen. Es ist schon merkwürdig, dass es Geschäftsleuten wie Juha Sipilä ein fremder Gedanke sein sollte, dass man die Zukunft investieren muss, um wettbewerbsfähig zu bleiben.

ChemBio Finland

Thu, 28 Mar 2019 00:00:00 +0000

The biyearly ChemBio Finland event at the Helsinki Fair Center is taking place on this week’s Wednesday and Thursday. I presented our key project at the booth of the Academy of Finland ( http://www.aka.fi/fi/akatemia/media/Ajankohtaiset-uutiset/2019/tervetuloa-suomen-akatemian-osastolle-chembio-messuille/) . Many people showed up to listen to our work on how to move in-vitro antibody generation technologies into the 21st century using synthetic biology and Crispr.

Passwordless login via the GUI and ssh defaults

Mon, 25 Mar 2019 00:00:00 +0000

I use cloud services at CSC (e.g. pouta.csc.fi), and they do not allow SSH login with a traditional username/password combo. When I want to make a bookmark in my file manager (Nemo oder Nautilus/Files), pointing to this location. I need to specify an RSA key file that is used for the login. On the command line, it looks as follows:

Poor correlation of the Journal Impact Factor with scientific impact

Wed, 13 Mar 2019 00:00:00 +0000

Definition of the Journal Impact FactorThe Journal Impact Factor (JIF or short IF) of Journal X is the number of citations found from all journals & proceedings (in the Web of Science core collection ) published in 2017 to articles in Journal X, divided by the number of articles that were published in the two previous years (2016 and 2016). For the JIF, only journals and proceedings count (not books) and within journals only original articles and reviews (editorials, letters and meeting abstracts do not count).As one can easily see, there are several factors in this description that lend themselves to interpretation and manipulation by humans. First, any writing in a scientific journal needs to be classified (e.g. whether it is an article or a letter) and that classification is made by humans. Furthermore, the selection of what is included in the Web of Science core collection is not a fixed constant, but the list is updated dynamically by humans.Web of Science versus ScopusSo what about journals that are not in the WoS core collection? I have published e.g. an article in a German-language journal ( Lymphologie in Forschung und Praxis ). This Journal is not included in any WoS collection. Despite initial reservations, this review article has meanwhile gathered 8 citations, which is a remarkable success given that the median citation count of a scientific publication is four ( source ; see also this blog post ). How can I report the JIF when some grant application requires me to list it?Luckily, there is still competition to the Impact Factor, namely the Cite Score . That number was invented by the World’s largest scientific publisher Elsevier . Elsevier keeps also count of citations in the Scopus database. Scopus is less choosy when it comes to journal selection and most journals that are not listed in the WoS core collection are listed by Scopus.**ResearchGate Journal Impact?**So what do you do if your journal is not listed by either of the two big scientometric providers? There is still one other metric that you can use, namely ResearchGate . The RG Journal Impact is not well documented (at least I could not find much) but presumably uses a similar method. However, it is difficult to trust a metric if you do not know how it is calculated. I have published exactly one article that is not counted by WoS or Scopus. However, this is due to fact that the journal ( Frontiers in Biotechnology and Bioengineering ) is young. Its publisher has announced that it will receive an impact factor still this year and that the Impact Factor will be quite nice. For the time being, I am using the RG Journal Impact ( 3.02 ).Large discrepancies in the journal evaluationEven though the way the cite score is calculated is very similar to the JIF, the resulting numbers can be surprisingly different. At the bottom of this text is a comparison of the JIF, Cite Score and RG Journal Impact for three different journals from the year 2015, in which I have published. One notable difference is that the JIF takes into consideration the 2 previous years, whereas the Cite Score considers the previous 3 years. However, that does not explain the majority of the differences. The Cite Score is also less choosy when it comes to the content type: it counts - unlike the JIF - also editorials and letters (as a rule of thumb it counts everything).A weak correlationThe Impact factor is misused. It was developed to evaluate journals (for librarians to decide whether to subscribe to a journal or not) and has then subsequently been used to evaluate individual articles and even individual researchers. The correlation between the Impact Factor and the actual scientific impact (e.g. measured in terms of citations) has been steadily declining over the last decades (see e.g. this research: https://arxiv.org/abs/1205.4328) . From my personal experience, I can confirm that this is true as the correlation between the JIF and the actual number of citation among my own publications is around 0.32. This is pretty bad if your goal is to use the JIF as a proxy to predict scientific impact in terms of future citations.UPDATEThe 2018 Impact Factor for Frontiers in Biotechnology and Bioengineering is 5.122 ( https://www.frontiersin.org/journals/bioengineering-and-biotechnology# ). Congratulations!

The battle between the big publishers and the scientific community

Mon, 04 Mar 2019 00:00:00 +0000

I participated in last week’s Townhall discussion Mikä on avoimen tiedon hinta? (“What’s the price to access knowledge?”), which was precipitated by the recent discontinuation of Finnish universities’ access to journals published by the Tyler & Francis group. Mikael Laakso introduced the audience to the open access issue and the problems of rising prices, and Arja Tuuliniemi reported about the ongoing negotiations with Tyler & Francis and the Wiley group. While publishers like to portrait themselves as the researcher’s friend and ally, fact is that most of the scientific publishing industry is owned by big multinational stock market-listed corporations, which primarily answer to their share holders and researchers needs play a secondary role in the best case. While one would think that electronic publishing is driving down the prices of publishing and accessing published material, the reality shows exactly the opposite.In the current situation, where many Finnish universities are struggling with shrinking budgets, these millions of Euros could be spend better and the FinElib consortium is constantly trying to negotiate fair deals with publishing giants like Elsevier, Springer, Tyler & Francis, Wiley and SAGE . If the negotiations do not yield results before the old agreements expire, Finnish universities are sometimes cut of from access to some journals. This has happened now again (after a similar crisis in 2016). At the beginning of February this year journals published by the Taylor & Francis group have been inaccessible for Finnish researchers. Plans S (i.e. the initiative of the European Research Council to mandate open access for all state-funded research by 2020) is certainly strengthening the negotiation position of the FinElib consortium, because all European customers are essentially lining up their requests according to the Plan S requirements. However, it is still unclear how Plan S will affect smaller, not-for-profit publishers like scientific societies ( https://scholarlykitchen.sspnet.org/2018/12/06/why-society-and-not-for-profit-journals-are-worth-preserving-better-economic-and-continuing-value-for-the-community ). My personal opinion is that there is no reason to panic. A similar shutdown of Elsevier access happened at the beginning of this year (2019) at all Max-Planck-Institutes and and seems to be tolerated by scientists quite well. Even though I might not be able to instantly access all content, this situation should be rather viewed as an opportunity. You can still access all the content that you need (perhaps with extremely rare exceptions).

Changing swappiness on Linux and SDD

Tue, 19 Feb 2019 00:00:00 +0000

The swappiness parameter is available from/proc/sys/vm/swappiness

“0” means “swap only to disk when you absolutely have to”
“100” means “swap immediately to disk”

If you are running you OS from an SDD, you might not want the default of 60, especially not if you have decent amounts of RAM (16 or 32 GB). In order to preserve the lifetime of your SDD drive, executesudo sysctl vm.swappiness=10.However, the setting disappears after a reboot and in order to make it permanant, you need to add the following line to /etc/sysctl.conf:vm.swappiness=10

Mounting group directories via the fstab

Mon, 11 Feb 2019 00:00:00 +0000

At the University of Helsinki, one can apply for group directories, which is simply disk space on a NAS. These are easily mounted when you use a university-managed computer via the university menu, but what about if you use your own machine? At least for Ubuntu Linux, the way to mount these directories has changed multiple times during the years and it again broke recently. The current entry in the /etc/fstab file in my (Vanilla, non-university-managed) Ubuntu 16.04 is as follows:# HY group directories//group2.ad.helsinki.fi/h204 /home/local_username/GROUP-drive cifs noauto,user,user=hy_username,nobrl,uid=1000,gid=1000,file_mode=0666,dir_mode=0777 0 0Then you can simply execute “mount /home/local_username/GROUP-drive” and you will be asked for your HY password. The number 2 and the string “h204” in the server address (group2.ad.helsinki.fi/h204) are specific for the cost center which is in this case H2042 (taking the first digit from the cost center string and first four characters from the cost center string, respectively).And here are some instruction on how to do it manually on a Macintosh:https://helpdesk.it.helsinki.fi/en/instructions/saving-and-sharing/group-storage-space/remote-access-home-and-group-directory-mac

Sourdough whole wheat bread

Sat, 09 Feb 2019 00:00:00 +0000

Traditional Finish bread is made from rye and sourdough. This requires expertise, especially when you follow the “purist” approach and only use whole rye flour, water, salt, and sourdough. Most rye bread that is produced for commercial sale has not been baked by these purist rules. Different from rye, wheat is much less problematic when it comes to baking. However, the reputation of wheat has recently suffered due its high gluten content. This is mostly unjustified because a high gluten content of wheat was one of the major goals of hundreds of years of breeding. Not only is gluten a protein (and therefore important in a grain-heavy diet), but wheat gluten is especially gluey and thus maintains the structure of the bread.I have some 30 years experience with baking wholegrain wheat bread using yeast as raising agent. But last week, I did challenge myself with preparing a sourdough bread. Not yet rye, but wheat sourdough. I prepared the sourdough myself. I added some yeast and yogurt at the beginning hoping that they would keep the bad bacteria away until the good microorganisms have settled in. Although we own an electric grinding mill, I mostly have bought flour for my baking so far because I find the price for wheat grains unacceptable (>2.5€/kg). Luckily I have finally found a farm, that is directly selling wheat grain for a very competitive price and that is (almost) reachable by public transport from Helsinki: Krannin Tila . The result of my experiment was not bad. Even my biggest critics - my kids - did eat the bread (however only when it was oven-fresh). Its taste reminds me more of rye bread than of wheat bread. I guess it is more important how you bake the bread than whether rye or wheat is used.And here is the recipe:

Finland: Paradise for cross-country skiing

Sun, 03 Feb 2019 00:00:00 +0000

At the moment, Finland is a paradise for cross-country skiing. Lots of snow and thousands of kilometers of cross-country ski-tracks (in the capital region almost 1000 km, most of which are easy to reach by public transport). A 13 km circular track starts just in front of my apartment at the old city district (Vanhakaupunki), and the picture for this post has been taken from this track. My sister Claudia maintains an excellent blog about Helsinki ( https://claudiashelsinki.com ) which mainly targets tourists and her last blog post featured cross-country skiing in Finland (and specifically in Helsinki). Her blog is very informative for everybody who wants to visit Finland and specifically Helsinki. However, Claudia writes in German ( https://claudiashelsinki.com/2019/02/02/langlaufparadies-helsinki-und-finnland ), but of course, there is Google Translate, which makes the information available, albeit it sometimes hurts: https://translate.google.com/translate?sl=de&tl=en&u=https%3A%2F%2Fclaudiashelsinki.com%2F2019%2F02%2F02%2Flanglaufparadies-helsinki-und-finnland%2F

Increased resilience

Tue, 27 Nov 2018 00:00:00 +0000

I strongly believe that companies are genuinely interested in getting critical feedback. At the very least, it should be part of their corporate survival instinct. When dissatisfied customers simply switch to an alternative vendor without giving feedback, the damage is already done. That’s why I always give feedback if a product does not meet my high-quality expectations.However, this time I am writing about a product I have been very satisfied with, namely the new GE Healthcare Superdex 75 Increase 10/300 GL . It is a gel filtration column and an iteration of the previous Superdex 75 10/300 GL , which we have been using for the last 30 years. The biggest advantage of the “Increase” is the higher pressure-resistance. A few weeks back an overworked grad student forgot to close the column after use and returned it to the fridge, where the 20% ethanol slowly evaporated over the following 2 weeks. The fridge is ventilated and when I needed the column, the damage was already done: There was a perhaps 8 mm gap and a dry zone of approximately once inch had been developing. I immediately filled up the dead volumes with degassed 20% ethanol and started a very slow run (0.05 ml/min) for several hours, after which is switched to degassed water and then to buffer. After letting it run for about 2 days the gap was reduced to about 3 millimeters. The remaining gap was removed by adjusting with the top adapter (I needed to screw it down as much as possible).Now I needed to test the “repaired” column. I did both a functional test (separating two proteins in PBS) and the acetone test (injecting 100 µl 2% acetone in water). I was massively surprised when the aceton test showed about 19000 theoretical plates (which is more than we ever got with our old Superdex 75 columns). And the separation of the two proteins (RNaseA and BSA) showed that the column is still fully functional. However, we cannot tolerate any gel compression, since the ability of the adapter to correct for it is maxed out (GE Healthcare used to produce a longer adapter, which would allow us to compensate even further, but they chose to discontinue this product).Both the grad student and myself were relieved after getting these results because buying a new column would have set us back by 2200€ and since we have no dedicated funding to operate our core facility , I would have been forced to offload this expense to the grad student’s laboratory. Unfortunately, I did not take a picture of the damaged column as my instinctive reaction was to immediately start the rescue. However, the column in the picture below is the damaged column after the rescue operation was complete.

Thus we learn our lessons, not for life, but for the lecture-room

Tue, 27 Nov 2018 00:00:00 +0000

Non vitae sed scholae discimus (“Thus we learn our lessons, not for life, but for the lecture-room”). 2000 years ago Seneca wrote this to one of his students. My son is of the same opinion: Much of his curriculum content is irrelevant for real life. Unfortunately, I have to agree (and many experts do agree as well). Within a few years, the initial pride and joy of starting school are followed by boredom and disinterest. Just a few weeks into the autumn semester, the kids are merely waiting for the Christmas vacation. Learning should be fun and I wonder what is going wrong? How does the school manage to kill off the natural curiosity and motivation that quickly?In the beginning, I argued with my son, that it is not very important WHAT you learn, but that you learn how to learn, which should be possible with almost any topic. However, while perhaps true, this notion is at the same time a confession of failure by the ppeople, who make and implement the curricula at our schools. Why does it seem so difficult to choose topics that are interesting and relevant?100 years ago, reading, writing and basic arithmetics might have been enough. Knowledge is exploding these days, but the only answer of curriculum planners is the cram more into the plans without getting rid of teaching obsolete factual knowledge. That leaves little freedom for the teaching of methodological competencies which are deeply needed in today’s society.I get it, that schools have limited financial and personnel possibilities. However, there are teachers, who - against all material limits (in one of the richest countries in the world!) - manage to deliver a modern and enjoyable customer (sic!) experience.As an answer to the future needs of our society, some people try to push the STEM subjects (science, technology, engineering and mathematics). However, especially in these subjects, the knowledge and information growth is so fast that curricula (which are by definition rather inert) and also most teachers are not able to keep pace with. Even though the knowledge might be relevant, the more important lessons that should be taught are not of factual knowledge, but of methodological knowledge. And methodological knowledge can be taught with highly interesting and relevant topics:

How to change the MAC address of the Ubiquity Edge Router X

Wed, 14 Nov 2018 00:00:00 +0000

Bring up the command line tool (CLI) from the browser GUI. If you use any special characters in your password, you might need to change your password first via the GUI. Despite considerable effort, I did not manage to type special characters into the CLI using Firefox on a Mac (copy-paste does not work). Assuming that you want to change eth0:configureset interfaces ethernet eth0 mac 00:03:0D:51:B4:D2commitsave

Nicht für das Leben, sondern für die Schule lernen wir

Tue, 13 Nov 2018 00:00:00 +0000

Non vitae sed scholae discimus („Nicht für das Leben, sondern für die Schule lernen wir.“; “Thus we learn our lessons, not for life, but for the lecture-room.”) ist ein ungefähr 2000 Jahre altes Zitat Senecas aus einem Brief an einen seiner Schüler. Mein Sohn ist der gleichen Ansicht: das meiste, was er in der Schule lernen müsse, wäre nicht wichtig für das wirkliche Leben. Leider muss ich ihm (und viele andere Experten mit mir) da Recht geben. Dem Stolz und der Freunde, die den Anfang der Schullaufbahn der meisten Kinder begleiten, folgt oft innerhalb weniger Jahre die Ernüchterung. Schon wenige Wochen nach den grossen Ferien warten die Kinder nur noch auf die Herbst und dann auf die Weihnachtsferien, obwohl Lernen doch Spaß machen kann. Was läuft hier falsch? Wie schaffen es die Schulen so schnell, die natürliche Neugierde und Motivation der Kinder zu abzutöten?Ich habe anfangs zu argumentieren versucht, dass es nicht wichitg is WAS man lernt, sondern dass man das LERNEN lernt. Und das könne man ja an beliebigen Themen. Leider ist dieses Argument ein Armutszeugnis für diejenigen, die die Lehrpläne für unsere Schulen erstellen oder umsetzen. Warum lässt man dann die Schüler nicht LERNEN lernen an Themen, die interessant und relevant sind? Wo vor hundert Jahren Lesen, Schreiben und die Grundrechenarten genügten, wächst das Wissen heutzutage exponentiell. Und die einzige Antwort der Schulbürokraten ist, immer mehr neuen Stoff in die Lehrpläne zu packen, ohne Altes aus den Lehrplänen zu streichen. Dabei währen eher mehr Freiräume als früher notwendig, weil die Vermittlung vieler der heutzutage benötigten Kompetenzen Spielraum und flexible Strukturen benötigt. Mir ist klar, das die (personellen und finanziellen) Möglichkeiten der meisten Schulen begrenzt sind. Trotzdem gibt es viele Lehrer, die dem Mangel (in einem der reichsten Länder der Welt!) die Stirn bieten und mit mit viel Energie und Engagement modernen Unterricht gestalten.Viele sehen das Heil in einer verstärkten Rolle der MINT-Fächer (MINT = Mathematik, Informatik, Naturwissenschaft und Technik; auf Englisch STEM: science, technology, engineering and mathematics), aber gerade hier ist der Informationszuwachs so rasant, das Lehrpläne und vermutlich auch die meisten Lehrer nicht annährend mit der Realität mithalten könnten, auch wenn das zu vermittelnde Wissen unmittelbar relevant wäre. Deshalb sind heute Lehrer gefragt, die ihren Schüleren nicht nur Fakten beibringen, sondern Methoden. Solche Konzepte kann man gerade mit hochaktuellen und interessanten Themen vermitteln:

OpenVPN server on pfsense and client on Ubuntu 16.04

Fri, 02 Nov 2018 00:00:00 +0000

I have been setting up an OpenVPN server on my Netgate SG-3100 router . I hope this makes syncronizing backups to a physically separate location easier. There are many walkthroughs to set up an OpenVPN server on a pfsense router and that works nicely. However, I am using Ubuntu 16.04 at work and setting up the client requires a bit more than doing the same on MacOS or Windows. On Ubuntu, it is mandatory to update DNS information manually after establishing the VPN tunnel if you have opted for the setting to route all internet traffic originating from the client through the VPN server. If you do no update the DNA resolver information on the Ubuntu client, you can access the the VPN-internal network (in my case 10.0.0.0/24), but you cannot use hostnames. E.g. ping www.google.com will fail, but ping 172.217.21.164 will succeed. Similarly, your browser will not find any URLs. And browsing with IP-addresses (“http://172.217.21.164”) is not very practical.The default configuration on Ubuntu does not allow for this update of the DNS resolver to happen automatically for security reasons. There is a script included in the Ubuntu package of openvpn that updates this information (/etc/openvpn/update-resolv-conf). But in order for this to work one needs to

Internationalization in everyday operations at Meilahti campus

Mon, 22 Oct 2018 00:00:00 +0000

Meet the rectors at MeilahtiLast Thursday (18.10.2018), the new rector of Helsinki University Jari Niemelä and the four vice-rectors (Sari Lindblom, Paula Eerola, Hanna Snellman, Tom Böhling) visited the Meilahti campus for an open question and answer event. Hardly any foreigners were present during the event. Consequently, the language of communication was Finnish. Obviously, foreigners won’t participate if they do not understand and speak the language of the event. And since foreigner’s don’t participate, there is no reason to change the language of the event, and so the circle continues… Traditionally Finnish and Swedish onlyThe Meilahti campus holds a special position when it comes to language use since until very recently, it was impossible to receive a degree from Meilahti without knowing Finnish or Swedish since the only degree programs were not offered in English. However, the situation has been changing (e.g. with the move of the Psychology Department to Meilahti and the establishment of new degree programs like TRANSMED ), but old habits die hard. Trailblazers RPU and HiLIFEThe trailblazers for internationalization at the Meilahti campus are the Research Programs Unit and HiLIFE. The postgraduate students and postdocs of the Research Programs Unit (RPU) and the HiLIFE recruitments are the two most internationalized parts of the Meilahti campus and consequently, Hannu Sariola (previous vice dean for research at Meilahti) and Tomi Mäkelä (the HiLIFE director) brought up the topic of internationalization pointing out that the rules of the university allow for more language flexibility than is actually implemented. To date, the only official languages at the University of Helsinki are Finnish and Swedish, although more English-speaking than Swedish-speaking students are enrolled. English is also the de-facto language of almost all scientific endeavors. Balancing the domestic languages with English likely has no perfect solution. If the university wants to optimize its international impact and success, the role of Finnish and Swedish inevitable has to decline unless massively more resources become available.**Separate events?**In order to engage the foreign staff as well, the dean of the faculty recently organized the faculty staff meeting twice: once in English and once in Finnish. I am not sure whether such separation is a long-term good idea, but it addresses the issue pragmatically and gets the job done. If someone suggested separating the faculty X-mas party according to language, that would be considered discriminatory, but for a working meeting, nobody seems to object…**PS:**I am not the only one who is aware that internationalization has a long way to go. There is a nice article on the Helsinki University intranet portraying the new vice rector Hanna Snellman and her take on the issue: https://flamma.helsinki.fi/en/HY377022 . However, the university keeps most of its interesting web content behind locked doors (inside their Flamma service), inaccessible to the general public, who is paying the university’s bills… What does the university fear? More transparency?

SSD or spinning disk?

Wed, 12 Sep 2018 00:00:00 +0000

sudo apt install smartmontoolssudo smartctl -a /dev/sdaorcat /sys/block/sda/queue/rotational

Lehrpläne aus der Vergangenheit

Mon, 10 Sep 2018 00:00:00 +0000

Non vitae sed scholae discimus („Nicht für das Leben, sondern für die Schule lernen wir“) ist ein ungefähr 2000 Jahre altes Zitat Senecas aus einem Brief an einen seiner Schüler. Meine Kinder sind der gleichen Ansicht: das meiste, was er in der Schule lernen muss, wäre nicht wichtig für das wirkliche Leben. Leider muss ich ihm (und auch viele Experten mit mir) da Recht geben. Dem Stolz und der Freunde, die den Anfang der Schullaufbahn der meisten Kinder begleiten, folgt oft innerhalb weniger Jahre die Ernüchterung. Schon wenige Wochen nach den grossen Ferien warten die Kinder nur noch auf die Herbst- und dann die Weihnachtsferien, obwohl Lernen doch Spaß machen könnte. Was läuft hier falsch? Wie schafft es die Schule so schnell, die natürliche Neugierde und Motivation der Kinder zu töten?Ich habe früher zu argumentieren versucht, dass es nicht wichitg is WAS man lernt, sondern dass man das LERNEN lernt. Und das könne man ja an beliebigen Themen. Leider ist dieses Argument ein Armutszeugnis für diejenigen, die die Lehrpläne für unsere Schulen erstellen und umsetzen. Warum lässt man dann die Schüler nicht lernen lernen an Themen, die interessant und relevant sind? Wo vor hundert Jahren Lesen, Schreiben und Rechnen genügte (und mit Rechnen meine ich die Grundrechenarten), wachsen heutzutage Wissen (leider auch Desinformation) exponentiell. Und die einzige Antwort der Schulbürokraten ist, immer mehr neuen Stoff in die Lehrpläne zu packen, ohne Altes aus den Lehrplänen zu streichen.Viele sehen das Heil in einer verstärkten Rolle der MINT-Fächer (MINT = Mathematik, Informatik, Naturwissenschaft und Technik; auf Englisch STEM: science, technology, engineering and mathematics), aber gerade hier ist der Informationszuwachs so rasant, das Lehrpläne und vermutlich auch die meisten Lehrer nicht annährend mit der Realität mithalten könnten, auch wenn das zu vermittelnde Wissen unmittelbar relevant wäre. Deshalb sind heute Lehrer gefragt, die ihren Schüleren nicht nur Fakten sondern auch die Natur von Wissen und Realität nahezubringen imstande sind. Solche Konzepte kann man gerade mit hochaktuellen und interessanten Themen vermitteln, z.B. Klimaveränderung: warum wir wissen, was wir wissen; was ist der Unterschied zwischen “Fakten” und “Meinungen”, warum gibt es in der Wissenschaft keine “Wahrheit” gibt, warum es trozdem Theorien, gibt, die mit an Sicherheit grenzender Wahrscheinlichkeit richtig sind und was eigentlich “richtig” und “falsch” in der Wissenschaft bedeutet und warum Wissenschaft eben keine Anhäufung von Fakten ist, sondern eine Methode. Und zwar die besten Methode, die wir kennen, um uns der Realität zu nähern (damit oute ich mich als Gegner der postmodernen Beliebigkeit, die auch die Wissenschaft als kulturbestimmt und ohne irgendwelche spezielle Beziehung zur Realität oder zur Wahrheit betrachtet).Die aktuellen Lehrpläne (zumindest die der Schule meiner Kinder) bereiten auf das vor, was vorgestern wichtig war. Die heutigen Kinder brauchen anstatt Stoffwissen Methoden. Und die Methoden kann man anhand eines Stoffes lernen, der interessant für jedes individuelle Kind ist. Und dabei geht es auch nicht um die Stoffmenge, sondern eher um die Tiefe. Kreativiät, Engagement und Verantwortung sind andere Dinge, die heutige Schulen lehren sollten und die für das Überleben der Menschheit unabdingbar sind; mehr zu diesem Thema gibt es zuhauf im Internet, hier nur zwei Links zur Anregung: https://www.cicero.de/kultur/wir-brauchen-eine-bildungsrevolution/51963 und http://www.spiegel.de/plus/a-00000000-0002-0001-0000-000158147643/ .

SnapGene and partial restriction digests revisited

Thu, 23 Aug 2018 00:00:00 +0000

Snapgene is a software for the wet lab molecular biologist, who does lots of cloning work (construct design and annotation). Since I last wrote about the SnapGene software ( https://www.snapgene.com/ ), many good things have happened:

International Vascular Biology Meeting 2018 organizational feedback

Wed, 20 Jun 2018 00:00:00 +0000

As member of the local organizing committee for the IVBM 2018 , I was asking conference participants for direct feedback. I received lots of praise, which I do not want to iterate here. If we are ever going to organize a large international conference again, here are the things that we should do differently next time. Maybe this list can also help other first-time organizers of large, international conferences. If this list gives you the impression that the conference was badly organized, you would be mistaken! All the important stuff worked smoothly and some of the issues below were solved before any of the participants noticed. However, there is always room for improvement of the details! And - as always - some of the issues were out of our control as we had outsourced some of the work, most notably to Confedent International . And some decisions were a compromise between the optimal and what the conference budget could accommodate. I also encourage you to contact me if you want to add something to this list; it could make things better in the future!

Minireview about key molecules in lymphatic development, function, and identification

Fri, 08 Jun 2018 00:00:00 +0000

Erich Brenner asked us more than a year ago whether we could contribute to the special issue about human lymph vessels he was editing for Annals of Anatomy. We agreed that we might be able to contribute a minireview. In the beginning, I was also hesitating, because Annals of Anatomy is not per se an open access journal. However, our university has meanwhile started to cover the article processing charges (APCs) for several publishers (including the biggest scientific publisher on this planet - Elsevier ) to make articles open access . Thus, everybody can not only read the article already now, but also share, copy and redistribute it, remix, transform, and build upon it for any purpose, even for commercial purposes as long as we - the original authors - are credited.The target audience is not the lymphatic research community, but outsiders, who need a first, very brief introduction to the molecules that are most central to the molecular biology of the lymphatic system. The selection is clearly biased by our own research history. Please write us an angry e-mail if we did not include your pet protein! If you convince us that your pet protein is central to lymphatic development or function, we’ll include it in our next review!

IVBM 2018 & 2020 (poster, talk, and virtual poster walk through)

Wed, 06 Jun 2018 00:00:00 +0000

IVBM 2018The International Vascular Biology Conference 2018 in the Finlandia Hall in Helsinki has been a big success so far. We received lots of positive feedback for the organization from the participants. Also my talk (“Everything You Always Wanted to Know About the Proteolytic Processing of VEGF-C”) and my poster received good attention.Below the poster as a PDF download.IVBM 2020The IVBM 2020 in Seoul, South Korea, moved completely online. Unfortunately, some talks are only available for a very short time (one day), and I missed already a few of those. A physical conference has the advantage that it makes sure that you can pay full attention to the event. An online event has to compete with many other issues that are trying to grab your attention.

Jeltsch Lab participates in Helsinki Running Day 2018

Wed, 23 May 2018 00:00:00 +0000

Our lab participated in the Helsinki Running Day with great results! The “Biomedicum Runners” marathon relay team: Sawan Kumar Jha, Timo Lehti, Khushbu Rauniyar, Rustem Kasymov. Individual performances by Zalina Magomedova, Michael Jeltsch (both marathon) and Alish GM (5k). Missing from the picture is Alisha GM.

Cell-based assays (Protein Interaction Biochemistry 2018)

Mon, 14 May 2018 00:00:00 +0000

A lecture about cell-based assays to determine and quantify protein interactions (part of the 2018 course Protein Interaction Biochemistry). Contains also a short introduction to ITC (isothermal calorimetry). CC-licensed.

Scanning my home network (nmap)

Sun, 18 Mar 2018 00:00:00 +0000

Scanning my home network for all devices that are listeningon port 80 (http):nmap -p80 192.168.0.0/24 -oG - | grep 80/openSometimes this doesn’t work (because nmap tries to be smart and only scan hosts that are available). In order to make nmap scanning without intelligence, use the e-Pn (no ping) option. This scans all ports of host 192.168.0.2:nmap -Pn -p0-65535 192.168.0.2

Literature list for Poster #XX:

Thu, 01 Mar 2018 00:00:00 +0000

@page { }table { border-collapse:collapse; border-spacing:0; empty-cells:show }td, th { vertical-align:top; font-size:12pt;}h1, h2, h3, h4, h5, h6 { clear:both }ol, ul { margin:0; padding:0;}li { list-style: none; margin:0; padding:0;}li span. { clear: both; line-height:0; width:0; height:0; margin:0; padding:0; }span.footnodeNumber { padding-right:1em; }span.annotation_style_by_filter { font-size:95%; font-family:Arial; background-color:#fff000; margin:0; border:0; padding:0; }* { margin:0;}.P1 { font-size:12pt; font-family:Liberation Serif; writing-mode:page; }.P2 { font-size:12pt; margin-bottom:4.23mm; margin-left:0mm; margin-right:0mm; margin-top:0mm; text-indent:0mm; font-family:Liberation Serif; writing-mode:page; }.P3 { font-size:12pt; margin-bottom:4.23mm; margin-left:0mm; margin-right:0mm; margin-top:0mm; text-indent:0mm; font-family:Liberation Serif; writing-mode:page; text-align:center ! important; }.P4 { font-size:20pt; margin-bottom:4.23mm; margin-left:0mm; margin-right:0mm; margin-top:0mm; text-indent:0mm; font-family:Liberation Serif; writing-mode:page; text-align:center ! important; font-weight:bold; }.P5 { font-size:11pt; margin-bottom:4.23mm; margin-left:0mm; margin-right:0mm; margin-top:0mm; text-indent:0mm; font-family:Liberation Serif; writing-mode:page; text-align:center ! important; }.Internet_20_link { color:#000080; text-decoration:underline; }.T10 { vertical-align:super; font-size:58%;}.T6 { font-style:italic; }.T7 { font-style:italic; }.T8 { font-weight:bold; }.T1 .T2 .T3 .T4 .T5 { }Novel activating proteases uncover new roles for VEGF-C

Strike at the University of Helsinki

Tue, 27 Feb 2018 00:00:00 +0000

A strike warning has been issued for tomorrow (28.2.) for the University of Helsinki. The reason is that the negotiations about between the employers and employees about the wages and working conditions are stuck and the strike is used as a means to speed up the movement of the employer’s negotiation position towards an acceptable compromise. Business as usual? After all, there hasn’t been a strike at the university for a very long time…While almost everybody agrees that Finland’s future is built on knowledge and innovation, the appreciation of the very people that are generating knowledge and innovation seems to have hit an all-time low if appreciation is reflected by working conditions and payment levels.I guess the underlying cause is not so much the concrete offerings of the employer (or the lack thereof), but the disregard and disrespect for academic education, research, and development that has been growing over the years, accelerated by the 2015-elect government, which refuses to invest into the future. Universities should not behave like companies trying to maximize their profit on the cost of their employees and the quality of their product. With some exceptions , everybody with a little bit of self-respect is participating. All major unions, including the students’ and professors’ union, are supporting this action. Apparently, professors will go on strike for the first time in the history of this country ( https://yle.fi/uutiset/osasto/news/finnish_professors_walk_out_in_first-ever_strike/10095355 ).

Running on the Baltic Sea

Mon, 26 Feb 2018 00:00:00 +0000

For a change, I did my running training last weekend on the Baltic Sea. After two weeks of Siberian cold here in Helsinki, I reckoned that the ice cover on the Baltic Sea was thick enough to be safe for running. That’s one of the few attractions of the Helsinki winter. If you want to get to know more about Helsinki and Finland, have a look at my sister’s blog. Unfortunately, the blog is in German, but maybe I can convince her to make it bilingual: https://claudiashelsinki.wordpress.com/

VEGF-C Review in Frontiers in Bioengineering and Biotechnology

Mon, 12 Feb 2018 00:00:00 +0000

The editors of Frontiers in Bioengineering and Biotechnology, section Tissue Engineering and Regenerative Medicine (Andrea Banfi, Wolfgang Holnthoner, Mikaël M. Martino and Seppo Ylä-Herttuala) asked us to contribute to the research topic Vascularization for Regenerative Medicine. We wrote a small review about VEGF-C, which specifically addresses the molecular biology of VEGF-C in relationship to regenerative medicine, i.e., (re)growing lymphatic vessels in vitro or in vivo.You can get it from the publisher directly https://www.frontiersin.org/articles/10.3389/fbioe.2018.00007/full or from here . **UPDATE (April 1, 2023):**The question of whether Frontiers Media is a predatory publisher did not even cross our minds when we were asked to contribute with a review. I know the guest editors of this Research Topic and can vouch for their scientific integrity. However, the journal has recently ended up on the list of predatory journals ( https://predatoryreports.org/news/f/list-of-all-frontiers-media-predatory-journals ), and the issues are discussed here in detail. Our review has meanwhile gathered:

Computer time: Windows against the rest of the world

Sat, 10 Feb 2018 00:00:00 +0000

I am not sure, but Windows seems to be the only operating system, that wants the computer clock to be set to the local time zone instead of universal standard time (UTC). Maybe that is a relic of the times when Microsoft thought that the internet was not very important for the future of computing. All other operating systems apparently use UTC: MacOS, Android, Linux, BSD, … However, if you are dual-booting your computer, you can get into trouble. Not all operating systems detect automatically a dual boot install and adjust their behaviour in order to be compatible with Windows. If this is the case, the easiest is to change the behaviour of Windows. A clear write-up how to do so is available from https://liliputing.com/2016/03/fix-time-problem-dual-boot-computers-windows-linux-android.html , but here are the steps in a nutshell:

The mixed bag of the EU organic food label

Tue, 30 Jan 2018 00:00:00 +0000

Many people assume that organic production of food results in healthier food with a higher nutritional value. Hence they buy food produced according to EU rules of “organic farming”. The first set of rules was introduced in 1991 and it was amended a couple of times. If you want to market your food as “organic” within the EU and use the EU organic food logo , you need to adhere to these rules.Often the same people that usually are very critical towards EU legislation take it for granted that the EU did a good job with its organic farming directive. Unfortunately, that is not the case. The main purpose of the legislation was to unify and to enable EU-wide trade of organically grown food and not to make sure that the food was more healthy or of higher quality than non-organic food.The directive also emphasizes the avoidance of “non-organic” chemicals, but for most foods this is only a minor factor contributing to how “healthy” the food is. I shake my head over organic refined flour on the supermarket shelves. If you want to use healthy flour, you should use whole meal flour. Refined flour has much less fibers and therefore is simply not a good choice if your goal is healthy eating. It is practically irrelevant whether the wheat has been grown organically or not if you strip out the fibers. Organic refined flour is only topped by by organic sugar, where everything healthy has been stripped away and its source - organic or not - is 100% irrelevant.The organic label is actually a hodge-podge of very different practices that aim to reach very different goals. Among these are animal welfare, sustainable farming and the avoidance of some practices that are perceived as “non-organic” (e.g. GMO, “non-natural” pesticides*). But if the health value of the final product was one of it aims, than it has utterly failed.I am all in favor of treating animals well, but if I am forced to buy organic milk, I support many practices that I do not want to support. For example the rage against GMO or non-natural pesticides and fertilizers. I have no problems with cows eating GMO plants. It is clear that GMO is one of the key technologies that we need to rescue this planet (the alternative is to reduce the amount of people on this planet). And without pesticides and fertilizers, we cannot feed the planet without cutting down the last remaining rain-forests and converting them into farm land (see e.g. https://ourworldindata.org/yields-and-land-use-in-agriculture) . By buying organic food you support a political compromise and not scientifically sound rules how best to produce high quality food or to save the planet. Did you expect anything else from an EU directive? The EU was founded as “European Economic Community” and economic interests were the primary forces at work. Since I drink probably a liter of milk any given day in form of caffè latte, I should be perhaps interested in using high quality milk. Comparisons of e.g. the fatty acid profiles of organic and conventional milk have been done. Clearly, for the quality of the milk (e.g. levels of polyunsaturated fatty acids, ratio of omega-6:omega-3 fatty acids), the most important factor was not, whether it confirmed to the EU rules for organic food, but rather whether the cows were eating their greens! https://www.google.fi/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0ahUKEwj1qOuJtIDZAhVJwYMKHfH9D2QQFggrMAA&url=http%3A%2F%2Forgprints.org%2F28133%2F1%2FForschung_2011-1.pdf&usg=AOvVaw31A0-ma28xQ0oXlBpxAF6U . Conventional low-input* cow farming was superior to organic high-input** farming and the differences between conventional low-input** farming and organic low-input farming were likely not significant, although I cannot be sure about this, because the significance levels compared only organic low input farming to conventional high-input farming (I requested the original publication, but did not receive any reply yet). Whether these differences translate into measurable health effects for milk consumers is still another question and probably depends on the level of milk consumption.Interestingly, the organic vs. non-organic problem has been well recognized (see e.g. here in the German daily newspaper “Die Zeit” https://www.welt.de/wirtschaft/article147993831/So-wird-Bio-zur-schoenen-Illusion.html) . The need for differentiation has led the Finnish diary producer Juustoportti to market its milk not under the organic EU label, but under the “free-ranging cow” label ( vapaan lehmän maito ). If you want healthy milk and care about animals, but don’t want to support the anti-scientific organic lobby, this could probably be your choice. Sadly, Juustoportti also rides on the anti-GMO bandwagon. Organic (Finnish: “luomu”) milk might also come from free-ranging cows (and even conventional milk occasionally does), but the certification doesn’t necessarily require it.*Sadly, the primary principle in the distinction between allowed and non-allowed pesticides in organic farming is whether they are of “natural” origin. Safety and efficacy are only secondary. It should be obvious to any educated person that being natural does not equate being safe to eat: Botulinum toxin, the death cap mushroom and and the mineral cinnabar do all occur naturally, but they belong to the most poisonous substances known to man. **Low input farming meaning that the cows were kept outside eating grass, while high input farming means cows being mostly inside. Both types of cow farming are compatible with “organic” and “conventional” farming according to the EU directive, which shows already that something is perhaps wrong with the EU directive.

Syncthing

Wed, 24 Jan 2018 00:00:00 +0000

Syncthing is one of the best tools for keeping folders synchronized across the internet. However, for one or the other reason, it occasionally stops to work on my Ubuntu 16.04 and because I use it in a “set it and forget it” fashion, I also forget how to check that it is operational.Make it start automatically at boot time (as a system service): systemctl enable syncthing@username.serviceStart the service: systemctl start syncthing@username.serviceCheck the status: systemctl status syncthing@username.serviceThe URL of the GUI: https://127.0.0.1:8384 However, the above solution does not work well if e.g. the files to syncronize reside on an encrypted folder which is mounted only after the user has logged in (e.g. in Ubuntu 16.04, there was the possibility to encrypt the user folder, which was only unlocked during user login). Alternatively, one can run the service as a “user service” like this:cp /usr/lib/systemd/user/syncthing.service ~/.config/systemd/user/systemctl --user enable syncthing.servicesystemctl --user start syncthing.serviceSyncthing seems to regularly loose a file called “.stfolder”, which is supposed to be in the root of any shared folder (or it gets converted into a folder). For me the problem gets usually fixed by simply recreating that (empty) file (and deleting the folder with the same name if it exists).

Remote desktop sessions to your Helsinki University work computer

Mon, 15 Jan 2018 00:00:00 +0000

If you have a work laptop, you can take it home to do work. But what if you have a desktop computer and need to access it from home? The technology to make this possible exists for more than 20 years, but if you think that University IT has made this easy for you, you would be wrong. In fact, I don’t know anybody who knows how to do this (let alone how to make the process easy). Even with the setup explained below, some things do not work well (e.g. I never could figure out how to get the file sharing to work with a Mac-to-Mac connection and thus I still use Fugu with a separate tunnelled sftp connection to transfer files). You have several options:

Brain drain from Finland continues

Fri, 22 Dec 2017 00:00:00 +0000

Finland is educating its citizens to a very high level, but is not able to keep this highly educated work force in the country. The net balance of university degree holder migration has been negative throughout the last decade and the trend is worsening, especially at the Bachelor’s and Master’s level. At the highest level, the interpretation is not very straightforward, since this group contains Licentiate* holders, PhDs, postdocs as well as professors. However, the negative trend is also stable, but not accelerating as fast as at the lower education levels. In this group the brain drain occurs selectively to the best countries with just 5 top countries absorbing 66% of the most highly educated migrants (USA, Great Britain, Switzerland, Germany and Sweden), while the lower degree holders are not as selective (52% of MSc and 41% of BSc holders migrate to the same top countries). Unfortunately, this statistic only reports the migration of Finnish citizens. In order to get a complete picture, one would need the same data for the migration of non-Finnish citizens. For this graph, the data from Statistics Finland was used ( http://www.stat.fi/til/muutl/2016/02/muutl_2016_02_2017-12-18_tie_001_fi.html) . All countries were grouped according to better or worse scientific output than Finland in the comparison (Nature Index, Weighted fractionalcount, https://www.natureindex.com/country-outputs/generate/All/global/All/weighted_score) . Countries that performed better thanFinland in 2016 were: USA, China, Germany, United Kingdom, Japan, France, Canada, Switzerland, South Korea, Spain, India, Italy,Australia, Netherlands, Israel, Sweden, Singapore, Russia, Taiwan, Belgium, Austria, Denmark, Brazil, Poland.* Licentiate is a degree specific to Finland and a several other countries, which is somewhere between a MSc and a PhD. In Finland, it has been decreasing in importance over the years since there is no equivalent in many other countries.

Practical Course: Purification and Characterization of Recombinant Proteins (DPBM-135)

Sun, 10 Dec 2017 00:00:00 +0000

Teaching material, results, etc. for the DPBM course “Purification and Characterization of Recombinant Proteins” ( https://courses.helsinki.fi/en/DPBM-135/120171139 ):

The magic sequence to wake up Apple's SuperDrive on Linux

Sat, 09 Dec 2017 00:00:00 +0000

sudo apt-get install sg3-utils (only needed the first time)ls /dev (to check whether sr0 or sr1, usually it’s sr0 unless you had already other USB drives connected)sg_raw /dev/sr0 EA 00 00 00 00 00 01

20th International Vascular Biology Meeting in Helsinki, Finland

Mon, 27 Nov 2017 00:00:00 +0000

The 20th International Vascular Biology Meeting 2018 (IVBM2018) will take place in Helsinki, Finland on June 3-7. Registration has opened ( https://b3p.it.helsinki.fi/IVBM/ ) and I hope to see you in Helsinki in June! I have been living here in Helsinki for about 20 years, hence feel free to ask me anything! If I cannot answer, I at least know who knows the answer.

Acatiimi article about our lab

Mon, 27 Nov 2017 00:00:00 +0000

However - unlike in the previous story - this time there is a group image, showing who does the real work!

TRANSMED - the most medical research education for your buck

Sat, 25 Nov 2017 00:00:00 +0000

Starting from this autumn term, even Finnish universities, so far the strongholds of free education, have started to demand study fees from students from outside the European Union (EU) and European Economic Area (EEA). Between 13k€ and 18k€ per year, the tuition fees are still modest compared to some other universities. At the moment, compared with other universities, you probably get the best returns for your money at the University of Helsinki .The TRANSMED Master’s Program is perhaps the best example. Given the real costs of a research-oriented medical MSc education in a world class environment, the 15k€ tuition fee per year is a bargain compared to similar programs at other universities. And even better: the chances to be accepted are surprisingly good. Some have proposed to increases the fees, but no concrete plans exist at the moment.So what is keeping foreign students from flocking to Finland? The cold winters cannot be blamed anymore. Thanks to global warming, most of the recent Christmases have been snow-free here in Helsinki. In fact, global warming seems to hit Finland harder than most other countries. Need more reasons to come? Have a look here: http://www.visitfinland.com/article/greatest-things-about-finland/

Lymphologica 2017

Wed, 01 Nov 2017 00:00:00 +0000

On the Lymphologica 2017 (Lymphologie 2017) congress in Bad Soden (Oct. 5-7, Frankfurt, Germany), I presented an introduction to the molecular biology of VEGF-C and how mutations in the genes of the VEGF-C/VEGFR-3 signaling axis can cause or contribute to hereditary lymphedema. The talk was targeted at healthcare practitioners who work in the lymphology field. A mini-review based on this talk was published in Vasomed and was available online , but has meanwhile disappeared. You can download the presentation slides and the English translation of the mini-review via the download link below.

Featured again…

Thu, 26 Oct 2017 00:00:00 +0000

Recently, our research seems to get lots of public interest: https://50tieteentekijaa.fi/tieteentekija/michael-jeltsch/ . And there is more to come… It would be nice if our government would show a similar interest in science and education. And it would be even better if they had a reasonable plan how to secure the future of science and research in Finland. The government spending for some research areas (in other words the investment into Finland’s future) has been shrinking so dramatically, that even the tabloids have picked up the topic: http://www.iltalehti.fi/kotimaa/201710122200451078_u0.shtml

Our key project featured

Wed, 25 Oct 2017 00:00:00 +0000

Our key project was featured in Tietyssti.fi . Katri Pajusola wrote the story and (at least from what I understand from the Finnish text) it seems to be a quite accurate description of what we try to do: http://www.aka.fi/fi/tietysti/luonto-ja-ymparisto/nyt-pinnalla1/tautien-hoitoon-laakitysta-ei-ainoastaan-diagnostiikkaa/

The most effective ways to reduce your carbon footprint

Thu, 12 Oct 2017 00:00:00 +0000

According to this study from the University of Lund, the most effective ways to tackle climate change are largely not being discussed. Not surprisingly, they touch such the things dearest to our hearts: our car, our holidays, our children and our favorite foods.

Nazis in the German Parliament

Sun, 24 Sep 2017 00:00:00 +0000

Sad day for Germany: Nazis are sitting again in the German parliament. They don’t called themselves Nazis. Instead, they use the name AfD (Alternative für Deutschland = Alternative for Germany). And many people argue (in my opinion correctly) that Angela Merkel did nothing to prevent that from happening.Both big parties - conservatives and social democrates - massively lost support amoung the voters. Virtually all small parties could eithe keep or increase their representation in the German parliament, the Bundestag. Merkel needs at least two of them to stay in power and the numbers allow a coaliton of the Conservatives, Greens and Liberals (called Jamaica coalition after the colors of those three parties: colors black, green and yellow). The once revolutionary Greens will perpetuate the status quo in Germany… Many people seemingly voted against their own interest, but the social democrats could not convince enough people that they are the only viable alternative to Angela Merkel’s political agenda.

Toni Nett's rules

Sat, 16 Sep 2017 00:00:00 +0000

More than 50 years ago Toni Nett published his book Der Lauf. In the book, he presented thumb rules to calculate possible personal running records for common distances for middle and long distances. The possible personal bests are calculated based on known performances on the next shorter distance. Manfred Steffny extended Toni Nett’s rules to cover the marathon and the 100 km. He found these rules surprisingly accurate when comparing personal bests of hundreds of runners of different levels from beginner to world champion. I have been writing about these thumb rules previously here . Now I made a small php script that does the calculation for you.

The Heart Beats on the Left

Fri, 15 Sep 2017 00:00:00 +0000

The heart points to the left and most people’s heart is about one-third right, two-thirds left. I just joined the Finnish Social Democrats ( SDP ). I had seriously contemplated joining the German Socialdemocratic party (SPD) in 1994, but I happened to leave Germany because of a DAAD scholarship I received. Shortly after I had moved to Finland, Germany managed to get rid of its conservative government. Gerhard Schröder replaced Helmut Kohl as federal chancellor and started moving things which Kohl had been afraid to touch for 16 years. I think a country, in which the son of a cleaning lady and a single mother can work up his way to become head of the government, is principally ok.A major reason for joining the SDP was also my dissatisfaction with the present Finnish coalition government, that stubbornly keeps refusing to invest into Finland’s future: into the education of our kids. The cutbacks in the budgets from kindergartens to universities show an unprecedented ideologic egoism for a short-term balanced budget, which is unprecedented among all Scandinavian countries.The good thing about the SDP (and the German SPD) is that there is more room for different opinions than in most other parties.

Deleting files with "illegal characters"

Fri, 08 Sep 2017 00:00:00 +0000

In the cross-platform environment of our university, at least three different OS connect to the smb shared group directories. Apparently Macs are able to save files with characters that are not allowed on other platforms and which cannot be easily deleted. Recently we had several files which ended with a ‘.’ (dot) or a ’ ’ (space), and we were not able to remove them via the GUI. In Windows 7, I managed via the command line with:delete "file." ordelete "file "I have, however, not found a way to so from my Ubuntu machine and it is annoying to boot into Windows merely to delete some files. Unfortunately, this became necessary because the Cloudberry backup system (which is running on Ubuntu) chokes on such files. I am looking into a new backup system for our lab’s computers since CrashPlan decided to discontinue support for non-business customers…

Windows changes my computers clock

Mon, 28 Aug 2017 00:00:00 +0000

If I am not mistaken, Windows is the only OS, that uses local time for the system clock (instead of UTC). This means that in multiple boot configurations, every restart of the system into Windows will screw up the system time. In order to reset it (in Ubuntu 16.04), usesudo timedatectl set-timezone Etc/UTC

Amber from Stutthof

Tue, 01 Aug 2017 00:00:00 +0000

While running at the Baltic beach close to Kąty Rybackie (Poland), I picked up some amber. Some of it didn’t pass the floating test (in 20% w/v NaCl in water at room temperature), but I have not clue what the non-floating stones actually are (they are too soft for glass, maybe plastic?).I did not know when I arrived here for a one-week beach holiday, that the small village we were staying in belonged to the municipality of Stutthof , where one of the Nazi concentration camps was located. Actually, I twice made a detour from my daily morning runs at the beach to have a look at the camp, which is nowadays a museum. Interestingly, children below the age of 12 are not allowed to visit the site. This is different from those memorial sites of concentration camps in Germany that I know: the decision whether to take children for a visit is left to the parents.Another notable memory from these holidays were the road trips, which made me reconsider my firmly held opinion, that most car drivers in here in Finland are driving irresponsibly and mostly too fast. As a matter of fact, it was almost impossible to drive within speed limits in Poland as nobody seems to do so. I realized that traveling in a speed-limit-abiding car would be more dangerous than traveling in a recklessly speeding one as it would be subject to constant overtaking maneuvers on narrow country roads. Hence, I was also speeding. Not surprisingly, Poland features the highest traffic mortality rates in Europe ( https://www.economist.com/blogs/easternapproaches/2013/06/polish-driving ). The Polish government’s claimed intention is to reduce the numbers, but instead of lowering the speed limits, they increased them in 2011. According to Wikipedia the maximally allowed speed on highways changed from 130 to 140 km/h and on dual carriageways from 110 to 120 km/h. A rough estimate (based on these numbers ) shows that approximately as many people have died on Polish roads in the last 20 years as were killed by the Nazis in Stutthof in the years 1939-1945. Maybe the Polish police should start enforcing the limits?

Accessing shared folders in VirtualBox (Linux guest)

Fri, 28 Jul 2017 00:00:00 +0000

Transferring files from the host to the guest OS and vice-versa doesn’t work out-of-the-box when you install VirtualBox from the Ubuntu repositories and download an Ubuntu VirtualBox image (e.g. from http://www.osboxes.org/virtualbox-images) . After installing the guest additions, drag-and-drop didn’t seem to work for me and I needed to set up a “Shared Folder”. After setting it up via the GUI, it doesn’t automatically appear on the guest desktop. You need to mount it:sudo mount -t vboxsf name(as_specified_via_VirtualBox_GUI) ~/mount_point_in_the_guest_OS/There are obviously many other ways how to achieve this (e.g. via Samba or sftp or sshfs)…

Predatory publishing - where to draw the line?

Wed, 21 Jun 2017 00:00:00 +0000

Zinni It seems that many researchers recently received an invitation to join the editorial board of the new open access journal ContROL (“Continuous Research Online Library”). The sheer number of invitation might be already a bad sign as the choice of the editorial board is a delicate one and mass emailing is arguably not a good method to assemble a high-quality editorial board. I get frequently similar requests, and when the e-mail message doesn’t clearly identify such a request as spam, I used to have a look at Beall’s list to see whether the publisher or journal has associated “red flags”. Some red flags are easy to identify. If you are an expert in the field but have never heard of the scientists who are supposed to do the expert work. One also could look at the publication record of the people to evaluate their previous work. However, nobody has the time to do that and that’s where Beall’s list came in handy.However, Beall’s list has disappeared this January from the internet. It was last updated on January 3rd 2017, but soon after that, all content was taken down. The January 3rd version is - thanks to great work of the guys at the Internet Archive - still available from here , but obviously it is not updated anymore. Nobody knows exactly why Beall took down all the content, but rumors have it, that Beall himself got threatend by parties which have a vested interest in predatory publishers remaining unnamed (read more e.g. here: http://retractionwatch.com/2017/01/17/bealls-list-potential-predatory-publishers-go-dark/).There are lot of “new” publishers out there who want to participate in the lucrative business of scientific publishing. It doesn’t really matter whether they use the open access model or not (when they are open access, they can e.g. earn on hefty “article processing charges”). Getting enough sufficiently qualified reviewers for the peer-reviewing process is hard work for the established journals and thus the peer-reviewing process of many new journals is more often than not less than rigorous.I also do not like it if it’s unclear who is behind a new open access journal. I feel an ethical dissonance if someone advocates open access, but all information about the journals background remains closed. In my opinion, there is at the moment not much need for more (open access) journals. Instead, most serious and reputable open access advocates are rather trying to improve the existing ones. One could conclude, that the relative amount of predatory journals among all newly established journals is steadily increasing and Google Trends support this notion. How can I figure out whether the ContROL journal is legit or not? I have checked out a few of the people from the Advisory Board and they appear to be real scientists with real track records of various quality. However, even reputable scientists occasionally end up on the editorial board of such journals (sometimes with and sometimes without any action on their part). That said, there is no clean demarcation line between predatory and honest publishers. Even some of the “reputable” publishers engage occasionally in some shady and controversial practices. That’s why Beall’s site lists “potential, possible, or probable predatory scholarly open-access journals”.Beall’s list has been criticized, but much of the criticism can easily be dismissed. An especially low-level attack on Beall’s integrity is e.g. the site http://scholarlyoa.net (note the similarity of the URL!), where some unnamed person(s) engage in ad-hominem attacks, logical fallacies and exaggeration in order to discredit Beall’s work. I myself doubt that the people behind this site are true friends of Open Access publishing. Throwing dirt does not do a favor to Open Access publishing. Maybe this site could even be a misguided, under-cover action by proponents of conventional publishing to discredit Open Access. There is valid criticism of Beall’s work , but none of it challenges the concept that somebody needs to monitor Open Access publishing (in the same way people are monitoring and criticizing the big commercial publishers). Maybe I should ask the publisher of ContROL a few questions. Mainly, why they still see the need for a new OA journal. ContROL promises in addition to the journal some kind of associated scientific social media and promotion platform. However, also that territory is already covered (by ResearchGate and Mendeley ). I was perplexed by the hefty “membership fee” that you need to pay in order to use their services ( https://control.zinianz.com/membership ). But unless you publish several articles per year, it seems to me overpriced. Even though they mention that they have waivers from the Article Processing Charges, I could not find any details. Why would they hide this information? Researchers from financially challenged countries need to know the costs upfront! Such lack of transparency is exactly the opposite what open access needs to achieve. The “membership fees” might also prevent the associated services from succeeding. Getting traction with a scientific social media site is difficult (even if your services are free and backed by the most powerful publisher in the world). Likely, the promised benefits won’t become reality.

Uncertainty about CRISPR's future

Sun, 18 Jun 2017 00:00:00 +0000

Some feared, that the patent decisions on the CRISPR technology this spring might lead to a monopolization of the technology . However, according to a last month’s article in Nature Methods, it is not at all clear at this moment, whether CRISPR will hit a home run for the editing of the human genome. If a single editing event is accompanied by hundreds of unwanted and unpredictable genomic changes, it would be difficult to argue in favor of it due to the unpredictability of the side effects. This is just a single study in mice , but caution is warranted. The Nature Methods article is especially interesting, since the technology just had been used in humans for the first time .Even if the intellectual property is held by a single company, it is unclear, how a patent could be enforced. CRISPR differs from many other technologies by having a very low entry barrier in terms of cost and know-how. Almost every life science researcher could do it at home in their garages…

About the agility of large organizations

Thu, 15 Jun 2017 00:00:00 +0000

A decade for the switchI don’t remember exactly, but the idea to deploy a decent content management system for the entire web presence of the University of Helsinki is probably 10 years old. I had reserved the domain jeltsch.org in May 2003 (after I had completed my PhD) to host my private web site. The oldest snapshot of my web site on the internet archive dates back to December of the same year. Like the Helsinki University IT staff, I realized that updating a web site by updating individual html pages is very time-consuming. In 2006, I was - exactly like the University of Helsinki IT services - looking for a content management system (CMS). At the university, they used Dreamweaver to generate the html pages; I used whatever text editor I had available. After comparing different options, both Helsinki University IT and myself came to the same conclusion to chose Drupal as the content management system for our web sites.Moving to DrupalMoving to Drupal (version 4.6) took me a few weeks, but in the end of 2006, my first Drupal site went online. Starting from that time, adding content to my web site became very easy. I avoided upgrading Drupal and skipped version 6. As I had anticipated, the upgrade to version 7 caused me a major headache (upgrading is supposedly much easier nowadays). Moving to drupal took the University of Helsinki many years, but finally in 2016/2017, the move was/is happening. Barack Obama was much faster: in the autumn of 2009, hardly half a year after he had become president, the switch of whitehouse.gov from a proprietary solution to Drupal was complete.*Is Drupal 7 old?*Here at our university, dead lines must have been moved multiple times and similar to the Western Metro Extension to Espoo , the move likely became much more expensive than planned. The university is using at the moment Drupal version 7, which was relased more than 6 years ago in January 2011. While Drupal 8 is already out since November 2015, the good new is that Drupal 7 remains officially the Long Term Support (LTS) version and thus will receive security updates for many years to come (I would guess for at least five years or so). About 85% of all Drupal sites are still running Drupal 7 and apparently, this number has not shown any signs of decline yet .The move is not complete yetI moved my lab’s web pages in the beginning of this year when the possibility was made available. However, our B3P core facility still runs on “handwritten” html code as we have not gotten permission to move these sites to Drupal (IT is waiting for the HiLIFE research infrastructure funding decisions).Meanwhile, 2.3% of all web sites worldwide use Drupal.*Problems?*However, the system is not free of bugs. Owing to security concerns (PHP security is considered to be porous like a sponge), most of the flexibility that Drupal offers is not available to the content providers: e.g. full HTML or PHP code within node bodies is disabled, which makes the implementation of dynamic content challenging. Luckily, the system has an achilles heel and that is its use of RSS feeds.RSS fees to the rescueRSS feeds with user-provided URLs can be integrated into most pages and surprisingly they allow unfiltered display of html content (including images and css styles). This is the way how I implemented our dynamically updated list of enzymes ( https://www.helsinki.fi/en/researchgroups/lymphangiogenesis-research-and-antibody-development/services-and-resources ) and our list of publications (which displays separate feeds from zotero.org , e.g. a list of featured publications or a list of review articles . Unfortuantely, the feed module doesn’t accept standard atom feeds, but only “old-fashioned” RSS feeeds, which required me to pipe the Atom feed from Zotero through a python script before it can be fetched by the site visitor’s browser.Varnish CacheThe other problem is that the site loads fairly slow. If visitors look for content the site must load with 3 seconds or the visitor is lost. Hopefully the site will scale well since many research groups have not made the switch yet. And it loads slowly despite it using a Varnish Cache . Unfortuantely, the Varnish Cache delays updates from becoming public sometimes for many hours (sometimes even over night). In the 21st century, that is not acceptable. I have set the maximal cache life time to 1 hours for my private Drupal site. The 3 second loading time is likely the best compromise they could find…

Barriers to Electronic Lab Notebook adoption

Thu, 08 Jun 2017 00:00:00 +0000

Our lab has been interested in electronic lanb notebooks (ELNs) for a while. A recent publication in the Journal of Cheminformatics has focused on the barriers to ELN adoption. Especially in the academic world, more than 90% of scientists are still using the traditional paper lab notebook. Biggest barrier to adoption was the cost in terms of money and learning of new habits. Close runner-ups on places 3 and 4 were the implementation effort and security concerns. While the authors are clearly biased (they are developing the open source ELN ELN SciNote ), the barriers to adoption are the same that I experience in my lab and at the University of Helsinki.I was stunned when about 2 months ago I received an e-mail with the news that the University of Helsinki had negotiated a framework agreement with the LabVantage LIMS/ELN vendor Software Point. While I think a university-wide ELN solution is necessary, this deal seems anything but optimal for most research-oriented laboratories at the University of Helsinki. Several labs at the university are using ELNs already for a while and none of them have been aware of the efforts to provide a university-wide agreement for a LIMS/ELN solution. And none of those that already use a LIMS/ELN have been choosing LabVantage, but other solutions ( Labguru , SciNote , eLabFTW ). It would have been helpful to have somebody in the evaluation team, who has actual experience with LIMS/ELNs use (or somebody who has participated in LIMS/ELN development), especially since such expertise exists at the University of Helsinki.Only a few people have been involved in the negotiations while the majority of the stakeholders were not even asked for their input. When I asked explicitly about this secluded operation, the answer was: Very few units (mainly the chronology unit and a person from dept of chemistry) were involved with the purchase at the time even though the information was spread around the university and anyone was welcome to participate and state their needs. However, even though I try to actively follow the IT infrastructure developments, I did not see any announcements anywhere and also searching retrospectively, I could not find anything that would have alerted me and allowed me to participate. The labs contributing most to the international success of Helsinki University are the main stakeholders, but they were ignored. Maybe a little bit more active search for the stakeholdres would have been appropriate.The base package that was negotiated with LabVantage seems to be geared towards routine and clinical lab work, but not towards innovative research. Among the two modules that are mostly necessary for life science research work are the ELN and the storage management. Unfortunately, many life-science specific routines (searching for DNA and protein sequences with blast-like search algorithms) are totally absent from the offer, but are very much needed for life science. The lack of a free API (like eLAbFTW features or SciNote soon will feature) prevents users from incorporating their own, existing code or their own database systems. Every small change would require to involve the LabVantage developers and that will be a very slow and costly process. In reality, this means that shortcomings of the system will never be addressed. The base package can be taken into use by any lab at the university after a single payment of 200€ for each user (no floating licenses, only dedicated users). For our lab that would amount to 2000€, but a low price tag is not a selling point in itself.Within the framework agreement, any lab can pay for the additional modules on its own, but the heft price tag of 17500€ make it unlikely that anybody will do so. I am unwilling to lobby for a joint purchase, because there is no way of knowing, whether these modules would be suitable for everyday lab work. Unlike most other vendors, LabVantage doesn’t offer a free trial of the system. It makes me suspicious, if a vendor doesn’t offer a trial. If the product is good, a trial will convince potential customers to buy. If the product is good, what could be the downside of a trial for the vendor? We have ourselves tested several ELN solutions over the last two years and some systems received very bad feedback by those people who use them every day (e.g. cumbersome data import, unintuitive interface, slow server responses). As a matter of fact, for oligonucleotide management and protein/enzyme storage, we still use the absolutely outdated open source LIMS that I co-authored about 15 years ago as a PhD student ( http://phplabdb.sourceforge.net , now at https://github.com/mbekaert/phplabdb) . In my lab, we use eLabFTW . We have a local installation on the Helsinki University intranet (which can be accessed via VPN from everywhere) and anybody from Helsinki University can get an account there. If you are interested in trying it out, please contact me!The key question remains unanswered: Why were the majority of stakeholders not pulled into the decision-making process?

Gemstone hunting in Finnish Carelia

Wed, 31 May 2017 00:00:00 +0000

Last Sunday, we participated in the spring excursion of the Finnish Gemstone Hobbyists’ Society ( Suomen Jalokiviharrastajain Yhdistys ) to a spectrolite quarry near Ylämaa in Finnish Carelia. Spectrolite is a variety of labradorite , which shows a rich iridescense. The Finnish spectrolite is peculiar because of its dark base color. Strictly speaking, the term “spectrolite” applies to the Finnish variety of iridescent labratorite only. The trip was a success as we returned tired and with many kilograms of specimens.

Essentials facts about VEGF-C in lymphology

Fri, 05 May 2017 00:00:00 +0000

Essentials facts about VEGF-C in lymphology

Dr. Michael Jeltsch, Adjunct Professor, University of Helsinki & Wihuri Research Institute, Finland, michael@jeltsch.org

Vascular endothelial growth factor C (VEGF-C) is essential for the development and growth of the lymphatic vasculature. Together with VEGF-D, it forms the lymphatic subgroup within the VEGF family of growth factors, whose other members (PlGF, VEGF/VEGF-A, VEGF-B) are primarily responsible for the growth and function of blood vessels. VEGF-C was discovered as a ligand of the tyrosine kinase receptor VEGFR-3 (1) and its specific effect on lymph vessels was first described in 1997 (2,3). About one-third of hereditary lymphedema cases in humans result from mutations in genes involved in VEGF-C signaling (4). The complete absence of VEGF-C leads to death during embryogenesis (5). Likely for this reason, clinical cases of hereditary lymphedema are characterised by a partial inactivation of the signal transduction. VEGFR-3 (6) is affected in most cases, but mutations of the hereditary lymphedema are described or suspected for all components of the VEGF-C signal transduction described below, partly within a multifactorial inheritance.

Forever Young

Sun, 30 Apr 2017 00:00:00 +0000

I was asked by the Novo Nordisk Foundation (specifically by Dr. John Peter Wittschieben) to say a few words from the successful applicants’ perspective during the “ How to Get Funding from International Foundations ” info event, which took place on April 26th in Biomedicum Helsinki.Useful informationTo be clear: The event was very useful. Specifically it was useful due to the detailed information provided by the Novo Nordisk Foundation and JDRF , who presented during the event. In the very beginning, I was surprised to hear our Dean talk in his introduction about the “lucky ones that received the funding”. In my naïveté, I always assumed that funding was distributed according to excellence and ability, not according to luck. While more experienced researchers like Mikael Knipp were able to give good advice, I could not. Obviously, I cannot boast with my own funding rates (which are about 5%, one of 20 applications being successful).**No time for science, too much time for grant proposal writing?**Some participants expressed surprise about the current widespread complaints of researchers about low funding rates, arguing that a rejected application leads to an improved renewed application in the next round. I agree, that the improvement might be substantial for the first few rounds, but then it becomes a game of diminishing returns. I write an average of 20 grant applications in order to get one accepted, and for 15 of these, I rather agree with E.P. Diamandis, who in Clinical Chemistry complained about the $20+ billion loss due to unsuccessful application writing.**Who is a “Young Investigator?”*The other question that - interestingly - was discussed (and which I had wondered about already for years), was the term of “young investigator”. The bottom line was, that everybody is a young investigator who does not hold a full professorship. This might be the only sensible definition, as the average age of principal investigators has been steadily rising during the last decades (see e.g. here ). Many investigators will therefore stay forever young (or at least until they retire).It is difficult to be creative if you are struggling with fundingAlthough I could not convince many (maybe nobody), I objected to the notion that is is desirable to combine the goal of creativity and applicability in academic research. True creativity originates mostly from a primary motivation and utilitarian aspects actually get in the way of creativity. This is not to say, that creative research cannot be very useful. To make them an important criteria in the distribution of funds is just asking too much from the money source, namely to be able to predict the future. Creativity and the push towards “applicability/impact” of research are not only orthogonal to each other, but are pushing into opposite directions. If the research is struggling with funding, it is difficult to be creative. The basic needs for survival need to be met before people can realize their possibilities. In addition, when foundation ask for short term applicability, they appear to me like politicians, who think in terms of the 4 or 5-year election cycle. For much of academic research, we cannot predict its future uses. In addition, potential applications are mostly MUCH more than 5 years into the future. If the push towards applicability results in shifting the balance from basic towards applied science, the pipeline (basic research > applied research > engineering) will dry out from its source. Maybe this push towards applicability will also accelerate the blurring of the lines between the traditional universities and the universities of applied sciences. *I have to side with Marx this time: Nicht das Bewußtsein bestimmt das Leben, sondern das Leben bestimmt das Bewußtsein.

A Very Short History of Antiangiogenic Tumor Treatment

Mon, 24 Apr 2017 00:00:00 +0000

I covered the antiangiogenic tumor treatment topic in the Cancerbio Summer School (CBSS) 2017. As a review I recommended the following: Weis SM, Cheresh DA. Tumor angiogenesis: molecular pathways and therapeutic targets. 2011. Nature Medicine 17:1359-70. http://www.nature.com/nm/journal/v17/n11/pdf/nm.2537.pdf

Finland still safest country for travellers

Tue, 18 Apr 2017 00:00:00 +0000

In the 2017 Travel & Tourism Competitiveness Index , Finnland scored in the global comparison rank 33 (11 places lower than two years ago ). However, Finland managed to keep its top position in the safety and security category. When looking at the raw numbers, the reason for the drop in competitiveness is not so much a worsening of the Finnish performance, but the improved performance of other countries, including Sweden and many non-European countries like Mexico, Malaysia or the United Arabic Emirates. Spain, France and Germany placed 1st, 2nd and 3rd, respectively, in both the 2015 and 2017 comparisons.

Overrun by the Big Wheel?

Fri, 24 Mar 2017 00:00:00 +0000

Despite focus on internationalization English information about education reform incomplete and lateThe Big Wheel reform is rolling over me and I don’t notice it. There has been some information in English about the process on the University’s intranet . However, during the drafting, most of the documents were initially only available in Finnish and due to the delay caused by translation, foreign staff without English language proficiency was largely excluded from the process. Loosing this input was certainly not helpful, since several goals of the Big Wheel reform are related to internationalization, e.g. harmonizing the degree structures within Europe (“3+2+3 system”) and making the degree programmes internationally attractive and competitive.Excellent students potentially excluded from studying at our UniversityConcluding from the application numbers for the Master’s programmes that’ll start in September 2017, there is still much work to be done to make the programmes “internationally attractive and competitive”. Virtually all programmes reported a decline in applications from Non-EU/EEA countries, which probably will result in much less income from tuition fees than the university would like (Master’s thesis tuition fees at the University of Helsinki are between 13000 and 18000€/year depending on the programme). We probably loose potentially excellent students and there is a diffuse suspicion that the general level of education might suffer. 30 scholarships of varying amounts are available for Non-EU/EEA students. However, only about 10 of the recipients will be able to completely recoup the tuition fee with their scholarship (see here: https://www.helsinki.fi/en/studying/how-to-apply/scholarship-programme) . I also think that the advertisement for the study programmes could be definitely improved.Information about available scholarships: clear enough or confusing? I also fear that many potential applicants were confused about the scholarship programme (so was I, and still am). Our own Master’s programme’s web pages ( https://www.helsinki.fi/en/programmes/master/translational-medicine-transmed ) do not mention the scholarships prominently (or was that on purpose?). Even worse, the link on the Helsinki University’s pages to check whether or not a student is required to pay the tuition fee has been half dead for a while (“You can check this FAQ at the Studyinfo website whether or not you are required to pay tuition fees” (original on this page ). Hopefully it died only after the application deadline finished…Educational reform of the PhD degreeThe Big Wheel reform concerns all three degrees: Bachelor’s, Master’s and Doctorate (PhD). Internationalization is especially relevant to the PhD degree and those Master’s programmes that are entirely in English (e.g. Translational Medicine or Life Science Informatics). Even though about half all PhD students in my unit (Research Programs Unit) are foreigners, hardly any of them knows what the “Big Wheel” is about. Big Wheel discussion at Meilahti campusAfter almost all is set and done, an info event about the Big Wheel was announced for the Meilahti campus (31.3.2017). The e-mail message was exclusively in Finnish. I often have given feedback when important events were not announced in English (more often than not getting no response). That’s why I wrote a message straight to the rector and the vice rector of the university. The e-mail conversation is attached below. Suffice to say that the university is still dedicated to increase internationalization despite this not being without problems…What was discussed at the hearingThe part of the discussion that happened in English was circling around the PhD education. A very valid request was not to fix something that is not broken. In the international comparison, PhD education is for the most part excellent in Finland and the only perceived problem is its length.At the moment a Finnish PhD thesis in life science requires the graduate student to publish in scientific journals. As a consequence, most of the research in Finland is done by PhD students. The exact number and quality of publications required differs between faculties as there is no formal consensus. Typical are 3-5 papers, sharing of authorship is accepted to a certain degree. Not all publications need to be first-author contributions.Finish PhD graduates are competitiveWhile a PhD from a Finnish University is internationally very competitive, PhD graduates are typically much older than those from most other countries. This begs the question: so what? The typical length of PhD studies in Finland has been generally assumed to be around 7 years. However, nobody knows exactly (not even the university itself, since tight rules to register PhD studies have not existed until recently), but there seems to be a very slow movement towards a shorter duration (and less requirements). Strong forces act against shortening of PhD studiesThe fact that the PhD studies last so long in Finland is the result of natural selection. Pushing with regulation for faster PhD education will have many unintended consequences. There are strong forces acting against shortening the PhD studies, especially for highly talented students that aim at an academic career: E.g. the relative ease to get scholarship funding during the PhD studies and the high unemployment among fresh PhDs in Finland.Age limits for PhD degrees for fundingPointed out by Kalle Saksela, a major obstacle to shorting the PhD education is the general funding situation of academic research. With every funding cycle, funding rates are pushing new all time lows. Successful applicants have a very compelling portfolio of high quality publications, which needs time to acquire. However, major competitive research funding (Academy of Finland, ERC) puts limits on applicants (e.g. “no more than 7 years after PhD completion”), which have no relationship to the quality of the application.Four yearsThe very clear message from vice rector Hämäläinen (Jukka Kola had already left the discussion, when it switched from Finnish to English) was that the PhD studies must be shortened in order to reach comparability with other countries. The target is 3+2+4 (3 years for the Bachelor’s studies, 2 more years for the Master’s studies, and then 4 years for the PhD studies). The idea put forward by the vice rector was to simply move some of the studies that are done at the moment under the PhD umbrella into the early postdoctoral period. A big question is obviously who is going to pay for this move? There needs to be a substantial increase in research funding to be able to pay salaries for postdocs unless we want to lower the overall domestic research output. Already now it borders to financial suicide to employ a postdoc with an Academy Research Fellow budget.

Purification and Characterization of Recombinant Proteins

Mon, 20 Mar 2017 00:00:00 +0000

We are organizing (again) a practical hands-on protein purification course from December 4th to 20th. We maximally can accommodate 16 participants, which will form groups of 2 to 4 participants. Each group needs 3 full days to go thru the practical exercises, but day 3 of the course will be overlapping with day 1 of the next group. Venue is Biomedicum Helsinki, rooms A516a1 (where the machinery is) and B318a/b (our lab). We will purify a protein (VEGF receptor 3) using a two-step protocol (affinity chromatography + gel filtration) on the the Äkta Avant FPLC device. On the third course day we’ll assay its interaction with its ligand (VEGF-C) on the ITC (isothermal calorimetry) device. We have given a similar course in 2015 ( http://www.helisci.fi/hbgs/FPLC2015/) . This new course ( https://courses.helsinki.fi/en/DPBM-135/120171139 ) will have a similar structure, but we expand it by one day to analyze protein interactions making use of the new isothermal calorimetry device of our B3P core facility. The documentation and results will be also available from here . Since we can run maximally two samples at a time (we have “only” two FPLC machines), we will have to split the participants into groups (of 2-4 students/group) and repeat the 3-day course several times depending on the number of participants.

Angiogenesis landmark publications

Thu, 09 Mar 2017 00:00:00 +0000

According to Nature, our Science paper from 1997 is a landmark paper for the angiogenesis field: *“A paper establishing the role of VEGF-C and VEGF-R3 signaling in lymphangiogenesis. A new field is born."*The collection of landmark papers for the angiogenesis field from the last 80 years ( http://www.nature.com/focus/angiogenesis/classics/vegf.html ) was published first in 2003 and unfortunately has not been updated to include later seminal studies. However, until today, most of these 86 papers are still must-reads for every PhD student in the angogenesis field.

"Silver" and "gold" coating a 5 cent coin

Tue, 07 Mar 2017 00:00:00 +0000

Last Friday, I coated with my kids 5 cent (copper) coins. They look pretty nice even though its only zinc and brass. All you need is a clean copper coin (you can clean old coins efficiently with vinegar), sodium hydroxide (NaOH), zinc powder and a hot plate. The original method (see this PDF ) uses a bunsen burner, but we did the heating and the final conversion of the zinc-plated coin into a brass-plated coin simply by placing it on our kitchen’s hot plate. Hot sodium hydroxide is pretty dangerous, so be warned (eye protection) and keep the kids under control!

Fertig

Sat, 04 Mar 2017 00:00:00 +0000

Nach einem Jahr von mühsamenm Teilesammelns und Bauens haben Tobias und ich heute das Lego Millennium Falcon Ultimate Collector’s Edition (Lego Set 10179, http://brickset.com/sets/10179-1/Ultimate-Collector-s-Millennium-Falcon ) fertig gebaut. Diese Version des Millennium Falcons wird nicht mehr verkauft und gebrauchte Sets werden für wahnsinnige Preise von um die €5.000 bei Ebay verkauft.Wir haben die notwendigen Legosteinie von zwei anderen Lego Star Wars Modellen genommen: aus dem Death Star (Lego Set 10188, http://brickset.com/sets/10188-1/Death-Star ) und dem Super Star Destroyer (Lego Set 10221-1, http://brickset.com/sets/10221-1/Super-Star-Destroyer).Allerdings mussten wir eine beträchtliche Menge an fehlenden Teilen dazukaufen. Viele von denen haben wir über die finnische Online-Auktions-Website Huuto ( http://huuto.net ) oder über BrickLink ( http://www.bricklink.com ), eine Art “spezialisiertes Ebay” für LEGO-Steine gekauft. Die am schwierigsten zu findenden Stücke waren die beiden hellen bläulich-grauen “Boat Mast Rigging Long 28 x 4” ( http://www.bricklink.com/search.asp?itemID=56261&colorID=86) , die im Moment für nicht weniger als €100 pro Stück verkauft werden. Wir haben diese Stücke natürlich nicht gekauft. Allerdings verkauft LEGO immer noch die schwarze Version dieses Stücks als Ersatzteil und Tobis Patenonkel hat sich die Mühe gemacht, diese zu besorgen und sie grau zu streichen. Danke Clemens!

Handbrake and protected DVDs

Thu, 02 Mar 2017 00:00:00 +0000

Ripping DVDs is a thing of the past, but occasionally I still need to do it. However, it happens so rarely that evertime I have either a new computer or a new Linux distribution and I need to install the necessary software. This time I am on Ubuntu 16.04. I usually use Handbrake and it is very comfortable, but handbrake sometimes fails to do the job. This time, I had to resort to MakeMKV . However MakeMKV only rips the video to an MKV container but it does not compress it. If you need the space reduction you should still push the file through a compressor. Here’s the whole chain of commands:I only have an Apple USB-Superdrive. Apple doesn’t want me to use it with any other computer but Macs. Therefore, in order to make it work under Linux, you needs to sens it a “Magic cookie” (see here: ):sg_raw /dev/sr0 EA 00 00 00 00 00 01If you have Handbrake installed from the default Ubuntu repository, you need to remove it (it’s crippled and you want to be able to use it also with encrypted DVDs):(sudo apt remove handbrake && sudo apt autoremove)Install this version:sudo add-apt-repository ppa:stebbins/handbrake-releasessudo apt updatesudo apt install handbrake-gtk handbrake-cliInstall software to read encrypted DVDs:sudo apt-get install libdvd-pkgHowever, you have to execute some manual commands after the install is ready, but the installer instructs you during installation.Select as source the TS_Audio folder on the DVD. If the scan never finishes or you do not see any tracks after the scan finishes, you might need something like MakeMKV. I didn’t find any PPA or deb file, so I compiled it from source, which succeeded without any problems following the isntructions from here: http://www.makemkv.com/forum2/viewtopic.php?f=3&t=224 . Here the short version:wget http://www.makemkv.com/download/makemkv-bin-1.10.4.tar.gzwget http://www.makemkv.com/download/makemkv-oss-1.10.4.tar.gztar -xvzf makemkv-bin-1.10.4.tar.gztar -xvzf makemkv-oss-1.10.4.tar.gz cd makemkv-oss-1.10.4/./configuremakesudo make installcd ../makemkv-bin-1.10.4/makesudo make installThe executable is /usr/bin/makemkv

No interest (in retrospection and introspection)?

Fri, 17 Feb 2017 00:00:00 +0000

There was much talk about last years “changes” at the university. Surprisingly, nobody seems to be interested anymore in the topic. At least this is the impression that I first got, when I went to the public hearing event at the Meilahti campus. The lecture hall 1 of Haartman Institute, where the hearing was supposed to take place, was completely empty when I arrived. Because only a handful of people had bothered to show up, the hearing had been moved to a table in the nearby Cafeteria. Hardly noticed by anyone, a review group has started its work to analyze the “changes” at the University of Helsinki, which took place during the last one and a half years. I guess the idea was to figure out what preventable mistakes have been done. According to this university source , Jukka Kola, who is the public face for many of the controversial decisions during this period, got to decide himself about the members of the review group. Because of this, the review group will have to be very careful not to appear biased in their report.

Science good, coffee bad

Thu, 26 Jan 2017 00:00:00 +0000

Last week I took part the Vascular Cell Biology Gordon Research Conference in Ventura (California). My two previous Gordon Conferences (2001 Rhode Island, 2014 Lucca/Italy) were outstanding and also this one did not disappoint.Even though there were many European researchers (19%), the US made up for 69% of the participants (Asia 6%, rest of the Amerikas 5%). This is probably a good representation of where the cutting edge research in vascular biology happens. Makes me wonder why the coffee in the US is as bad as it is (my bias got confirmed again). It cannot be explained by the lack of scientific expertise.Gordon conferences are designed to promote the exchange of unpublished data and hence I am not writing anything about the science. One exception: There are clinical trials to treat lymphedema with leukotriene B4 inhibitors ), but this is already public knowledge and the mouse studies are mostly published ( http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0008380) . So no secrets leaked here… I myself presented a poster about the continued CCBE1 story that is currently under review and some preliminary data about additional VEGF-C activating enzymes.Obviously, the outcome of the presidential elections was a popular topic during lunch and dinner conversations especially as it relates to science funding and science policy. Opinions ranged from “We have no clue what to expect” to “Be afraid. Be very afraid.” I personally enjoyed about 8 hours of Trump presidency since my return flight from Los Angeles to Munich left last Friday at a quarter past five in the afternoon.In the free afternoons, I tried to catch the America-exclusive Taurus Pokémon for my daughter Milena. Sadly, the conference location was almost entirely devoid of poke stops and therfore I was chronically short of poke balls. Insiders told me that Santa Monica beach is the place to go to in order to catch Pokémons. I actually planned to go there Friday morning, but it was raining cats and dogs and so I tried my luck at the airport and about an hour before departure I finally managed to catch a Taurus and another one just before boarding the plane. So all in all a very successful conference journey!

ScanSnap iX100 support for Linux

Fri, 23 Dec 2016 00:00:00 +0000

Under Ubuntu 16.04, the ScanSnap iX100 is not supported yet by the sane package. In order to get it working, you need to install the ppa from Rolf Bensch:sudo add-apt-repository ppa:rolfbensch/sane-gitsudo updatesudo upgrade

Kapa HiFi excels, Phusion works sort-of, Q5 and Platinum SuperFi disappoint

Fri, 02 Dec 2016 00:00:00 +0000

My last NEBuilder assembly got stuck because I couldn’t get two of the PCR reactions to work. I needed one small fragment and two ~3-kb-fragments. I needed to insert a 2A-sequence in between the small and one of the 3-kb-fragments and thus added the necessary sequences as tails to the primers. The template was not especially GC-rich, nothing too complicated, but only the small fragment did amplify in my first attempt. When also my second attempt failed to amplify the 3-kb-fragments, I decided to try out some alternative polymerases. For cloning purposes, I have been using exclusively Phusion High Fidelity DNA polymerase (from New England Biolabs or from ThermoFisher ) for the last years, but maybe there was something better and more robust? I received three different free samples for testing: KAPA HiFi HotStart , NEB Q5® High-Fidelity and ThermoFisher Platinum SuperFi™ . My graduate student did the PCRs yesterday and I ran the gels today. From the gel quality, you can see that I don’t have much routine anymore, but the overall results are quite clear and in the future, our go-to polymerase for tricky templates will be KAPA. I think KAPA’s proofreading capabilities are a bit below Phusion, but I do not care if 2% instead of 0.5% of the DNA products contain a mutation.In the attached PDF file, you can see, that my grad student included two more samples for the Phusion polymerase, where she used the same conditions, but a different template (supercoiled plasmid instead of linear DNA). Surprisingly, the Phusion polymerase did a much better job to amplify from supercoild DNA than from (the same) linear DNA; I cannot explain that…

1000 times too slow

Thu, 01 Dec 2016 00:00:00 +0000

Helsinki University has outsourced parts of its IT infrastructure to Microsoft. Even if outsourcing is cheaper in the short term than generating equivalent services locally, the net effect is likely negative due to the lost jobs, know how and independence. It doesn’t need a conspiracy to explain this self-destructive behavior, just bad decision criteria, which do not include long term and externalized costs.In its push to upgrade to newer Windows versions, Microsoft ended extended support for Windows XP on April 8, 2014 and the university obeyed by denying network access to XP machines. The argument was that XP was becoming a security risk. At the same time, Windows XP accounted still for about 20% of all Windows installations on this planet ( https://www.statista.com/statistics/218089/global-market-share-of-windows-7/ ). Even in October 2015, well above 100 Million computers did still run Windows XP ( https://en.wikipedia.org/wiki/Usage_share_of_operating_systems and https://www.statista.com/statistics/218089/global-market-share-of-windows-7/ ) without any catastrophic consequences.The ban of Windows XP was a problem, since four of our devices, that we need for research, are still running Windows XP. And there is no way to upgrade the OS without upgrading the equipment (which would cost thousands or tens of thousands of Euros and therefore is mostly impossible in the present tight financial situation of the university). And of course, the software that is needed to operate the devices is not compatible with Windows 7. As a consequence, we can neither remotely operate this machinery nor do automated backups. Even taking the data for analysis to another computer requires the Adidas network .I had contacted IT support well before the extended support of Windows XP ended and asked them to find a solution. Apparently there were different possible solutions and IT support did start to implement them, but because of personnel fluctuations, the project had to be “restarted” several times and different support professionals had different opinions on how to solve this problem. With the big “fire and hire” action at the university, the whole project disintegrated again. This autumn I again discussed our needs with the IT staff, but did not receive any concrete help so far.This Tuesday, I finally wanted to know how difficult it really is to connect a Windows XP machine to the network in a way that would not compromise security, but enable file distribution, backup and remote control. I went to the Institute’s garbage place where broken electronic equipment is gathered and took three old 10/100 NICs and a few ethernet cables. One card and one cable were still functioning and I dropped the NIC into a Ubuntu 16.04 computer and connected it via ethernet cable to one of the XP machines.After manually assigning an IP to the NIC and installing samba onto the Ubuntu machine, I was able to mount the samba share as a drive on the Windows XP machine. Then I just made the samba share available via a web page. All this took about one hour. Not being an IT professional, I spend maybe an additional three hours researching how to do it (samba setup, apache setup, configuration of a secondary NIC, which is not automatic on Ubuntu). This setup fulfills all of our requirements, didn’t cost anything and was implemented within one day.A write-up of the technical details will follow once I get around documenting what I did. Agility is perhaps what is mostly missing when I look at many of our university’s IT projects. Notably I think of switching to Drupal as content management system for the university’s web pages. Sadly, our faculty is still using Dreamweaver to create its web presence and as a consequence many web pages are never updated.

Automated reinstall of software from package list

Sun, 20 Nov 2016 00:00:00 +0000

If I need to reinstall a Ubuntu/Debian-based Linux OS (or mirror a software selection to another machine), this is how it can be done. On the source machine:sudpkg --get-selections > ~/Package.listcp -R /etc/apt/sources.list* ~/apt-key exportall > ~/repository.keysThen just copy the files to the target machine:suapt-key add ~/repository.keyscp -R ~/sources.list* /etc/apt/apt-get updateapt-get install dselectdselect updatedpkg --set-selections < ~/Package.listapt-get dselect-upgrade -yIf some packages are not available, this will fail. This concerns in my case manually installed packages like teamviewer or snapgene / snapgene_viewer . I usually remove those packages manually from the list (there are luckily not many of them).However, the upgrade is not fully automatic, since you need to e.g. agree to various licenses (e.g. for Microsoft’s True Type fonts) and acknowledge manually other stuff (e.g. libdvd-pkg legal issues), which kind of defeats the purpose of making this automatic and painless…

Temperature Sensors

Tue, 15 Nov 2016 00:00:00 +0000

https://my.wirelesstag.net/eth/signin.html

Let's encrypt duplicated my log files

Wed, 19 Oct 2016 00:00:00 +0000

I have not been keeping log files for my web server until the beginning of 2016, when I needed to trace access to certain files (I started to use awstats , mostly because I was familiar with it since I had used it years ago when my site was still running on a Red Hat server). In March 2016 I luckily started to use Let’s Encrypt . I had used another “free” service before, which got recently into big trouble as they apparently had not control over their own security. When I looked at my Apache server’s log files (on Ubuntu 14.04), I noticed that apache did double logging (to both the individual vhost’s log file and a common log file). I realized that Let’s Encrypt specifies into every vhost’s configuration file an Import directive which sources /etc/letsencrypt/options-ssl-apache.conf. And this file in turn specifies common access.log and error.log files for all vhosts in the /var/log/apache2/ directory. I uncommented the five lines associated with this logging and the duplicate logging stopped (originally, I had thought, that this letsencrypt directive was only used for the initial Let’s Encrypt setup for the cert generation).

Key project funding

Fri, 07 Oct 2016 00:00:00 +0000

This post is inspired by our recent success in the Key Project Funding call of the Academy of Finland . One of the main time killers for scientists is to apply for money to finance their research. Scientists spend more and more time preparing grant applications because of the growing competition for the shrinking resources.After deducting the time for teaching and administration, they maybe able to spend a few hours each week doing research. Last week over lunch, a friend of mine ask me what our funding rates were. I did not know, because I have been avoiding the inconvenient truth. I calculated today and the depressing result is that they are in the low single digit range and this seems to be a quite average figure (for us, 2015 was an exceptionally successful year and the 2016 number might perhaps still improve since several decisions have not been made yet).Improving academical productivity by increasing the 1600 hours of yearly working time on paper is meaningless if 400 hours of this time are spent in vain, i.e. for unsuccessful grant applications. The financial damage and opportunity costs to the system are enormous and a colleague of my recently pointed me to this 2015 article in Clinical Chemistry , where the monetary value wasted by grant application writing was conservatively estimated for the US to be at least $20 billion per year.Our budget includes new positions for researchers, but we don’t know yet where and when these people will be able to start their work. In theory, the hosting organization (i.e. the Research Program of the University of Helsinki) guarantees the infrastructure. However, the Research Program cannot generate lab space from nothing. The university is just trying to save money by minimizing the floor space it rents. While some people celebrate successful grant applications, my view is more down-to earth: After the grant decision is before the grant decision*.*Citation modified after Sepp Herberger , coach of 1954 soccer world cup winner Germany, who famously stated “After the game is before the game.”

OpenBIS for Dummies

Tue, 06 Sep 2016 00:00:00 +0000

If you have considered moving from paper to electronic lab notebooks as we are at the moment, you might have come across the OpenBIS solution. You want to install OpenBIS, but have not clue how to go about it? I didn’t have much of a clue either and therefore tried repeatedly until I succeeded. Luckily, I got some help from the ETHZ OpenBIS and our local computing support team, but obviously they cannot compensate for the lack of insight into Jetty and postgresql…If you just quickly want to try it, it might be easier to download the VirtualBox image, where everything is preinstalled and preconfigured ( https://wiki-bsse.ethz.ch/display/bis/openBIS+ELN-LIMS+Virtual+Machine ). However, I didn’t have any fast hardware to run the VirtualBox image and concluded that it would be fast enough on bare metal using an old computer.The notes below are written from memory and from the final configuration files that worked. However, I will still setup the server from scratch executing only what I have been writing down below in order to make sure I have not missed anything important. However, in the meantime I want to get this information out. I would have been happy if I had found some “OpenBIS installation for Dummies” instructions. In order to have a very long support, I chose for the installation Ubuntu 16.04 Server (the VirtualBox image uses Ubuntu 14.04 Desktop) and the latest version of OpenBIS 16.05.1 (you need to apply for an account to be able to download the software). The electronic lab notebook (ELN) plugin comes bundled with that release. Doing that, you have a problem with Java 7 support (it is not going to maintained for long and I will try to run OpenBIS ELN with Java 8 soon, but this walk-through uses a Java 7 PPA for Ubuntu 16.04).1. Do a fresh install of Ubuntu 16.04.1 Server. Create during the install the admin user “openbis”. When it asks for software selection, choose OpenSSH and Postgresql in addition to standard system utilities. Upon first login (as openbis user), update and upgrade all the software to the latest version and install emacs (or whatever text editor you prefer) and unzip:sudo apt install unzip emacs24-nox2. Install Java 7. Thi sis just one way how to do it:sudo add-apt-repository ppa:openjdk-r/ppa sudo apt-get updatesudo apt-get install openjdk-7-jre-headless3. To setup postgresql correctly, change the configuration file /etc/postgres/9.5/main/pg_hba.conf. All lines ending in peer, the peer should be changed into trust! After that, reload postrgresql:sudo systemctl reload postgreql4. If you are installing to a virtual machine like virtualbox, it would make sense to install the guest utilities as this will make you life easier (virtualbox-guest-utils). Make a shared (permanent, automout folder) and add openbis to the vboxsf group:sudo usermod -a -G vboxsf openbis4. Place the compressed openBIS installer file into the home directory of the openbis user.5. Untar/gzip the installer:tar -xvzf openBIS-installation-standard-technologies-S233.0-r36799.tar.gz6. Change into the uncompressed directory:cd openBIS-installation-standard-technologies-S233.0-r367997. Change the following things in the console.properties file:INSTALL_PATH=/home/openbis/DSS_ROOT_DIR=/home/openbis/dataELN-LIMS = truePATHINFO_DB_ENABLED = trueINSTALLATION_TYPE = serverFor this try I have not changed the password of the keystore, but you should do it for security reasons if you use the server for production!8. Run the installer (not as root, but as openbis user):./run-console.sh9. When the installer asks to enter the password for the openBIS ‘admin’ user, type in the password you want to use when logging in as admin into the web interface.10. When installation is done, go to ~/openbis/servers/openBIS-server/jetty/etc and edit the file service.properties. You actually have not to edit anything for the installation to work, but we needed to configure the system for login authentication via Ldap.authentication-service = file-authentication-service => authentication-service = file-ldap-authentication-serviceIf you use ldap alone (i.e. authentication-service = ldap-authentication-service), you need to have some special users in the ldap directory. We are authenticating via our university’s ldap serer only regular users of the system and hence, e.g. the admin user needs to be authenticated locally. This admin user is setup during the install, but you need to have both file and ldap authentication active for this to work. This is our ldap server address as specified in the service.properties file. It contains the authentication base, which you need to ask from your sysadmins:ldap.server.url = ldap://ldap2015.it.helsinki.fi/OU=people,DC=helsinki,DC=fiThis is the ldap user and his password on the ldap server (don’t ask me why the ldap people use such complicated word monster for such a simple concept):ldap.security.principal.distinguished.name = OU=openbis,OU=login,DC=helsinki,DC=fi``ldap.security.principal.password = PASSWORDThe following paramters are specific to our ldap server. We use OpenLDAP and since OpenBIS seems not to support TLS, we use ssl:ldap.security.protocol = ssl``ldap.security.authentication-method = simple``ldap.queryTemplate = (&(%s))OpenBIS requires https. You can either leave the self-signed certificate (provided by the ETHZ) or install an own certificate. If you keep the self-signed certificate, all users will get a warning when they try to log into the web service. There seems to be an additional problem as the uploading of files seems not to work with the self-signed certificate since the https request via port 8444 doesn’t result in an intercept that is presented in the browser window to users to override.Hence we had no choice but to get a real certificate, which is luckily easier today than still one year ago due to the letsencrypt folks. Nevertheless, getting the certificate stuff right took us some time. We are operating the OpenBIS server inside the University network and it is not visible from the outside. Users who want to access it from outside need to use a VPN.Therefore we had to install a temporary “fake” server with the same name on a publicly reachable IP and generate a letsencrypt certificate (letsencrypt is not yet automated for jetty). I used the automated method for apache2 on my own server at Digital Ocean and then retrieved the two important files (fullchain1.pem and privkey1.pem) from the /etc/letsencrypt/archive/eln.jeltsch.org directory and moved them over to our OpenBIS server. To convert them into the correct format for the java keystore, I used the following commands:openssl pkcs12 -export -out keystore.pkcs12 -in fullchain1.pem -inkey privkey1.pemkeytool -importkeystore -srckeystore keystore.pkcs12 -srcstoretype PKCS12 -destkeystore keystore.jksThe first command asks for an export password. It doesn’t matter what you use (I used 12345678). The second command asks for a destination keystore password. Enter here “changeit” if you have not changed the default keystore password (“changeit”) during the setup. Then it also asks you for the source keystore password (which is the 12345678 that I just used above).Then you still have to add the contents of this keystore to the already exisiting keystore. There are probably many ways to do this, but I used a graphical tool called Keystore Explorer . You simply open both keystores (you need the “changeit” password for this), you delete the existing entry for ETHZ and add the only (letsencrypt) entry from the newly generated keystore. Replace the files “keystore” and “openBIS.keystore” in the directory ~/openbis/servers/openBIS-server/jetty/etc/ with the modified keystore. Both files are identical, I don’t know atm the relevance of this duplication. You also have to replace ~/openbis/servers/datastore_server/etc/openBIS.keystore with the new version of the keystore. For some reason, uploading did not work and in order to enable uploading, the service.properties of the datastore server needs to specify the host-address of the datastore server:https://eln needs => https://eln.jeltsch.org. Since we used a different host for the certificate generation, there was a host name mismatch and we had to override manually the hostname settings:Change it in the files /etc/hostname and /etc/hosts, then reboot. However, the installer took only the first part of the full name for the service.properties files of the datastore server. Our server’s name is eln.jeltsch.org and it resulted in https://eln, which did not resolve in our network, since we got the letsencrypt certificate signed on another server. After we changed the service.properties files and after rebooting we were finally ready to test the server:11. Starting the server: Log into the server as openbis user.cd ~/openbis/bin/./allup.sh12. On another computer, navigate in your web browser to “ https://eln.jeltsch.org:8443/openbis/webapp/eln-lims" . If you have not installed a publicly trusted certificate, the browser will now warn you that the connection is not secure. Just click “Advanced” and confirm the security exception. You need to login as admin/PASSWORD (which you specified during the install).There are some tutorials on how to use the ELN. However, the people in my lab told me that the UI is not very intuitive and that I need to teach them the basics. I think it might make sense to describe in a tutorial the typical setup in a typical small life science lab: what work spaces with what access rights for whom and to describe common scenarios (e.g. if some reagent lists need to be accessible by outsiders, etc.). I also have many ideas for improvements. It would be e.g nice to get more “ELN previews” for uploaded documents. At the moment, images are previewable, but e.g. PDF files not (I have not tried SVG files yet, but we use them quite a lot for image annotation). This certainly is not my last post about OpenBIS and until we take it into production use (likely beginning of next year) I still have to learn much.

How to start openvpn or ssh server under Ubuntu 16.04 and 18.04

Sat, 03 Sep 2016 00:00:00 +0000

OpenVPNsudo systemctl start openvpn@clientThe “client” is derived from the configuration file name (/etc/openvpn/client.conf). If your configuration file is server.conf, the command needs to besudo systemctl start openvpn@serverWhen you want the service to start up automatically during system boot, you issue:sudo systemctl enable openvpn@serverTemplated versus non-templated servicesOpenVPN is a so-called “templated” service (it needs a configuration file when being invoked). In contrast to this, the ssh server is a non-templated service. Hence the command is simpler:sudo systemctl start sshd

Cloning club - workshop material

Tue, 30 Aug 2016 00:00:00 +0000

Collection of the course materials for the DPBM -organized Cloning Club . There are files in (at least) two different formats for each lecture: PDF and ODP (Open Document Presentation). The ODP file is editable using LibreOffice software. If you want to open it with Microsoft Office, you need to convert it first using either LibreOffice or some online conversion tool (like cloudconvert ). The material by the course organizer (in Open Document and PDF format) is available under the creative commons license (excluding adapted material, which is explicitly marked). Material from course participants (in PowerPoint format) is provided at the terms of the creators. I might add improved versions the meeting/lecture slides later based on participants feedback.

University rankings (and how to manipulate them)

Mon, 29 Aug 2016 00:00:00 +0000

Whow. Helsinki University was again able to improve its position in the Shanghai Ranking and is now number 56. However, even the University’s own press release had kind of a gloomy tune as if this was the last blossom before the final decay. It is true that the basis of the current success has patiently been built by the researchers over the last decades. Nevertheless, when politicians now draw the conclusion that the cuts of the educational budget are responsible for this success, they are probably right.Perhaps the cuts actually did contribute to the surge in productivity: All the scientists that unexpectedly were suddenly unemployed obviously continued to work furiously on their current projects to get their current manuscripts ready for publication. Papers are the overwhelmingly dominant currency in the academic job market. And these unemployed scientists might publish faster than before since unemployed scientists have no teaching duties…However, more importantly, the Helsinki numbers of the individual Shanghai Ranking indicators for 2015 and 2016 differ significantly only the per capita academic performance (publications/number of academic staff) and the number of highly cited scientists. Since the job cuts at Helsinki Universities have been going on already for a while even before the massive cuts of this spring, it appears reasonable to claim, that the 56th position is partly due to the job cuts, which did influence directly and rapidly the number of academic staff.The Shanghai Ranking emphasizes research, whereas in other rankings, Helsinki has even been dropping. E.g. in the QS World University Rankings , Helsinki dropped from position 67 (2014/15) to 96 (2015/16). Between these two rankings, the QS team made “improvements” to their ranking system and these were almost exclusively responsible for the drop if you look at the data closely. They “normalized” the citation ratio per faculty according to the subject, and life science got badly punished by being a “high citation field”. Very simply put, a citation to a paper in Arts and Humanities now counts about 40 times as much as a citation to a paper in Life Science/Medicine. Each of the 5 big fields (Arts & Humanities, Engineering & Technology, Life Sciences & Medicine, Natural Sciences, Social Sciences & Management) contributes now equally with 20% to the final rating in the citation per faculty category (detailed explanation of the normalization from here: http://content.qs.com/qsiu/Faculty_Area_Normalization_-_Technical_Explanation.pdf).Why on earth do they punish a field for having a bigger impact? Papers in the humanities are not cited as much as papers in life science. Maybe this could be due to the fact that their average publication is not as relevant for their own field as is a life science publication for the life science field? I agree that there are cultural differences between fields, but who is to say how much is due to such cultural differences versus low quality or irrelevant research? Exactly that’s what QS World University Ranking’s did by making up “normalization” factors essentially claiming equal relevance.However, all such rankings are easily manipulated. E.g. the citation to faculty (member) ratio can easily improved by outsourcing services that were previously performed by faculty scientists (and that’s what Helsinki University is just doing at the moment). Similar to the impact factor for journals, university rankings are losing their relevance if the goal is to score high and not to excel at research and teaching ( Goodhart’s law : When a measure becomes a target, it ceases to be a good measure).The Shanghai Ranking has been criticized much. It undervalues teaching since teaching performance doesn’t enter directly the calculation at all, and it favours big universities since 50% of the rating are based on sheer numbers which are not normalized to account for the size of the university. Nevertheless it it the only reproducible (and therefore scientific) dataset from the three big rankings ( https://link.springer.com/article/10.1007/s11192-012-0801-y ) since both the QS and the Times Ranking rely heavily on opinion and reputation surveys, which are notoriously difficult to reproduce.What is the take-home message? Helsinki University is probably as good as it used to be during the last decade and the big fluctuations are just artifacts resulting from changed ranking methodologies or resulting from administrative adjustments to the financial realities brought upon us by the Finnish voters in the 2015 parliamentary elections.

Let's beat cancer together!

Sun, 07 Aug 2016 00:00:00 +0000

Sawan and me registered as “The Jeltsch Laboratory” team to the Helsinki Twilight Run , which is a charity event to support the Finnish Cancer Foundation . However, Sawan caught a summer flu and had to skip the whole event. My goal was to stay below 1 hour and I managed. There were actually more participants from the RPU (Research Programs Unit) ; I ran into Tiia and Julia. Maybe we should next year start as a joint RPU team (or whatever the RPU will be called if we really manage to change our name)?

Asustor AS7004T RAM upgrade

Sun, 31 Jul 2016 00:00:00 +0000

Are you about to buy the new Asustor AS7004T ? It is certainly an impressive small NAS server, but it comes only with 2GB RAM and if you want to utilize some of its cooler capabilities (like running virtual machines ) you need to add RAM. Its specs are uninformative (“2GB SO-DIMM DDR3 (Expandable. Max 16GB)”) and the memory installation guide misleading. However, it really does have two RAM slots for DDR3 SO-DIMM. The device that I bought had 2GB RAM glued into the user-serviceable RAM slot, while the virtually inaccessible factory RAM slot was empty. If you want to add RAM, it requires you to void the factory warranty as the empty RAM slot is not accessible without removing the screw that is covered by the “Void if removed” sticker. Anyway, almost complete disassembly is required for you to access the free RAM slot, which is not for the faint of heart. Especially since Asustor’s own YouTube video shows the disassembly only for the 10-bay AS7010T model, which is significantly different from the AS7004T. The biggest difference between the 7004T and the 7010T is that the 7004T has an additional cooling element screwed to the PCI back plane. This cooling element takes the heat from the mother board, but also makes removing the back plane and the mother board more tricky. You also need to remove the power supply and disconnect the power cables from the motherboard before you can take the motherboard out.

The Staden package on Ubuntu for bioinformatics dinosaurs

Wed, 27 Jul 2016 00:00:00 +0000

Mostly we use the SnapGene software when we check the sequences of our DNA constructs. However, sometimes SnapGene’s alignment view is not flexible enough and then I fall back to using the ancient Staden Package . I just had upgraded from Ubuntu 14.04 to 16.04 and hence did not have Staden installed. I was pleasantly surprised when the installation of Staden took only about 15 seconds because finally - thanks to the Debian Med team - Staden is available from the universe repository (actually already since October 2014).sudo apt install stadenStaden is clearly not as intuitive as it could be, but it is very powerful and lends itself to automated processing of data. If you have the opportunity to learn it, I would encourage you to do so. The Finnish CSC recorded the Staden course from 2004, in which I participated and you can get the recordings from Funet TV . I just had briefly considered switching from Ubuntu to SuSE because of the ongoing wireless connection debacle that Canonical can’t seem to fix, but considering how non-trivial a manual install of Staden is, this is a big plus for Ubuntu. There are obviously dedicated Linux distributions for bioinformatics purposes, but they all tend to lag behind the latest and greatest developments of the major distros.

Moving from Paper to Electronic Lab Notebooks

Tue, 26 Jul 2016 00:00:00 +0000

Electronic lab notebooks (ELN) are the future. While this statement appears self-evident, it is not clear what software will establish itself and which ones will disappear. When I first checked the ELN market about three years ago, there were only a handful of solutions. Now there are already maybe about a hundred different software companies that try to cash in on the trend. And what is even more worrisome is the fact that the list of vendors contains already about 20 abandoned products…Thus, settling on a software is a serious decision for a lab and even more so for a whole institute. Many points need to be taken into consideration. Just to mention a few of them:- How sure is it, that the software is available and supported in 10 years? If the company disappears, your data might as well. All vendors will claim that your data is safe. You should be realistic given the widespread deception of customers and authorities by companies. Just think about VW…- What is the upfront investment and what are the running costs? If they charge you for storage space, the price might initially be low, but don’t underestimate how much data you will accumulate with all the new high res imaging and sequencing technologies. Once you are doing superresolution, you easily can gather a many GB each week. E.g. SciNote includes 100 GB of storage for 2 teams, which can fill up within a few weeks depending what type of research you are doing. I was trying to figure out how to buy storage beyond 100 GB, but I could not figure out how. I hope that the usability of their ELN is not on the same level… - How free is your data? Can you easily (and in an automated fashion in regular intervals) pull out your data if you need to? In what format can you get your data? If it is only PDF or Word files, just forget about it. You should get a real database dump that can be used to populate other systems. I would not trust any company to tell me ahead of time that they will go belly-up soon and that I should rescue my data…- Where are the data stored physically? This determines e.g. what law the data falls under and who has access to it. How much can you trust a small company overseas to keep your data private and secure? Let’s remind everybody of the data breaches that affected Sony, Linkedin, IRS, T Mobile, UPS, JP Morgan Chase… Some vendors offer in-house hosting, but the pricing seems to be too high for many academic labs to make this a viable alternative.- Open Source seems to be a solution to may of these problems. However, with diminishing computing infrastructure support from the university, the maintenance requirements of such a system need to be very low in order to make this feasible.- If it is marketed as “free”, what do they mean with free? Often, the “free” offering is not sufficient for any serious work and hence misleading. “Free” as in “free beer” is also not enough… Many labs need also the freedom to adapt the software to their specific needs, which excludes proprietary solutions without public APIs.In my lab we have been testing a few of the available solutions. Our emphasis was on open source solutions since only Open Source solutions make it easy to test the software extensively. So far we have tried:

Batch renaming files on the command line

Tue, 28 Jun 2016 00:00:00 +0000

The default command line application for batch renaming files in Ubuntu 16.04 is called “rename”:rename 's/tk98i_/wt_tk98_/' *.tifIt uses Perl regular expressions with and the s/old/new/ syntax. The example above renames all files with the .tif extensions and replaces the th98i_ expression with wt_tk98_.Here are some more examples: http://tips.webdesign10.com/how-to-bulk-rename-files-in-linux-in-the-terminal

ffmpeg

Sun, 26 Jun 2016 00:00:00 +0000

Trimming an avi file: ffmpeg -i Die_Sendung_mit_der_Maus_16.06.19_09-30_ard_30_TVOON_DE.mpg.HQ.avi -vcodec copy -acodec copy -ss 00:06:04 -t 00:29:32 output.aviss is the start time and t is the duration (not the end time)webm to mp3 conversion:ffmpeg -i La_robe_de_soie.webm -vn -ab 128k -ar 44100 -y "La_robe_de_soie.mp3"Concatenate two videos:ffmpeg -f concat -safe 0 -i list.txt -c copy /tmp/output.avilist.txt:file 'video1.avi'file 'video2.avi'UPDATE:It is nice to be able to manipulate video files on the command line. However, especially for the more advanced functionality, the syntax becomes impossible to remember. Hence the need for a GUI that makes ffmpeg more accessible. The best tool that I have come acress so far is the cross-platform LosslessCut . There are also packages for Mac, Linux or Windows .

RPU Seminar 2016

Fri, 24 Jun 2016 00:00:00 +0000

Available Downloads

Get the slides in PDF format.

Download PDF

Cloning Club

Wed, 22 Jun 2016 00:00:00 +0000

Together with the Doctoral Programme in Biomedicine (DPBM) we are organizing in autumn 2016 a workshop and a practical course about cloning (course code 921244).Dates and venue (workshop): Weekly discussion workshop (8 events each 1 to 1.5 hours) starting Tuesday 30.8.2016; venue: meeting room 7 (Biomedicum Helsinki, 5th floor, except 27.09. and the last workshop on 25.10., which take place in BM B136A); 1 creditDates and venue (practical course): Decentralized lab course (at the participants schedule and venue or - for participants without own access to the necessary facilities - in the first two weeks of November in our lab); 1 creditCourse information page: http://www.helisci.fi/hbgs/cloning-club2016 Registration page: https://elomake.helsinki.fi/lomakkeet/71701/lomake.html Detailed course info: PDF Advertisement poster: PDF Course material: Material will be added after every meeting here . Cloning has the appeal of being boring. However, all starts with DNA. Genetic engineering is not only here to stay, but will become more and more important: we are just scratching the surface of its potential. Almost all biomedical research involves DNA constructs: expression vectors to transfect cells, shuttle plasmids to make viruses, constructs to generate transgenic animals.The skill to generate a DNA construct is needed until the arrival of that promised device, which will spit out any plasmid a few hours after you have fed it the plasmid’s sequence. Many new technologies are available and as a result, it is more difficult to choose than in the old days when restriction enzyme cloning was the only option. Today, demands and options are endless and you need to choose the right strategy to maximize success and speed.

Unicorn 7-Benutzer-Einrichtung erfordert manuelle Intervention in einer Netzwerkbenutzer-Umgebung

Fri, 17 Jun 2016 00:00:00 +0000

Unicorn, Äkta Avant, Äkta Explorer, GE Healthcare, Windows, Netzwerk-Authentifizierung, Benutzer-Einrichtung, Methode, Resultat, Wissenschaft, ProteinaufreinigungSince we are operating our Äkta Avant in a multiuser environment, we need to separate the methods and results of the different users. By default, every network user is at the moment able to see every method and every result that has been generated on the machine by any other network user. This is a considerable privancy and security issue as a malicious user could delete (or even worse: modify) methods and results.Our Äkta is set up in a way that allows users to log into the Unicorn 7 computer with their university login/password via the regular Windows network authentication mechanism. However, if several people share the responsibility of a run, this setup becomes impossible as they would need to devulge their passwords to each other. Hence we have created a local account which can be used by users who wish to share the operation of the Äkta.After logging into Winodws, users still have to log into the Unicorn 7 software, which users do with their university login and password (“Windows authentication”). Using this setup, every user is able to see all methods and results, which is not acceptable.When setting up a new user with Unicorn version Access>Folders") and exactly which folders were accessible by that user and the user would see only his/her own methods and results. Since the folder structure under Unicorn 5 was a folder structure of the Windows file system, users could always copy methods and results from one folder to another and thereby make them available despite the limitations set by the Unicorn 5 program.When I first read that Unicorn 7 supports Windows network authentication, I had hoped that we would be able to avoid the painful user setup which we had to go thru for each user on the Äkta Explorer. However, the pain continues as setting up the user privileges once for a group doesn’t give us user isolation.Firstly, one cannot restrict access of individual users in Unicorn 7, but only access of groups. We had to create one Access Group for each network user, add the network user to this group, create a separate home folder for the group and then restrict the folder access to this home folder. Hundreds of clicks were required for a handful of users since the default is no access to anything and every single privilege check box needs to be enabled except for the admin privileges.In that respect, Windows (and every other OS) is way smarter than Unicorn. If a university employee logs into a machine that he or she has never been logging into before, it creates all the necessary default local folder structure automatically and mounts that users private home folder without granting access to everything other employees have been doing on that specific machine. I think that should be an option on Unicorn as well. Maybe it is and I just can’t figure it out?Another big drawback of the above described method of separating each user into an own access group is that login into the Unicorn program becomes a major ordeal: In addition to writing user name and password the user has to select the correct access group for the login to be successful. And even worse: In our setup we cannot avoid that every university employee belongs to two access groups: A manually created access group for each user for user separation and the “default” which works via the Windows network authentication - maybe Kerberos?). Hence, if users do choose the default access group (which is called “Users” in our case), they are able to log in, but they don’t see their methods and results.There are two reasons we cannot delete the “Users” access group: One is the mandate of the faculty and secondly (and we have tried), we cannot delete it anymore as many people have already created methods and generated results being in the access group “Users”. Thus UNICORN prevents us from deleting this account. I am working on this problem: I should be able to access directly the underlying MS-SQL database in order to change the ownership of the methods and results. However, GE was not exactly forthcoming when I was asking about access right handling. The answer was:The DB access credentials in a standalone UNICORN solution are encrypted and are not public. If you had an enterprise solution (hosting your own (SQL server) DB) you would have control of the credentials and in theory you could extract the wanted information (the format is something that you have to figure out by yourself and is not supported by us). You can upgrade your solution to an enterprise if you want.This sounds worse than it is, because we have physical access to the MS-SQL server and pulling out the access credentials seems not very difficult. But it takes my time to find the exploit to “break into our own system” and that is what annoys me. However, according to Lisa Bromark from GE, the 7.0.2 update seems to correct this issue:UNICORN can be configured to use a new database password. It is possible to generate an encrypted password or to enter an already encrypted password. This is done by running the UNICORN Service Tool after UNICORN installation.However, it is unbelievably difficult to get the update (at least it seems to take weeks). Distribution is apparently still via optical media and snail mail. I think the last time I got myself software via a CD/DVD was more than 10 years ago. However, GE told me that they are just moving UNICORN software updates to “electronic distribution”. Welcome to the 21 century!

Echtes Biohacking

Mon, 13 Jun 2016 00:00:00 +0000

Steven Novella hat einen interessanten Blog-Artikel ūber Biohacking geschrieben. Ich schliesse mich seiner Meinung grösstenteils an, dass die meisten diesen Begriff zu Unrecht fūr sich in Anspruch nehmen, weil sie eben nichts konzeptionell Neues machen, was diesen neuen Begriff rechtfertigte. Allerdings haben sich für die Anwendung dieses Begriffes und seine Abgrenzung zur DIY-Biologie und diversen Körper-Modifikationsbewegungen noch keine einheitlichen Maßstäbe etabliert.Die Definition von Biohacking als die “Freiheit, seine Biologie tiefgrūndig zu erforschen” ist weitgehend nichtssagend. Das Wort Hacking hat im allgemeinen Sprachgebrauch meist den Beigeschmack des Illegalen oder zumindest des Halblegalen. Diesem Sprachgebrauch folgend könnte man Doping im Sport als Biohacking bezeichnen, Kaffeetrinken aber eher nicht (einmal davon abgesehen, dass Kaffeetrinken zumindest für einige Leute den Tatbestand des Doping erfüllt). Ein anderes Beispiel, das ich als “echtes” Biohacking bezeichnen würde wäre der Gebrauch von Crispr/Cas um seine eigene DNS zu editieren. Oder die Herstellung von Medikamenten in der eigenen Garage.Die Frage ist: Macht irgendeiner sowas? Gentechnologische Verfahren und die Herstellung von Pharmazeutika sind im universitären und kommerziellen Bereich streng reglementiert, weil solche Verfahren einige Risiken mit sich bringen. Es ist daher nicht verwunderlich, dass die regulierenden Behörden sich nicht darüber freuen, noch eine weitere Szene auf Anzeichen von Bioterrorismus überwachen zu müssen.Tatsächlich wird es immer leichter, die diesbezüglich notwendigen Werkzeuge herzustellen und zu benutzen. Biotechnologie in der Garage ist Wirklichkeit, zumindest hat die Zeitschrift Nature diesem Thema ein News Feature gewidmet. Schon vor geraumer Zeit habe ich einen Vortrag gehört von Thomas Landrain, einem der Köpfe hinter dem La Paillasse-Labor (Thomas: du hattest versprochen, die Internet-Seiten von La Paillasse ins Englische zu übersetzen!), einem Biotechnologie-Laboratorium, dass ohne Startkapital in einer Pariser Vorstadt-Garage gegründet wurde und dass wirklich interessante Projekte durchführt (hier ein Artikel von Thomas Landrain über DIY-Biologie ). Und auch Konferenzen wurden schon zum Thema DIY-Biologie veranstaltet: https://www.synenergene.eu/news-item/paris-conference-what-can-do-it-yourself-biology-do . Aber wo ist die Grenze zwischen DIY-Biologie und Biohacking? E. coli-Bakterien zu modifizieren, damit sie Erythropoietin herstellen, dann das Protein aufreinigen und in sich selbst injizieren, um seine sportliche Leistung zu verbessern würde wahrscheinlich jeder als Biohacking durchgehen lassen. Meiner Meinung nach ist dieses Beispiel gar nicht so abwegig, sondern wäre durchaus mit den Mitteln der heutigen DIY-Biologie realisierbar.

BSD and Linux

Fri, 10 Jun 2016 00:00:00 +0000

I am used to the fact that a Linux installer honours a pre-existing install of Windows and offers to setup the computer with a dual-boot option during installation. Vice-versa no Windows installer honours any other pre-exisiting OS. Therefore I was surprised that when I tried to install Ubuntu 16.04 on my PFSense box (FreeBSD), the Ubuntu installer did not even see that a BSD install exists on the drive. I chose the “erase all” option, but when I rebooted after the installer has finished, the system went straight into PFSense without giving me any option to select Ubuntu. I guess the boot loader had not been touched by the Ubuntu installer. I booted from a live Ubuntu USB stick, reformatted the drive with fdisk and wrote zeros to the boot loader:dd if=/dev/zero of=/dev/sda bs=512 count=1Then I repeated the install and everything was fine. However, my PFSense installation was lost…

Netstat

Fri, 10 Jun 2016 00:00:00 +0000

To list all ports that a server is listening to:sudo netstat -plnt

Real biohacking

Mon, 23 May 2016 00:00:00 +0000

I have read an interesting blog post by Steven Novella about biohacking . I completely agree that most people that push biohacking are not doing anything, that would justify the use of the term. A new term should be used if you are doing something conceptually new. However, the use of the term biohacking and its relationship to DIY biology and diverse body modification movements has not settled yet.The definition of biohacking as the “freedom to explore biology deeply” makes the term rather meaningless. Hacking as a term has always carried the notion (rightly or not) of doing something illegal or at least borderline legal. To follow this analogy, doping in sports could be considered biohacking (but not drinking coffee - notwithstanding the fact that coffee does fulfil the criteria of doping for some people). Other examples that I would call “true” biohacking would be the use of Crispr/Cas to modify your own DNA. Or developing medical drugs to treat diseases in your own garage.The question is: does anybody do such things? The development of such techniques is highly regulated in both academic research and commercial enterprises and real genetic engineering carries real risks. Not surprisingly, law-enforcement officials are not very happy about still another subculture to watch for signs of bioterrorism . However, the tools are getting easier and easier to use and garage biotech is a real thing (at least Nature thought it is worth a News Feature ). Already a while ago, I did listen to a talk by Thomas Landrain, one of the brains behind the La Paillasse lab (Thomas: you promised that the La Paillasse web pages would be translated into English!), which is a biotech lab that was started with zero money in a garage in a Paris suburb. They are doing quite interesting research (see e.g. this article about his take on DIY biology). There are also conferences about DIY biology: https://www.synenergene.eu/news-item/paris-conference-what-can-do-it-yourself-biology-do . But when does DIY biology become biohacking? Modifying E. coli bacteria to produce erythropoietin and then purifying and injecting it into yourself to increase your sports performance would certainly qualify as biohacking. Imho that example would actually be feasible considering the state of the DIY biology technology…

Unicorn 7 user separation requires manual intervention in a network user environment

Mon, 09 May 2016 00:00:00 +0000

Since we are operating our Äkta Avant in a multiuser environment, we need to separate the methods and results of the different users. By default, every network user is at the moment able to see every method and every result that has been generated on the machine by any other network user. This is a considerable privancy and security issue as a malicious user could delete (or even worse: modify) methods and results.Our Äkta is set up in a way that allows users to log into the Unicorn 7 computer with their university login/password via the regular Windows network authentication mechanism. However, if several people share the responsibility of a run, this setup becomes impossible as they would need to devulge their passwords to each other. Hence we have created a local account which can be used by users who wish to share the operation of the Äkta.After logging into Winodws, users still have to log into the Unicorn 7 software, which users do with their university login and password (“Windows authentication”). Using this setup, every user is able to see all methods and results, which is not acceptable.When setting up a new user with Unicorn version Access>Folders") and exactly which folders were accessible by that user and the user would see only his/her own methods and results. Since the folder structure under Unicorn 5 was a folder structure of the Windows file system, users could always copy methods and results from one folder to another and thereby make them available despite the limitations set by the Unicorn 5 program.When I first read that Unicorn 7 supports Windows network authentication, I had hoped that we would be able to avoid the painful user setup which we had to go thru for each user on the Äkta Explorer. However, the pain continues as setting up the user privileges once for a group doesn’t give us user isolation.Firstly, one cannot restrict access of individual users in Unicorn 7, but only access of groups. We had to create one Access Group for each network user, add the network user to this group, create a separate home folder for the group and then restrict the folder access to this home folder. Hundreds of clicks were required for a handful of users since the default is no access to anything and every single privilege check box needs to be enabled except for the admin privileges.In that respect, Windows (and every other OS) is way smarter than Unicorn. If a university employee logs into a machine that he or she has never been logging into before, it creates all the necessary default local folder structure automatically and mounts that users private home folder without granting access to everything other employees have been doing on that specific machine. I think that should be an option on Unicorn as well. Maybe it is and I just can’t figure it out?Another big drawback of the above described method of separating each user into an own access group is that login into the Unicorn program becomes a major ordeal: In addition to writing user name and password the user has to select the correct access group for the login to be successful. And even worse: In our setup we cannot avoid that every university employee belongs to two access groups: A manually created access group for each user for user separation and the “default” which works via the Windows network authentication - maybe Kerberos?). Hence, if users do choose the default access group (which is called “Users” in our case), they are able to log in, but they don’t see their methods and results.There are two reasons we cannot delete the “Users” access group: One is the mandate of the faculty and secondly (and we have tried), we cannot delete it anymore as many people have already created methods and generated results being in the access group “Users”. Thus UNICORN prevents us from deleting this account. I am working on this problem: I should be able to access directly the underlying MS-SQL database in order to change the ownership of the methods and results. However, GE was not exactly forthcoming when I was asking about access right handling. The answer was:The DB access credentials in a standalone UNICORN solution are encrypted and are not public. If you had an enterprise solution (hosting your own (SQL server) DB) you would have control of the credentials and in theory you could extract the wanted information (the format is something that you have to figure out by yourself and is not supported by us). You can upgrade your solution to an enterprise if you want.This sounds worse than it is, because we have physical access to the MS-SQL server and pulling out the access credentials seems not very difficult. But it takes my time to find the exploit to “break into our own system” and that is what annoys me. However, according to Lisa Bromark from GE, the 7.0.2 update seems to correct this issue:UNICORN can be configured to use a new database password. It is possible to generate an encrypted password or to enter an already encrypted password. This is done by running the UNICORN Service Tool after UNICORN installation.However, it is unbelievably difficult to get the update (at least it seems to take weeks). Distribution is apparently still via optical media and snail mail. I think the last time I got myself software via a CD/DVD was more than 10 years ago. However, GE told me that they are just moving UNICORN software updates to “electronic distribution”. Welcome to the 21 century!

Python für Kinder

Thu, 05 May 2016 00:00:00 +0000

Mein Sohn lernt gerade Programmieren. Und es macht Spass. Zuerst haben wir zusammen ein bischen in html und php programmeirt, da er ein Online-Quiz auf seiner Website machen wollte. Danach haben wir angefangen, das (deutsche) Buch “Python für Kids” ( http://python4kids.net ) durchzuarbeiten. Ich habe Python gewählt, weil es eine moderne, leicht zu lesende Sprache ist. Sie ist heute wahrscheinlich die erste Wahl für angehende Programmierer. Python ist Open Source, einfach auf allen Betriebssystemen zu installieren und leistungsfähige Programme können schon nach einer kurzen Lernphase geschrieben werden. “Python für Kinds” verwendet das Turtle-Modul , das eine grafikorientierte Einführung ins Programmieren ermöglicht. Die Grafik oben ist z.B. eines der Ergebnisse.Python ist auch eine sehr gute Wahl für Biologen und Bioinformatiker. Da Python eine Mehrzweck-Sprache ist, ist man nicht auf bestimmte Aufgaben beschränkt (wie z.B mit R). Es gibt mit Biopython ein sehr gutes Modul für den Umgang mit DNA und Proteinsequenzen (und sogar 3D-Strukturen).

Good leadership?

Mon, 02 May 2016 00:00:00 +0000

When I started as a principal investigator at the University of Helsinki , I was advised to take the “Good leadership” course which was arranged by Personnel Training . Together with 14 other research group leaders, I learned between November 2013 and March 2014 from Sanna-Marja Heinimo and other experts i.a. the “skills for effectively developing, coaching, empowering and leading others to getting best results”.At the end of the course, we had a dinner with Jukka Kola , who is now credited for implementating the extensive (and according to many observers overboarding) cost savings that were forced upon the university by the budget cuts mandated by the prevailing political powers.I do not want to discuss here whether such drastic measures were necessary or a less extensive savings strategy would have been sufficient. Even the decision whether to save or to practise deficit spending in an economic downturn is mostly not based on facts but on ideology. In economics, fashion and Zeitgeist are at work in addition to hard data. Therefore, it is not surprising that prominent economists are holding opposing views concerning the effects of deficit spending. But I go off on a tangent here…I simply wanted to express my total disappointment. Not in the savings themselves, but in the way HOW the savings were implemented in relation to the “good leadership” practises that we have been advised to practise.The decisions were not sufficiently openly discussed. Still now, the grounds for many lay-offs remain incomprehensible and controversial (see e.g. this article in the major Finnish daily newspaper Helsingin Sanomat). Since transparency was noticeably absent, the talk about good leadership by the top management of the university seemed to have been hardly more than lip service. I do not doubt that they have the best intentions in mind for the greater good of the university. Just who defines the greater good? Most oligarchs define it themselves, don’t they?So it is not surprising that in the recent workplace well-being survey, the satisfaction with the strategic leadership at the university level (rectors and vice-rectors) was at an all-time low. If the polls would be repeated now, the results would likely be much worse, especially if the fired people would still get a voice. Notably, it is not only the average employee of the University of Helsinki, who does not trust the leadership any more. My feeling is that the distrust now pervades researchers at all career stages. What future is possible with such a constellation?Google is consistently named among the best American companies to work for and they decided to spend millions of dollars and many years to research how to create the best work teams. The single most decisive factor in determining the innovation outcome, creativity and productivity of a team was psychological safety ( see this NYT Magazine article ). Guess how safe university employees are feeling at the moment.When we were talking with Jukka Kola, I was very impressed with his clear commitment towards increased internationalization at the University of Helsinki. However, I already wondered back then how realistic the goal to “actively recruit top international staff” is. Now it seems even more unlikely that this goal can be reached to a meaningful degree since universities start to experience a new wave of brain drain. Even at the students’ level, where the internationalization has made amazing progress in the last 20 years, we might see a decline with the introduction of tuition fees for non-EU/ETA students .

The logic of the Äkta Avant fraction collector

Mon, 02 May 2016 00:00:00 +0000

After we solved all the [teething troubles with our Äkta Avant]((/en/akta_avant), we finally dare to let customers use it. Our customers are very heterogeneous covering complete novices to FPLC and experienced Äkta Explorer users (and everything in between). When we have been giving feedback to GE, our perspective is obviously biased towards a certain type of user. However, taking care of customers is giving us now a new perspective since we get confronted with the usability problems that they cannot solve by themselves. Here I just want to mention one stumbling stone, that has repeatedly brought up to us: the rationale behind the operating mode of the fraction collector. Unlike in the older systems, the fractions collector cannot be manually reset to “First position” or to any arbitrarily defined position as was possible e.g. under Unicorn 5.It took us ourselves quite a while to get used to the internal logic of the fraction collection process and we needed guidance from GE. The fact that the system is not behaving intuitively is underlined by the fact that some of the answers that we received from GE experts were incomplete (leading for us to some unpleasant sample losses). Finally we received from GE support a table that describes the behaviour of the fraction collector (see below). However, even that table is incomplete and we have added a few lines that describe some non-standard situations for which the table does not provide an answer. These changes and additions to GE’s description have been marked in red.

Clearing the BIOS password in a HP Compaq Elite 8000

Mon, 18 Apr 2016 00:00:00 +0000

Power the computer down, remove power cable (and other cables that can carry electricity) and let residual charge drain. Open lid and remove the green jumper. Reboot and you’re done. Maybe you want to put the green jumper back not to loose them (you can also apparently leave it attached to pin 1 or pin 2, but not connect both pins).

BackupPC and Macs

Wed, 13 Apr 2016 00:00:00 +0000

I myself have been using the backup software BackupPC for almost a decade, and I started to backup our lab computers to a central backup server about two years ago. BackupPC supports deduplication and therefore much data can be stored on a couple of 2 TB drives.BackupPC supports many protocols (smb, ftp, tar/rsync via ssh), but we mostly use rsync via ssh. The data is not encrypted before the backup. Strangely not even the upcoming version 4 will support pre-egression encryption. However, we store the backup on an encrypted volume. That way it is at least protected if the backup server is stolen. And during transit, the data is protected by ssh. However, the system is not TNO (“trust no-one”), since I (as the backupc administrator) can access the files. When using Linux, one feasible method would be to encrypt the user’s home directory using eCryptFS (which is an inbuilt option when creating users on Ubuntu ) and then backup the /home/.ecryptfs directory instead of the users home directory. However, recovery would be much more of a problem. You would be able to browse the diectory structure and files of the backup, but the filenames would be meaningless since they are also encrypted in the process.There is one peculiarity in backing up Mac OSX machines: BackupPC normally connects as root via ssh into the client computer and executes the rsync backup command. In order to make this possible on university-managed Mac OSX computers, we had to create a dedicated user (“backuppc”) on the client machines and allow for this user the execution of rsync with root privileges, which is done by adding this line in the /etc/sudoers file:backuppc ALL=NOPASSWD: /usr/bin/rsync. Then we have to change the ssh/rsync command for the Mac client on the backuppc server changing “root” into “backuppc”.

HiLoad 26/60 Superdex pg gel filtration chromatography column performance

Mon, 11 Apr 2016 00:00:00 +0000

The most common protein purification technique that we use is gel filtration (also called size exclusion chromatography). In gel filtration, proteins are separated by their size (or more correctly by their “Stokes radius”, which is largely determined by their size and shape). For gel filtration of large protein amounts, we bought GE Healthcare’s HiLoad 26/60 Superdex 200 prep grade about 9 years ago (the 26/60 has been replaced by HiLoad 26/600, but both are almost identical). With this column you can very cleanly separate two proteins that have a size difference of 100%. Therefore it is suitable to separate monomeric from dimeric versions of the same protein. The columns “expiry date” was 2012-03. Our experience is that under proper handling, such a column can easily reach a life span of 10 to 15 years (we don’t use it very often, we store it in 20% ethanol, if we don’t need it for longer periods of time, we keep it at +4°C).

dd a broken DVD

Thu, 07 Apr 2016 00:00:00 +0000

dd if=/dev/sr0 of=image.iso bs=2048 conv=noerror,notrunc iflag=nonblock

Test iframes

Mon, 04 Apr 2016 00:00:00 +0000

Python for Kids (and bioinformaticians)

Sat, 12 Mar 2016 00:00:00 +0000

I started to teach my son programming and we both are enjoying it. First we did a bit of html/php since he wanted to make an online quiz on his website, but now we started to work through the (German) book “Python für Kids” ( http://python4kids.net ). I chosen Python because it’s a modern, easy-to-read language, and nowadays probably the most popular first choice for starting programmers. It’s open source, easy to install on any system and you can get write powerful programs after a short learning period. Python for Kids uses the Turtle module, which enables a graphics-oriented introduction into programming. The graphics on the left is one of the results. Another very useful Python teaching resource for kids is Code Club .Python is also a very good choice for biologists and bioinformaticians, but since it is a multi-purpose language, you don’t limit yourself to certain tasks. There is Biopython , which is a very good toolset for the handling of DNA and protein sequences and even 3D structures.

How much PCR product can you get?

Thu, 10 Mar 2016 00:00:00 +0000

How much PCR product does one get from a typical PCR reaction? 50-120 ng/µl seems to be a typical result, but it very much depends on your PCR conditions. If you need to minimize your primer concentration to maximize specificity, your yields can be significantly below that. Vice versa, if specificity is not an issue (e.g. for some PCR clonings), you can get many times more.Let’s consider the typical maximum amount of a single PCR reaction, which is 100 µl. And let’s assume we do not have specificity issues and therefore we can use large amounts of primer (1 µM each) and dNTPs (0.2 µM). Since the synthesis of every molecule of double-stranded PCR product consumes one primer, the theoretical maximal molar concentration of double-stranded (ds) DNA product is the same as your primer concentration: 1 µM. 1 µM dsDNA would equal 100 pmol for a 100 µl PCR reaction. How much is that in micrograms? That is of course dependent on the length of your PCR product: e.g. 100 pmol dsDNA of 1000 bp is equal to 66 µg.Can you really get that much? Not in our example of a 1000-bp-product. The reason is that the building blocks of the DNA, the dNTPs, become exhausted long before the primers do. For the 1000 bp product, only 40% of the primers are used up when the dNTPs run out (assuming a GC to AT ratio of 50:50 in your amplicon). To make one molecule of a 1000 bp dsPCR product, you need about 2000 molecules of dNTPs. For our example, a 400-bp PCR product would therefore be optimal as both primers and dNTPs get exhausted at the same rate.It seems that if you want to get larger amounts of longer PCR products you would need to increase the dNTP concentration. However, in our example of a 1000 bp product, the theoretical maximal amount of PCR product is about 26µg, which is massive and sufficient for most applications. There is an online calculator, that lets you play around with primer and dNTP concentration and product length: http://www.bioline.com/us/media/calculator/01_14.html

Review of GE Healthcare's Äkta Avant 25

Wed, 02 Mar 2016 00:00:00 +0000

About one year ago, we secured funding in an internal faculty call to replace the old Pharmacia Äkta Explorer 100 FPLC machine of the Protein Production and Purification core facility . The Äkta Explorer had been purchased in 1996(?) when the Swedish brand Pharmacia still existed. In 2014, the worse case scenerio happened and both monochromator and Xenon flash lamp broke almost simultaneously, which left us with a bill of almost 10000€. Hence we wanted to replace the machine with a contemporary model. There are only two companies offering serious devices in this space, which is GE Healthcare ( Äkta product line ) and BioRad ( NGC product line ). GE Healthcare inherited the Äkta brand from Pharmacia via multiple mergers, while BioRad is a relatively new contender with their NGC models, which they released only a few years back.We opted for the Äkta Avant 25 . We definitely wanted to have a cased, refrigerated fraction collector. And we wanted to have a familiar user experience. We often run automated purifications and we do not like our proteins to be for longer times at room temperature in open tubes into which bacteria and dust from the air can enter.By now, we have operated the Äkta Avant for about half a year and we have meanwhile a good idea how it compares to the Äkta Explorer. Even though the Avant is more modern than the Explorer, all users of our core facility still use the Explorer. They are familiar with the user interface of Unicorn 5.11 and seemingly have no interest in learning the - admittedly - more complicated UI of the Avant. But the other reason it was only in internal use so far was the fair amount of problems that we have encountered. With our old Äkta Explorer, we have never seen so many problems in such rapid succession. I don’t know whether our situation is typical (according to GE Healthcare’s representatives it is not). Nevertheless, here are the issues that we encountered:

Essential git

Tue, 01 Mar 2016 00:00:00 +0000

git pull origin mastergit push origin mastergit commit -m "comment" -a https://www.linux.com/learn/tutorials/824358-how-to-run-your-own-git-server

Taj Mahal

Mon, 08 Feb 2016 00:00:00 +0000

One and a half years after our last big LEGO project (the big Millenium Falcon ), we finished now the Taj Mahal , which is with 5922 parts the largest LEGO set ever released for retail. Again, we used our existing LEGO parts and only bought the missing ones via Bricklink from four different online shops.

The Jeltsch Laboratory

Sat, 23 Jan 2016 00:00:00 +0000

My laboratory’s web pages at the University of Helsinki

Centrifugal and centripetal embryonic lymphatic development

Tue, 19 Jan 2016 00:00:00 +0000

Since the beginning of last century, researchers have been arguing about the embryonic origin of the lymphatic system. Some claimed that it is in its entirety an outgrowth from blood vessels (so-called centrifugal hypothesis with Florence Sabin and Louis-Antoine Ranvier as early proponents, this mechanism of growth is called “lymphangiogenesis”). Others maintained the view that the lymph vessels do form newly from precursor cells in the mesenchyme (so-called centripetal hypothesis with George Huntington and Charles McClure as early proponents, this mechanism is called “lymphvasculogenesis”). This controversy has been going on for more than a century and several published studies within the last years show, that the truth lies somewhere in between both views. Such synthesis had been proposed already in 1932 by van der Jagt. Kenny Mattonet and myself wrote a short update on the topic and you can read the English version or the German original .

FPLC Protein purification course

Mon, 04 Jan 2016 00:00:00 +0000

Eight postgraduate students registered for the FPLC protein purification course , which took place in December. If I learned anything, than that protein purification during a course should be done ALWAYS with a protein and a protocol, that has been used before successfully MANY times. Student-provided proteins are a great source for learning, but the time restraints of a course format did not allow us to finish the purification of these proteins during the course.Technical Problems with the new Äkta Avant 25In addition, the Äkta Avant 25 , that we newly purchased from GE Healthcare this summer, broke TWICE during the course. First the controlling computer broke (RAID failure). HP delivered the replacement drive within 24 hours and after the RAID had rebuilt itself, we could continue the course. However, during the first run after this incident, the Äkta ran into an overpressure problem. We identified a faulty flow restrictor as the cause, but we did not want to continue as we have had severe problems with air bubbles in previous runs. Therefore we performed the runs on the old Äkta Explorer 100 . GE Healthcare quickly had their service engineer check out the system, but since he did not have a spare with him, we had to wait until Monday 14.12. until the Äkta Avant was again fully functional.What we purified: soluble VEGFR-3 (VEGFR-3/Fc) and HepsinWe did purify soluble human VEGF receptor-3 (the first three domains of its extracellular domain connected to the constant Fc part of human IgG). This is a purification that we have done many times. It is equivalent to the purification of antibodies using Protein A sepharose.We had prepared in advance conditioned cell culture medium. We produce most of our proteins in insect cells (mostly Drosophila S2) and the VEGFR-3/Fc had been secreted by the S2 cells into the medium after induction of the metallothionein promoter with 1 mM Cu2+ for about 4.5 days. The preparation of the medium for purification consists only of 1) getting rid of the cells by centrifugation and 2) filtration to remove precipitates and other small particles that might clog the column. There is no need to adjust the pH.Rapid neutralization after low pH elution IS IMPORTANTWe ran the medium over a disposable 5-ml HiTrap recombinant Protein A column over night at about 1ml/min and eluted with a low pH buffer. The eluted 2-ml fractions were immediately neutralized with 400µl 1M Tris pH 8.5. Here we made a small mistake during one of the two purifications. GE Healthcare had not released the casettes for the 5-ml-collection tubes (they still have not done so even though they did promise them already for September 2015) and we used 15-ml Falcon tubes to collect 2-ml fractions, into which we had pre-aliqotted 400 µl of the neutralization solution. However, the mixing in these tubes was not efficient and the prolonged exposure to low pH resulted in a partial damage to our protein. This can be seen when comparing the size exclusion chromatograms of Group 2 versus Group 4: For Group 4 the first peak (aggregated protein) is much larger and more heterogenous compared to the same peak for Group 2.In fact, when VEGFR-3/Fc is eluted by low pH from protein A columns, it always precipitates at higher concentrations soon after elution, but dissolves again upon neutralization. This did not happen in the fractions 5.A.3 and 5.A.4 (Group 4) due to the inefficient mixing of elutate and neutralization buffer in the 15-ml-Falcon tube (the fraction size of 2 ml was probably to blame as well; 1 ml would have been better). During the run for Group 2, we removed the tubes immediately after the run had ended and thereby mixed the buffers, while for Group 4 the run finished during night time and the eluate remained largely unmixed until the morning.Alternatively, we could have eluted with a highly concentrated chaotropic salt at near-neutral pH (which we’ll do next time in case we have an automated run where the elution happens in the middle of the night). Pierce offers a (proprietary) “gentle” elution buffer of pH 6.6. I don’t know the Pierce buffer composiiton, but it is a highly concentrated solution of some chaotropic salt. 3M potassium/sodium thiocyanate or 4M magnesium chloride in buffered solutions around pH 7 are frequently used chaotropic salts for this purpose.HepsinThe student-provided proteins were challenging. First, their concentrations in the starting material was very low. While we can see clearly the protein when the VEGFR-3/Fc conditioned medium is run on a PAGE gel and stained with Coomassie, no such band is visible for the Hepsin. In addition, it appeared that a significant fraction of the protein seems not to contain the histag (anymore) and therefore is not captured with the first purification step. The fraction of Hepsin-H6 that does bind to the Ni2+ sepharose elutes already at an imidazole concentration of 20 mM, which makes washing the column challenging. The Hepsin with the longer histag (H10) survives the 20 mM imidazole wash, but it suffers also from low expression levels.Below are the chromatograms of the individual runs and the annoteded images of the Comassie-stained PAGE gels. The detailed protocol for the operation of the Äkta Avant 25 is still under preparation…

SnapGene - Simply the best DNA manipulation software

Fri, 01 Jan 2016 00:00:00 +0000

Our lab has been using different software packages to plan, document and visualize DNA constructs. Among those that we liked a lot for a long time were Textco’s GeneConstructionKit (GCK) and Clone Manager (Professional) . The latter runs unfortunately only under Windows. However, since several of our computers run Ubuntu Linux , we did run GCK versions 2.5 and 3 using WINE (a compatibility layer that allows us to run native Windows programs under Linux). However, with the upgrade to version 4, GCK became unusably slow under WINE and we were looking for a replacement. We contacted the developers of GCK, but they apparently were either not willing or able to help us. I suppose that the codebase of GCK is probably more than 20 years old and for that reason nobody dares to touch it. Just around that time, SnapGene was released and it fulfilled almost all of our requirements:

Know your rights

Thu, 19 Nov 2015 00:00:00 +0000

In a series of articles in the magazine Acatiimi , Mia Weckman from the Finnish Union of University Researchers and Teachers (FUURT) was introducing the Finnish legal system and legislation concerning the work place. This series was specifically aimed at foreign new employees and written in English and is therefore one of the few sources of information if you don’t know the Finnish language. However, let’s keep in mind that paper and displays don’t blush. Many of the rules were developed and are well suited for work traditional work places but less so for academic research, which flourishes best when driven by enthusiasm and devotion and not by duty. Nevertheless, since we are far from that ideal, you should know your rights. Here are the topics and the links:

Top 8 Science Podcasts to Listen to

Wed, 11 Nov 2015 00:00:00 +0000

My top 8 podcasts targeted at scientists (but not only for scientists). Try them: they are entertaining and keep you up to date with what’s going on in science generally. If you focus on your narrow field of expertise, you’ll become narrow-minded. Many leading science magazines have jumped on the podcast band wagon (e.g. Science Magazine Podcast , Nature Podcast ), but I mostly enjoy the genuine podcasts, that established the science podcast genre. There’s a limit to what one can listen to (for me that’s one hour a day during my cycling commute) and I include a few that I like listening to, but that don’t make it into my regular schedule at the moment. In the order of decreasing personal preference:

Managing OpenVPN with Network Manger

Thu, 05 Nov 2015 00:00:00 +0000

I just switched back from MacOSX to Ubuntu for work. Mostly for financial reasons. We need more computers at work and a really good PC laptop is just half as expensive as a MacbookPro or iMac. Today I wanted to connect from home to the University’s VPN network and I had a look at the instructions provided by the university.As usually, documentation was virtually absent and what was available was wrong. And exclusively in Finnish ( http://www.helsinki.fi/helpdesk/ohjeet/tietoliikenne_ja_etakaytto/yhteydet_yliopiston_ulkopuolelta/vpn_ubuntu-asennus.html) . From the image (Hardy Heron) it is clear that this page has not been updated for about at least 6 years (Hardy Heron was realased in the beginning of 2008).So what do you do if you downloaded and extracted the hy-vpn-config.tar.gz file from https://ohjelmistojakelu.helsinki.fi?First you need to install a plugin for the Network Manager: sudo apt-get install network-manager-openvpn network-manager-openvon-gnome. Then you go to the Network Manager via the icon in the menu bar on the top right of your Desktop. Below all the available wireless networks, there is an entry “VPN Connections”. Follow “VPN Connections” -> “Configure VPN” -> “Add” -> “Import a saved VPN configuration” -> “Create”. Then select the “openvpn.conf” from the downloaded and extracted files. After that, fill in the rest of the dialog box: User name, Password. For the CA Certificate, select the “HY-vpn-CA.pem” file from the downloaded files (you should have put it first somewhere safe, e.g. to “/etc/openvpn”).One problem that people are complaining about is the fact that the import does not honor the “redirect-gateway def1” directive and as a consequence you won’t be able to connect anywhere (I guess this is due to the Network Manager using dnsmasq and dnsmasq is apparently not smart enough to realize that it should send the queries somewhere else now). That’s why people are complaining that Network Manager doesn’t work to route all traffic via the VPN network. The box that you need to uncheck for this to work is well hidden: It’s in the connection editor dialog under the IPv4 Settings tab -> Routes (at the bottom right) -> “Use this connection only for resources on its network”. Why on earth do they have to call it in a way that nobody understands its meaning? Why not to call it “Do not route all traffic through this VPN connection”? I also had to check the box that said “Ignore automatically obtained routes”, although I don’t know why…As usual, setting up the OpenVPN sucks and the important tunneling back of VPN traffic needed to be added manually on the OpenVPN server:iptables -t nat -A POSTROUTING -s 10.8.0.0/24 -o eth0 -j MASQUERADEI did it by making an additional file called openvpn2 in the /etc/network/if-up.d/ directory with the following content:#!/bin/shiptables -t nat -A POSTROUTING -s 10.8.0.0/24 -o eth0 -j MASQUERADEOf course you can still start and stop the VPN via the command line. However, since systemd, the password entry is not straightforward. When you execute sudo systemctl start openvpn.service you need to execute (e.g. in another terminal) sudo systemd-tty-ask-password-agent and enter your password there. That’s clearly a kludge until they get a decent password agent…

Being indexed

Tue, 03 Nov 2015 00:00:00 +0000

There are many databases storing and analysing scientific publications . “Being indexed” or “being listed” simply means for a journal that one of these databases includes the articles that are published in this journal. Importantly, several of these databases also include citation data for each article; therefore they are often referred to as journal citation databases. Since there are many such databases, virtually every journal is “listed” somewhere and if you want to get your journal listed, there are several guides out there, e.g. Getting your journal indexed . However, in the life sciences, there are a few databases that are substantially more important and authoritative than others. The big three are MEDLINE , Web of Science and Scopus . How are these three databases different? Clearly, the most important journals are covered by all of them. But less important journals and journals that publish in non-English languages might be only listed by one or two of the three. The databases have different journal selection criteria (see below) and the selection is subject to constant change.MEDLINE MEDLINE is a non-commercial database that is maintained by the US-American National Library of Medicine and the selection of journals happens under NIH -oversight. MEDLINE and especially its online portal PubMed are exceptional due to their free accessibility for everybody. In fact, PubMed is probably the only transparent academic bibliographic database that can be used for free by everybody to research life science literature. MEDLINE currently indexes 5620 journals.Web of ScienceThe Web of Science comprises several databases and they used to be maintained by the Institute of Scientific Information (ISI), before it was sold to Thomson Scientific & Healthcare (nowadays Thomson Reuters ). The ISI was founded by Eugene Garfield , who is considered to be the father of bibliometrics and scientometrics . The Web of Science currently indexes 13762 journals (combined Arts & Humanities, Expanded Science and Social Sciences Citation Indexes).ScopusThe other commercial journal database is Scopus , which is owned by Elsevier , the largest publisher of scientific journals. Scopus is the largest of these three databases covering many more journals than the other two. According to some, this is due to the somewhat loosely applied journal selection criteria ( http://www.issi2015.org/files/downloads/all-papers/1198.pdf) . There has also been some discussion about the independence of the journal selection for commercial databases. After all, according to a study published in PlosOne, five companies control more than half of all academic publishing, with Elsevier dominating at about 25% of the market ( http://dx.doi.org/10.1371/journal.pone.0127502) . Scopus indexes currently over 22000 journals.People have been comparing databases and citation counts (e.g. here ). One database, that I have been omitting is Google Scholar . Even though the free accessibility of Google Scholar and its broader approach to measure impact have advantages as opposed to Web of Science or Scopus, Google Scholar is - similar to the general Google search engine - not very open about what journals and sources its search covers. In my opinion, this is a big draw-back, but on the other hand Google probably constantly has to tweak its algorithm to avoid exploitation. If you want to know more about Google Scholar as a citation database, I recommend this article . Journal ListsMEDLINE: ftp://ftp.nlm.nih.gov/online/journals/lsi2015.xml,http://www.ncbi.nlm.nih.gov/nlmcatalog?cmd=historysearch&querykey=1 (currently indexed)http://www.ncbi.nlm.nih.gov/nlmcatalog/?term=reportedmedline (all)Web of Science/Thomson Reuters: http://ip-science.thomsonreuters.com/mjl/Scopus : https://www.elsevier.com/__data/assets/excel_doc/0015/91122/title_list.xlsx Journal selection criteriaMEDLINE: https://www.nlm.nih.gov/pubs/factsheets/jsel.htmlWeb of Science/Thomson Reuters: http://wokinfo.com/essays/journal-selection-process/Scopus : https://www.elsevier.com/__data/assets/pdf_file/0006/95118/SC_FAQ-content-selection-process-22092014.pdf

This year's Nobel prizes

Mon, 12 Oct 2015 00:00:00 +0000

Three of this year’s nobel prizes were given for topics we work on: The prize in Medicine was shared by Youyou Tu and William Campbell/Satoshi Ōmura. Campbell and Ōmura received their share for the development of an anti-parasite drug that is effective against roundworms (nematodes), which are the cause of river blindness, lymphatic filariasis and a few other diseases. Nematodes, that cause lymphatic filariasis (like Brugia malayi) are living in the lymphatic system. Many nematodes do express a VEGF-C-like molecule, but the function of this parasite-VEGF-C for the nematode’s life cycle has never been looked at.The prize in Chemistry was shared by Tomas Lindahl, Paul Modrich and Aziz Sancar for their mechanistic studies of DNA repair. We are right now experimenting with such mechanisms, especially the cytidine deamination, which we exploit in order to generate mutations on demand. When cytidine is converted into uracil (which can happen spontaneously or mediated by an enzyme), the enzyme Uracil-DNA glycosylase (UNG) removes the uracil base. Then another enzyme (apurinic/apyrimidinic endonuclease) cleaves the backbone 5’ to the abasic site and DNA polymerase beta excises the abasic sugar phosphate residue and inserts a cytosine thus repairing the damage.The third prize is the one in Economic Sciences, which went to Angus Deaton. “He pioneered the analysis of individual dynamic consumption behavior under idiosyncratic uncertainty and liquidity constraints.” (from the Advanced Information PDF by the Royal Academy. I freely translate: He researched how peoples ‘spending behaviour changes in the face of irregular and insufficient income. That describes quite well our lab’s financial situation and we indeed work on that issue, because science without money doesn’t work.

Difficult start

Wed, 26 Aug 2015 00:00:00 +0000

UPDATE: I asked the Academy for the funding rates for the Academy Professor positions, but there are so few of these positions that you don’t get any usable statistics out of that data. I received a very transparent answer from the Academy (including the numbers I was asking for). The decision to preferentially cut funding from postdoctoral researchers was a conscious one by the Academy to preserve the means to do competitive research for projects and Academy Research Fellows. However, the trend to move funding from younger to older researchers seems to be general and has been going on already for half a century in the US (see e.g. here: http://metamodern.com/2009/11/27/great-science-great-scientists-and-icons/ or here: http://nexus.od.nih.gov/all/2012/02/13/age-distribution-of-nih-principal-investigators-and-medical-school-faculty/) . Our future depends on new ideas and innovations. I am not sure, whether it is true that younger investigators come up with more new ideas and innovations as claimed in the blog post above ( http://metamodern.com/2009/11/27/great-science-great-scientists-and-icons/) , but if that is the case, moving money away from them would a bad idea in the long run.Getting a research position funded by the Academy of Finland is becoming increasingly difficult. What worries me most is the fact that the savings are concentrated at the “lower” end of the academic career ladder: The success rate of applications for the postdoctoral researcher positions has been deteriorating most while Academy projects’ funding remained largely untouched in the Research Council for Health. This Tuesday, the Academy presented these numbers at the Ask & Apply event for this September’s funding call at the Medical Faculty. Academy Research Fellow funding was also stripped down, but much less than the postdoctoral researcher funding. Strangely enough, the slide omits the success rate of applications for Academy professor positions. Is this indicative of a generation conflict, where established researchers are successfully trying to secure the dwindling resources for themselves? I would need to know the application success rate for the Academy Professors and the granted amounts in order to draw any conclusions.

Erkrankungen des Lymphgefäßsystems (Diseases of the Lymphatic System)

Wed, 05 Aug 2015 00:00:00 +0000

The 6th edition of the the book Erkrankungen des Lymphgefäßsystems (Diseases of the Lymphatic System) is out. It’s a German language textbook, for which Kenny Mattonet, Jörg Wilting and myself wrote the fifth chapter (Genetic causes of primary lymphedema). Get it from here , since Amazon still sells the old, 5th edition. If you have a really good excuse why you should get one for free, mail me! I have a few copies.

Neon electroporation device chickens out

Tue, 04 Aug 2015 00:00:00 +0000

UPDATE: We are not the only ones that try to economize on our running costs. This lab published its experiments in with the Neon system in Analytic Biochemistry . Thanks to Joachim Goedhart ( @joachimgoedhart ) for bringing this to our attention! The Neon transfection device from Life Technologies (oops, Thermo Fischer nowadays and former Invitrogen ) was introduced about five years ago to the market. It is designed for easy electroporation of mammalian cells. We have had the device available since 2011, but it was not much in use. I don’t know whether the low adoption rate is due to the user-unfriendliness (I still don’t know how to put the electrode tip to the pipettor despite having done this hundreds of times, it’s just really finicky mechanics), expensive running costs (for its desposible gold-plated electrodes and the proprietary transfection buffer) or something else I cannot figure out.However, there are a few things that I wanted to share because real useful information about the Neon device is scarce on the web.The first thing that we had constant problems with were air bubbles in the electrode tip, which result in desastrously low electroporation efficiencies. The only way to really prevent this is to prepare at least 25% more cell suspension than actually needed. When you prepare only 10% more, the last electroporation will certainly arc due to unaviodable air bubbles (the cell suspension additionally sticks easily to the outside of the pipette tip which contributes to the need to prepare more than actually needed). As a consequence of this, we ran out of electroporation buffer R long before we ran out of pipette tips. Additionally one cannot purchase buffer R separately. The Life Technologies representative with whom I corresponded promised to send us a small batch of pipette tips/buffer in good will (that was in January), but we are still waiting for that to arrive…Unforatunately, recently our old Gene Pulser II electroporation device broke. Bio-Rad doesn’t repair it anymore and also doesn’t provide spare parts. It was mostly used for E. coli electroporation. I knew that the Neon device was not designed to electroporate E. coli. Why not and why can’t it be used for that purpose? It turns out that the electric field strength is by far not enough for E.coli (in the BioRad Gene Pulser II, a typical bacterial electroporation achieves an electrical field of 12.5kV/cm, whereas the Neon barely achieves around 850V/cm. However (I thought), the neon can do much longer pulses than the Gene Pulser II (Neon is advertised to be able to give pulses up to 100 ms, whereas the typical pulse length of the Gene Pulser II is about 5 ms). In addition to this, the Neon can deliver automatically multiple pulses. So I wanted to test whether a long and/or repeated pulse with lower field strength can transform E. coli. However, it appeared that when you use water (or 10% glycerol) as the E. coli transfection buffer (which you usually do), the machine complains the tip electrode doesn’t make contact. This is due to the fact that the machine tests whether you have inserted the tip correctly by sending a small current through the system and that current doesn’t flow if you have resuspended your E. coli in water. In order for the machine to “accept” an inserted pipette tip electrode, you need somewhere between 10 and 20 mM NaCl. So I used 15 mM sodium chloride as E. coli electroporation buffer and set the electroporation parameters to 2500V and 100 ms. Surprise: The machine refuses to give such pulse because it is “Over power limit!”. The maximum pulse length it can deliver with 2500V is 19 ms. Unfortunately even that pulse cannot be given automatically multiple times (again: “Over power limit!”). Therefore I manually executed this pulse between 1 and 20 times, but not a single bacterium received any DNA and all bacterial plates remained blank.The manual states:"The Neon TM device is designed to only input certain values and limits for each value are listed below. If your input value exceeds the maximum value, an error is displayed.Input Voltage range: 500–2,500 VInput Pulse Width range: 1–100 msInput Pulse Number range: 1–10Unfortunately, this can be very easily misunderstood. It was not clear to me that one cannot combine the three parameters within these ranges freely. One should think that Life Technology has better technical writers (but maybe they don’t use the device…)Bottom line: The device is utterly useless for anything but mammalian cells. Also some other interesting applications (e.g. electroporation of nematodes or other small critters) are difficult or impossible. While the machine might be a good choice for many mammalian cells, it’s much more limited than the old-fashioned BioRad Gene Pulser II.P.S.: I used the buffer E to fill the pipette station (for use with 10 µl tips). However, I also tested instead of buffer E a mixture of 90% 150 mM sodium chloride and 10% glycerol (which gives me the same conductivity as buffer E has). However, I still really would like to know the composition of buffer R. Why? Because I think that the tip electrodes can be recycled more often than only twice (other manufacturers of pipette tip electrodes advertise that their electrodes can be recycled many more times (e.g. the BactoZapper , although they don’t give precise numbers either). The Neon manual states that “Oxide formation at the piston surface area can be generated if the tips are used more than 2 times, which decreases electrode function of the piston.” The electode is gold plated and gold should be more resistant to oxide formation than the stainless steel electrodes of the BactoZapper…

Strawberry fields forever

Sun, 02 Aug 2015 00:00:00 +0000

Seldom does one find wild strawberries in amounts that allow you to pick liters, but this summer we did. I hope that genetic engineering will sooner or later bring back this amazing taste into the cultivated varieties, which have lost most of it over the centuries of breeding for size and appearance. When that happens, I suspect that GMO opponents will continue eating the conventional, GMO- and taste-free, but pestidicide-surcharged breeds (read more about GMO plants).For now, we have to make do with the cultivated varieties. Cultivated strawberries are sold at the grocery store by weight, whereas on the market they are sold by the liter. Being frugal by nature, I never liked this as it makes comparing prices difficult. Assuming that strawberries can be approximated by equally sized spheres, the maximum theoretical packing density could be 0.74 kg per liter (using regular packing) and 0.63 kg per liter (using random packing). Assuming that strawberries can be squeezed a bit, these number could be slightly higher. However, this is again offset by the measuring jar’s small size, which leaves lots of slack space between the walls and the strawberries.I bought a few times 1 liter of strawberries and measured their weight, which averaged at 0.517 kg. Now my thumb rule is that if the liter price it equal or less than half of the kilogram price, you should buy by the liter.UPDATE: I measured now also blueberries and they (due to their smaller size) fill better the 1-liter jar used by the market vendors. I liter is approximately equal to 0.575 kg. Another take home message is that market vendors do usually give you a bit more. If you buy a liter you often get 1.05 or even 1.1 liters. Are they are generous or do they only respond to being watched by the customer during the process of weighing?

Lymphangiogenesis in health and disease

Thu, 11 Jun 2015 00:00:00 +0000

Available Downloads

Get the presentation in PDF format.

Download PDF

The new Finnish government cuts university funding by around 500 million € (or not?)

Thu, 11 Jun 2015 00:00:00 +0000

UPDATE: It appears that some of the party representatives that were the source of the information in this article have not been reflecting the official positions of their respective parties (in other words: they were talking BS without having any authorization to do so). In reality, the coming cuts and their sizes are going to be determined only during this coming fall season.

Helkama Jääkäri - everything but the frame broke within the first 3 years

Thu, 07 May 2015 00:00:00 +0000

For one last time, I have to write about the Finnish bicycle company Helkama . I own the Helkama Jääkäri , which is a military style bicycle and marketed as extremely tough. The frame has 25 years warranty. However, pretty much everything else has been braking within the first 3 years, which ridicules the whole concept. During this year’s spring overhaul, I had to replace three parts: The stand, the saddle and the bell. And I see already signs of future trouble… In none of my previous bikes, saddle or stand have been breaking that fast. And that includes cheap bikes for half the price that I paid for the Jääkäri. Apparently, Helkama does not vet its component suppliers sufficiently. My Jääkäri’s rear wheel had to be replaced already after the first winter and the carrier meanwhile two times. When it broke the third time, I did not even bother to get it replaced again, instead I repaired and reinforced it myself . I really hope that Helkama’s advertisement is just a lie and that the Finnish Army does not use this bicycle.

Best paper award

Fri, 01 May 2015 00:00:00 +0000

[

![](/sites/]( http://www.med.helsinki.fi/english/news/2015/20150505_Jeltsch.html)We have won Circulation’s 2014 Best Paper Award in the category of Basic Science. Circulation is the leading cardiology journal and the organ of the American Heart Association . Already when we published the paper (titled [/files/files/Jeltsch%20et%20al.%20-%202014%20-%20CCBE1%20Enhances%20Lymphangiogenesis%20via%20A%20Disintegrin.pdf">“CCBE1 Enhances Lymphangiogenesis via A Disintegrin and Metalloprotease With Thrombospondin Motifs-3–Mediated Vascular Endothelial Growth Factor-C Activation”](/sites/<?php print $_SERVER[)), it was clear that it provided a major overhaul of our understanding of the VEGF-C growth factor and it got featured by Open Heart . The article manages to provide multiple new insights:

Thank you, Lufthansa!

Thu, 30 Apr 2015 00:00:00 +0000

In the morning of September 25th, 2014, I was waiting at Helsinki Airport to board Lufthansa flight LH 855 to Frankfurt where I was to change planes on my way to Genoa, Italy. I had been invited to give a talk at 2:45 pm at the 40th Congress of the European Society of Lymphology. I had only 1 hour 10 minutes stopover time in Frankfurt. 1 hour 10 minutes after the scheduled departure time, me and a few other passengers had not yet managed to board (they had boot problem with their computer system and people were checked in manually). I explained the desk attendant the situation and he said that it would be absolutely no problem to get a refund in this situation when I would decide not to board as I had no chance to catch my connecting flight. They apparently had overbooked the machine and the guy next in line was very happy when I gave up my seat. However, the desk attendant was not right, when he told me that getting the refund would be easy. Actually I have not received it by the time of this writing. However, I got assured by a phone call from Lufthansa, that it would happen within the next two to three weeks.In the frenzy to be competitive, Lufthansa has been streamlining its services to such a point that they apparently are dysfunctional. My first attempt to claim refund was via the regular route: online. When nothing had happened for 3 months, I phoned. Multiple times. Mostly to be cut of after having been in the waiting queue for 15 minutes or more. Then I wrote a physical letter to a UK address that Lufthansa had posted online for customer complaints. That letter came back after about 2 months: “address unknown”. Then I wrote another letter to the new address (they finally managed to update their web pages) and after another couple of weeks, I received that phone call from Lufthansa. Very apologetic. This should never have happened. They sent me two bottles of champagne, which arrived by courier, while I am still waiting for my money. I am flying next month to Switzerland to the 41st Congress of the European Society of Lymphology. I am flying Finnair.

Creating a video from webcam still images with crontab and ffmpeg

Wed, 29 Apr 2015 00:00:00 +0000

I have a webcam that is taking images when there is movement in its view field. It uploads them to a ftp server. I wanted some automated method to generate a video file from the images of the previous day. Finally I came up with the following shell script which is living under /etc/cron.daily:#!/bin/sh## cron script to make a movie out of webcam stills## The webcam puts the images of the whole day into a folder with the date. This generates the target folder.foldername=/home/ftpuser/labcam/$(date -d "-1 days" +%Y%m%d)echo $foldername# This renames the iamges into 1.jpg, 2.jpg, etc. This is necessary for ffmpeg to recognize them. counter=1for i in $foldername/*.jpg; do new=$foldername/$counter.jpg echo $new cmd='mv $i $new' eval $cmd counter=$((counter+1))done# This does the actual conversionffmpeg -f image2 -framerate 25 -i $foldername/%d.jpg -c:v libx264 $foldername/out25.mp4# And this removes the jpg files from the target folder (in order to save space)cmd2='rm '$foldername'/*.jpg'eval $cmd2

Follow us on Google+ and support cancer research!

Fri, 17 Apr 2015 00:00:00 +0000

This is an invitation to all of you to follow my lab’s new Google+ pages. This is your chance to support cancer research. You will need a Google+ account to follow us: https://plus.google.com/101997423182393816561

Writing scientific articles in German - a waste of time?

Wed, 08 Apr 2015 00:00:00 +0000

It appears strange to us, but one hundred years ago the lingua franca of science was German. Although my former boss Kari Alitalo had warned me, I wrote in 2013 a two part review about lymphangiogenesis in German and I was shocked to see, that it had not been cited at all since. In order to make it available for a broader audience, we translated it now into English. Given the fact, that the average article gets about 4 citations altogether, we need only to be cited five times to be above average…

Helkama quality woes

Sun, 25 Jan 2015 00:00:00 +0000

This post is a follow-up of my post from 2 years ago about my new bicycle, a Helkama Jääkäri . It had its fair share of problems, and even though the customer service was very responsive, the repetitive problems with its luggage carrier were too much for me. Last December, the third carrier broke. I had received also the this one as a free-of-charge replacement, but it is a nuisance when it breaks, even though replacing takes only about 10 minutes. It is not in very heavy use: the stuff I transport on it weighs about 2-3 kg, but apparently the welded/soldered connections are prone to fatigue breakage. Helkama knows that it has a quality problem with its carriers. When I asked for the second replacement carrier, the customer service told me, that they are trying to identify a suitable replacement for the subcontractor who makes these carriers. This time I thought to repair the carrier instead of asking for another replacement, which took less time and will probably last longer. I don’t know whether they have changed their component supplier. If my own repair breaks, I still have two old broken carriers I can repair, but most likely, my next bicycle is not going to be a Helkama .

Air humidifiers

Sat, 24 Jan 2015 00:00:00 +0000

What is the optimal relative humidity (RH) for humans? Opinions differ, but mostly the estimates for “optimal” indoor relative humidity are concerned about the house and not the people living in it. Optimal values for human health fall in between 40 and 70% ( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1474709) . The humidity in a rain forest never falls below 80% and even in the savanna the RH is mostly above 50% if that is any reference of a RH that humans have become adapted to. But mostly people deploy air humidifiers when they observe symptoms and the requirements to relieve those symptoms might be different to the requirements for healthy people. Anecdotal evidence has it, that some types of cough only disappear under a hot shower above 37°C, where the RH is close to 100%. Under those conditions, water will probably condensate inside the airways thus thinning the mucus resulting in a better debris removal and reduced postnasal drip*. However, there is evidence that not all respiratory tract infections benefit from higher humidity, e.g. croup (Finnish: kurkunpääntulehdus) seems unaffected by humidity despite common longstanding believe of the opposite ( http://www.cjem-online.ca/v6/n5/p357 versus http://www.ncbi.nlm.nih.gov/pubmed/1906598) . Interestingly, the use of both humidifiers and dehumidifiers appears positively associated with childhood asthma ( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2966669) , which could indicate a hygienical problem with such devices in general. Also for asthma too high humidity is contraindicated, although this recommendation seems to be based mostly on the indirect effect via increased mold and mite infestation or bacterial contamination. I could not find much evidence for a direct negative effect of high RH on asthma and some asthma experts have nothing against a reasonable increase of the RH by means of a humidifier provided that the device is maintained clean and that the humidity is kept within safe limits to ensure that it does not contribute to increased allergen exposure (e.g. http://asthma.ca/corp/services/pdf/asthma_humidifiers_vaporizers2_eng.pdf) . For more info about the relationship of relative air humidity and asthma see https://books.google.fi/books?id=ehuYVX2-hWYC&num=10.The problem with relative humidities between 40-70% is, that they can promote mold growth. However, the situation is a bit complicated. Even 70% RH is not much of a concern if there are no temperature differences between indoors and outdoors. Mold needs water to grow and water condensates when the RH reaches 100%. With relative humidities of 40-70%, that happens when cold surfaces meet warm air (windows, outer walls). When this condensation zone cannot buffer (wrong material) nor conduct the humidity away (airtight materials), you’ll have a problem (see e.g. http://www.hs.fi/kotimaa/a1416111843440 , article in Finnish). Therefore indoor mold is a more severe problem in colder climates and “optimal” air humidity for the house differs from season to season being the lowest for the cold season. For countries with cold winters even low relative humidities can cause mold to grow. At -30°C the recommendation is that the RH be not above 15%. That is a level so low that I guess that even otherwise healthy individuals will start to experience health problems*. Estimates are that about 20% of all buildings in Finland have a mold problem ( http://uutiset.hometalkoot.fi/component/dpcontentplugin/files/download/20/Kosteus-%20ja%20hometalkoot%20toimenpideohjelma.pdf , article in Finnish).Due to this, buildings in Finland use nowadays mostly forced circulation to ensure that dry air is constantly blown through all rooms. When the temperature drops to -20°C or lower, the relative air humidity can get indoors as low as 15%. This is so low that most people start to complain about respiratory symptoms and dry, cracking skin. Off they go to buy a humidifier. But do those really make a difference?There are mainly two different types of humidifiers for home use on the market: those that evaporate water by heating and those that create a water mist by ultrasound ( http://en.wikipedia.org/wiki/Humidifier) . I found the heating type utterly useless: In order to achieve any appreciable increase of humidity (from the typical winterly 30% or less in Finnish apartments to anything above 40%), I had to reduce the air change rate by partially blocking the air vents that blow the air into the room like this . By doing this the room got unbearably hot because the humidifier not only evaporates water but also acts as a quite efficient heating element (I tried the UFOX 3S: http://www.ufox.fi/ilmankostuttimet with a power of 165W, which can evaporate up to 150 ml per hour.So the only alternative was an ultrasound evaporator. How well they raise the relative humidity depends mostly on the air change rate (ACH, http://en.wikipedia.org/wiki/Air_changes_per_hour , in Finnish “ilmanvaihtokerroin”). That’s a number that tells you how many cubic meters of air are exchanged per hour for each cubic meter of room space (m3/h/m3). There is some provision here in Finland, that this number has to be at least 0.5, but mostly the real numbers in residential homes are nowadays much larger. However, in the context of this minimum, the health effects on the inhabitants are usually discussed (radon, gassing-out from furniture, etc.), but not the effects on the building (see e.g. here: https://www.rakennustieto.fi/Downloads/RK/RK070304.pdf , article in Finnish).I have made a quick and dirty calculation of how much water evaporation is needed to keep the RH in a small room above 40% and then checked these values against what I observed when we did use the air humidifier in my daughter’s room to reduce her coughing during the night. The data points:

Resistance to streptomycin and spectinomycin

Sun, 11 Jan 2015 00:00:00 +0000

Many cDNA clones from the ORFeome gene collection come in a pENTR223.1 plasmid*. To grow these clones most people use spectinomycin because that’s what the antibiotic resistance gene is called in the maps on the ORFeome collaboration and what the protocol requires.However, a thorough look at the literature shows, that the same selection marker should work equally well with streptomycin. Well, what’s the difference? Mainly the price: While 5 grams of spectinomycin from Sigma cost 112.7€ here in Finland (Sigma 85555-5G) , the same amount of streptomycin is only 17,80€, more than 6 times cheaper (Sigma S6501-5G) .The resistance gene in pENTR223.1 is the aminoglycoside adenylyltransferase gene aadA (streptomycin 3’’(9)-O-nucleotidyl transferase; aminoglycoside 3"-adenylyltransferase (AAD(3”)(9); ANT(3”)(9)), which confers resistance to both spectinomycin and streptomycin. However, there are related aminoglycoside adenylyltransferases, that do not confer resistance to both antibiotics, but only to one or the other. Hence you need to know exactly what spectinomycin resistance gene your plasmid carries if you want to replace spectinomycin with the cheaper streptomycin. Plasmid maps are often not helpful: I have seen the aadA gene in pENTR223.1 annotated with SmR (Streptomycin Resistance, like in SnapGene) or SpnR (Spectinomycin Resistance, like in the maps from the ORFeome collection).To experimentally test, whether pENTR223.1 confirms resistance to both antibiotics, I grew an insert-containing pENTR223.1 plasmid in 100µg/ml spectinomycin and 100µg/ml streptomycin and it grew well under both conditions, whereas the untransformed parental E.coli strain (NEB5-alpha) did not grow in either. However, the differences are not always clear-cut when you look at different concentrations of these antibiotics. Streptomycin/spectinomycin inactivating aminoglycoside adenylyltransferases have preferred, but not exclusive substrate specificities. this means that some resistance to a low concentration of streptomycin can be conferred by the aminoglycoside adenylyltransferase that targets primarily spectinomycin (or vice versa). However, in practise, some of them are exclusive enough to justify to classify them as either SmR or SpnR. If you need to know, you can always try it out…The other thing I learned while doing this is that the negative selection marker ccdB DOES NOT work in XL1 Blue, while it does work in NEB5-alpha. Apparently, ccdB does not work in DH5alpha and JM109 either (what’s the difference between DH5alpha and NEB5alpha?).* pENTR-223.1 is also called pDONR-223.1 or pENTR223.1-Sfi due the two SfiI sites flanking the insert. People tend to call the plasmid pDONR before the insertion of the cDNA and pENTR if the plasmid contains the cDNA. However, this usage pattern is not ubiquitous. Upon insertion of the insert (using the Gateway BP reaction) the pDONR223.1 vector looses the ccdB and chlR/CmR selection markers and the resulting backbone is referred to mostly as pENTR223.1.

Lab cam

Fri, 02 Jan 2015 00:00:00 +0000

2-week Lab Course

Tue, 30 Dec 2014 00:00:00 +0000

I had no idea how much work it is to organize a practical lab course. Had I known, Pirjo would have had a much harder time to convince me to give this course for the Doctoral Programme in Biomedicine (DPBM)l . Kari had warned me… The accompanying lecture course had been running from September to November. The practical course had been offered with 16 free slots, but that was totally unrealistic given that we were confined to my 23.7 square meters of lab space. Teaching lab space is available, but without equipment and all the other infrastructure that is needed for such an undertaking. 8 people registered to the practical course and - luckily - half of those pulled out in the last moment with insufficient possibility to commit to the heavy workload that the course required. Thus we ended up with four students and three projects. Under no circumstances would we have managed with more.The idea was to offer each participant the possibility to realize his own DNA cloning and protein expression project. Something that would be relevant for his own PhD studies. For that matter, I had meetings with the three groups one month in advance to plan the cloning and to order the necessary materials. We were working in parallel on the following three projects:

The car is in the garage

Tue, 30 Dec 2014 00:00:00 +0000

Finally Claudia’s car is in our heated garage. After moving two thirds of our cellar’s content and half of our apartment’s content to our garage, it appeared questionable whether a car would still fit. I installed many additional shelves and relocated my and Marzena’s bicycles to the condo’s common bicycle storage. The other 7 bicycles and the bicycle trailer were hanged to hooks along the garage walls. Then we lifted Tobias’ 3.5 meter long cardboard rocket tightly under the garage ceiling. Finally I was able to drive it in. I drove in sort of blindly because the car had been snowed in so badly that me and Tobias could not really make any difference by scratching its windscreens half an hour (we had to stop because our fingers were too cold to continue). The snow and the cold had arrived here in Helsinki quite exactly together with the winter solstice.

25 Years After

Fri, 14 Nov 2014 00:00:00 +0000

These are not all images that I took, some B/W portrait shots and other interesting negatives are still waiting to be scanned, but I just can’t seem to find to time…

Vor 25 (oder noch mehr) Jahren

Fri, 14 Nov 2014 00:00:00 +0000

Vermutlich haben alle, die sich dafür interessieren, schon die Fotos angeschaut. Trotzdem hier nochmal der Link zu den gescannten Diapositiven von unserem Segeltörn im IJsselmeer und dem Literaturkurs bei Frau Herzig: http://gallery.jeltsch.org/index.php/1989 . Einige Schwarzweiss-Portraits und andere interessante Negative warten noch darauf, wiederentdeckt zu werden…

Download SnapGene

Fri, 31 Oct 2014 00:00:00 +0000

You can get a registration code (which is valid until the end of 2014) from the course organizer.

38. Annual Congress of the German Society for Lymphology

Sun, 05 Oct 2014 00:00:00 +0000

I participated in the 38th Congress of the German Lymphological Society ( http://www.dglymph.de/ ) in Halle (Saale). The conference was very refreshing and interesting: It was very different from the meetings I typically attend because it was focussed on the practical aspects of clinical and ambulant management of diseases that involve the lymphatics. Because my talk was an introductory lecture about lymphangiogenesis research, it did not contain any unpublished data and hence I make it available for download. However, the slides are in German and - depending on the target audience - might require some commentary. The talk is a chronological account of the important publications in the field of lymphangiogenesis research starting from about 20 years ago; heavily biased towards my own work and work in which I have been participating.

New Mechanisms of Lymphangiogenesis and Lymphedema

Fri, 26 Sep 2014 00:00:00 +0000

Here is the presentation that I could not give, because my schedule was too tight to allow for a 1 hour 20 minute delay. If you have questions concerning the talk, please ask via e-mail: michael@jeltsch.org.My Lufthansa flight LH855 from Helsinki to Frankfurt got delayed by 1 hour 20 minutes. Because I had only 1 hour 15 minutes to change my plane in Frankfurt on my way to the 40th Congress of the European Society of Lymphology in Genova/Italy, I did not even board the plane and rather canceled my talk. Because I have another appointment on Saturday in Germany, I had planned the return flight for Friday early morning and hence could not move my talk either. Next time I’ll be smarter.

Practical Molecular Biology and Genetic Engineering

Mon, 08 Sep 2014 00:00:00 +0000

Collection of the presentation slides for the DPBM course Practical Molecular Biology and Genetic Engineering . There are files in (at least) two different formats for each lecture: PDF and ODP (Open Document Presentation). The ODP file is editable using LibreOffice software. If you want to open it with Microsoft Office, you need to convert it first using either LibreOffice or some online conversion tool (like cloudconvert ). All material is available under the creative commons license . I might add improved versions of the lecture slides later based on participants’ feedback. The slide about restriction enzymes (REs) and how to calculate the necessary RE amounts to digest a certain amount of DNA is in the file of Lecture 1.

Ubuntu is slowly getting unusable

Mon, 01 Sep 2014 00:00:00 +0000

The default Document Viewer in Ubuntu 14.04 is Evince. Recently it started to have problems with many PDF files that are opened by other PDF viewers (Okular, Acroread) without problems. Actually Evince opens them, but the window remains invisible. I tried to change the PDF viewer, but Ubuntu has apparently removed all means to do so in version 14.04 short of going into the command line and editing configuration files by hand: what a progress! In previous versions of the File Manager, it was possible to right-click a file and after selecting “Open with” > “Other Application” to choose “Set as default”. Now the only way to do so is to edit ~/.local/share/applications/mimeapps.list, replacing [Default Applications]application/pdf=evince.desktop with[Default Applications]application/pdf=kde4-okularApplication_pdf.desktop; I guess it is time to switch back to OpenSuSE…

It is finished

Sat, 30 Aug 2014 00:00:00 +0000

After one year of gathering pieces and building, Tobias and me finished today the Millennium Falcon Ultimate Collector’s Edition (LEGO set 10179, http://brickset.com/sets/10179-1/Ultimate-Collector-s-Millennium-Falcon) . This version of the Millennium Falcon is not sold anymore and used sets sell for insane prices on Ebay.We took the necessary bricks from two other Star Wars models: the Death Star (LEGO set 10188, http://brickset.com/sets/10188-1/Death-Star ) and the Super Star Destroyer (LEGO set 10221-1, http://brickset.com/sets/10221-1/Super-Star-Destroyer).However , we had to gather a substantial amount of missing parts, many of which we bought 2nd hand via the local Finnish online action site http://huuto.net or via BrickLink ( http://www.bricklink.com ), a sort of “specialised EBay” for LEGO pieces. The most difficult to find pieces were the two Light Bluish Gray Boat Mast Rigging Long 28 x 4 ( http://www.bricklink.com/search.asp?itemID=56261&colorID=86) , which sell at the moment for not less than 100€ per piece on BrickLink. We obviously did not get these pieces. However, LEGO still sells the black version of this piece as a spare part and Tobias’ mentor took the trouble to get these and paint them grey; thank you Clemens!

Fiddling around with CSL

Wed, 06 Aug 2014 00:00:00 +0000

When writing manuscripts and grant applications, you always and again have to update the bibliography. This is what reference management systems are for. There are many of them (see http://en.wikipedia.org/wiki/Comparison_of_reference_management_software) . I have been using mostly EndNote, Bibus or Zotero ( http://www.zotero.org ), which I am using also at the moment. It has the advantages to be truly cross-platform, open-source and compatible with both LibreOffice and Microsoft Office. In the past, I have also been using for a short while Papers (by Mekentosj, who claimed they NEVER would do a Windows version), Bookends, Mendeley, and RefWorks (which is licenced by my university). None of them is perfect and even the most commercialized of them (Endnote, now owned by Thomson Reuters) destroyed one of my (MS Word) manuscripts totally when it crashed. Some of these programs store the formatting instructions for inline citations and the bibliography in the so-called CSL (Citation Style Language, an XML-type language, http://en.wikipedia.org/wiki/Citation_Style_Language).However , I could not find an easy editor for CSL: the in-built one from Zotero is not great, neither is the online CSL editor ( http://editor.citationstyles.org/visualEditor).However , I needed a way to quickly export my own published papers to create a “List of Publications” for grant applications. Hence I created a group in Zotero and added all my own publications into this group. I now mark them all, right click and select “Create Bibliography from items”. In the pop-up dialog, I choose the style and mark the radio-buttons “Bibliography” and “Copy to Clipboard”). Back in my word processor I just have to paste the clipboard and I most of the work is done. However, I could not find any good style for this, so I created one myself (which is based on Vancouver). Feel free to use it…

From the molecular biological foundations to causal treatment options for diseases of the lymphatic system

Tue, 22 Jul 2014 00:00:00 +0000

PD Dr Michael Jeltsch, University of Helsinki, Finland

Research into the molecular basis of lymphangiogenesis in embryonic development and pathological processes has led to a rapid expansion of our knowledge (Krebs and Jeltsch 2013a, 2013b). The molecular biology era of lymphatic research began with the discovery of VEGF growth factors and their receptors 25 years ago. This review therefore focuses on these molecules.

Where did the Nautilus scripts folder go in Ubuntu 14.04?

Thu, 26 Jun 2014 00:00:00 +0000

After upgrading from Ubuntu 12.04 to 14.04, my Nautilus scripts stopped working. The reason: they are polled from a different location in 14.04. In 12.04, they used to be in ~/.gnome2/nautilus-scripts, but now they are in ~/.local/share/nautilus/scripts. I think the link above still has not been updated to reflect the new location.

The case against FastDigest®

Wed, 25 Jun 2014 00:00:00 +0000

Restriction enzymes continue to be important

In 2006, the innovative Lithuanian biotech company Fermentas launched a new product line for molecular biology researchers: the FastDigest restriction enzymes. Together with the polymerase chain reaction (PCR), restriction enzymes (REs) are arguably the most important tools in molecular biology. They made recombinant DNA technology possible in the early 1970s. Until every lab can afford a reliable DNA laser printer (which is probably still a decade away), restriction enzymes are the tools of the trade. Novel cloning techniques (like In-Fusion , Gibson Assembly or SLICE ) have their place, but still lack the robustness of traditional restriction enzyme cloning.

Stuff the Maverick upgrade broke

Tue, 24 Jun 2014 00:00:00 +0000

My 1.5 year old MacbookPro was starting to behave badly including failure to complete booting and other niceties. The computer support guy suggested to upgrade from Mountain Lion to Maverick to see whether it would fix things.Initially that seemed to work; however, many programs refuse to run under Maverick. This includes: Gnumeric and (importantly) nfs. It appears that mounting nfs via the finder is not anymore possible. However, I still am able to do it via the command line (using the resvport option, which should not be necessary, but which nevertheless does the trick):sudo mount -o resvport -t nfs mcblserver:/var/www /Users/mjeltsch/nfs And talking about Gnumeric: I guess I need to compile it newly for Maverick myself…

Poster printing without an A0 printer

Thu, 15 May 2014 00:00:00 +0000

I failed to prepare my poster for the GRC conference on Molecular Mechanisms in Lymphatic Function & Disease in time. The A0 printer from UNIGRAFIA is not available on weekends. Hence the best I could do is to print it out on A3 and stitch it together. A definite advantage is that I do not have to run around with these ridiculously large poster tubes, that identify you as a Science nerd from half a mile distance.Unfortunately, the only application that can decently split a DIN A0 PDF into separate pages on the fly while printing is the full version of Acrobat. I tried out other options: pdfposter did a fairly good job, but it did not manage with the background: pdfposter -mA3 -pA0 input.pdf output.pdf Pdfposter also doesn’t create overlaps. A solution, that always should work is to convert the PDF into an image (convert -density 150 input.pdf output.png) and then use PosteRazor to create individual PDF files from that image. However, conversion of a A0 pdf into a high res image can last hours. Use a .png file! PosteRazor refused to work on a 60 MB TIF file. The background gradient conversion results in visible colour steps. In order to avoid that, you would have to define the background gradient as an image rather than a vector element. Otherwise PosteRazor worked well; unlike in pdfposter you can define overlaps for the assembly.I have been using Inkscape to prepare my poster and usually I export it from there as a PDF file. This did not work this time because the program consistently crashed during the export. Hence I tried to save it as an encapsulated postscript file and to distil it into a PDF. When exporting from Inkscape (actually it is “Save as”), I selected the following options:Postscript level 3Rasterize filter effects: yesResolution for rasterisation: something between 150 to 300Export area is page: yesAfter distilling it, I printed it from Acrobat Pro with the following options: Page setup: DIN A3, portrait orientationPage scaling: Tile large pagesAt a tile scale of 95% and an overlap of 10mm I got 9 pages (3x3), which is still OK for assembly.

Getting Ubuntu Trusty Tahr onto the CuBox Pro

Wed, 14 May 2014 00:00:00 +0000

eUPDATE: The Cubox guys have moved the documentation about how to install to the Cubox Pro. If you need Trusty Tahr for your Cubox Pro, you can download a 4GB image: https://drive.google.com/open?id=1CgbSfy17-UrWZwBjZtZpHYTkPgw0MXFq . You just need to write it to an SD card (using dd) in order to get your system going. If you have a larger SD card, never mind: just dd the image to the SD card and then use gparted or something similar to expand the second partiton (the root partition) to fill the entire SD card. Password/login: cuboxpro/cuboxpro. SSH is enabled, so you should be able to login remotely. It’s the desktop version, so you can also connect an HDMI cable and login via the GUI. There is still a youtube video ( https://www.youtube.com/watch?v=XfLJAchNu2c ) on how to use the original cubox installer ( http://download.solid-run.com/pub/solidrun/cubox/installer/) , but the latest version of Ubuntu that you can install with that method seems to be 13.10 at the moment of this writing. I have been buying a CuBox : perhaps the world’s smallest desktop computer. Both at work and at home I need to replace an old, loud LAMP server with something modern. I don’t even need a GUI, I am happy to run the server headless. Neither do I need much much speed.The CuBox seems like a great idea: No noise, little power consumption, no space requirements and a decent performance. However, getting it to work was far from trivial. It is definitely not an end user toy, but aimed at the tinckerer. The first difficulty was buying the box. The producer didn’t sell it directly at the time (now they do) and the only company that sold it to Finland was UK-based NewIT . Because on the producers homepage they only present their newest models (the “CuBox-i” models), I wasn’t even aware of how many different models they had released. I actually bought the CuBox Pro (but I didn’t know about it, because there is also the “CuBox-i4Pro”, which is the one I rather should have bought. Israel-based SolidRun could do definitely a better job with their web pages. They seem to have a rapid product cycle and drop quickly all links to their “older” products from their main page. This is irresponsible especially since these products are still sold.I bought the device shortly before Ubuntu 14.04 LTS (Trusty Tahr) was released with the intention to install the server version on this device. I bought it with the 4GB SD card with the preinstalled ancient Ubuntu 10.04 (Oneiric Ozelot). I connected it via HDMI to our (not full HD) TV screen and at least the first boot succeeded and the desktop appeared usable, although not snappy. But what the heck, I want to use it as a sever.So the first thing I tried to do was to upgrade to 14.04. I was sure that this would work because the community is stepping in where CuBox fails. Namely by providing ready-to-go disk images to flash to the SD card. I tried Arch Linux, Debian and an early Ubuntu 14.04 release. However, when I inserted the SD card after flashing, the CuBox did not want to boot.Because the Oneiric image (which came on the 4GB card with the device) worked, I flashed it back from a backup (which I had made using dd). Again, Oneric booted up fine. I started to upgrade the distribution to 12.04, which worked somehow, but I lost the graphics display (which I didn’t care about). But then the upgrade from 12.04 to 14.04 failed completely. And I definitely want the 14.04, because I want to set it up and forget about it for the next 5 years.However, none of the images provided (by CuBox or the community) wanted to boot (I don’t even want a GUI, I am fine with a command line access as I want to use it as a server). I have tried flashing them from Windows and Linux, but it didn’t make a difference. What could the reason have been? The partitions on the card are mounted automatically without error when I insert the card to my Ubuntu 14.04 laptop. I finally googled the Model number “CBP-300-P” which is printed on a sticker on the bottom of the cube. I had started to suspect that it is not me, but some incompatibility or broken hardware. I came across this irc conversation and I realised that I had been pulling the OS images from the CuBox-i wiki pages, whereas my model was a CuBox Pro.The relevant forum is here and the instructions do work. The instructions are not for the faint of heart, but also not overly difficult. You need a HDMI connection to a full HD screen (1920x1080). If you have less than that, you need to connect to the serial console using a mini-USB cable from another computer and use a terminal emulator as they explain here . The suggested Putty did refuse to make a connection to ttyS0 (from Ubuntu 14.04), but I managed with minicom. However, there was no color coding, but it worked also without.Because you are running the whole OS from the SD card, you might want to limit memory swapping and do a few other changes to prolong the life of the memory card, essentially the same as is done for SSD drives .

1 hour 53 minutes 6 seconds

Tue, 13 May 2014 00:00:00 +0000

21.0975 kilometres in 1 hour 53 minutes and 6 seconds, 3011th of 12120 runners in my age group, almost 5 minutes faster than last year: Helsinki City Run 2014 .

We got featured by Circulation!

Mon, 12 May 2014 00:00:00 +0000

The molecular basis of Hennekam syndrome

Thu, 20 Feb 2014 00:00:00 +0000

Finally our CCBE1 manuscript is out! You can access it from the Circulation’s homepage . If your library does not have a subscription, just drop me an e-mail . It nicely complements the article by Le Guen et al. from Ben Hogan’s group in Development. While Le Guen and colleagues analyzed the interaction of CCBE1 with the VEGF-C/VEGFR-3 pathway mainly at the genetic level in zebrafish, we tried to describe the molecular details of the interaction using in vitro assays which we complement with in vivo mouse data. We describe that the primary lymphangiogenic factor VEGF-C is produced as an inactive precursor (pro-VEGF-C). Pro-VEGF-C (that is the 29/31-kDa-form) does bind to VEGFR-3 on endothelial cells, but is unable to activate it. Until now, the common wisdom was that pro-VEGF-C is only a less potent activator of VEGFR-3 than mature VEGF-C. In fact, it actually acts as a competitive inhibitor of mature VEGF-C. The task of CCBE1 is to assist the ADAMTS3 protease in cleaving cell-surface bound pro-VEGF-C and thus to localize the concentration of active VEGF-C. In hereditary diseases that are caused by mutations in CCBE1 ( Hennekam syndrome ), this activation of VEGF-C is impaired and causes lymphedema. Because of the importance of lymphatic vessels in many diseases, CCBE1 and ADAMTS3 are interesting drug targets. In cancer, for example, it would be a tremendous benefit if one could prevent the activation of VEGF-C and thus prevent VEGF-C-mediated metastasis.

SVS or lymphatic system?

Sun, 26 Jan 2014 00:00:00 +0000

In 2003, I wrote a review article about the lymphatic system , in which I briefly discuss the general setup of the lymphatics in different animals and I got the part about the lymphatic system in fishes wrong. Or at the very least it was incomplete.While mammals, birds, reptiles and amphibia are quite easily defined animal classes, there is no animal class “fishes”. Different ways exist to classify “fishes”, but at least three animal classes are needed to accommodate the living “fishes”: cartilaginous fishes, ray-finned bony fishes and lobe-finned fishes. Almost all research on the lymphatic system of fishes had been done on teleost fishes (one of three infraclasses of the ray-finned bony fishes). Teleostei comprise most of the living fishes including the mostly studied zebrafish (Danio rerio) . So everything that follows is about this infraclass (and hence might not apply to sharks and sturgeons to name just two non-teleost fishes).

Historic articles about the lymphatic system

Sat, 25 Jan 2014 00:00:00 +0000

Permission to self-archive

Tue, 21 Jan 2014 00:00:00 +0000

Thanks to Jörg Wilting , I finally received permission from the Deutsche Gesellschaft für Lymphologie (German Society for Lymphology ) to self-archive two review articles that I have been writing last year for the journal Lymphologie in Forschung ind Praxis . This is important, because otherwise, the impact sphere of the review would have been very limited. The first article discusses the molecular main players of lymphangiogenesis: VEGF-C and VEGF-D and their functions in embryonic lymphangiogenesis. The second article tries to summarize the roles that VEGF-C and VEGF-D play in diseases that are affecting the lymphatic system.

Mounting individual partitions from disk dumps

Thu, 26 Dec 2013 00:00:00 +0000

You can make disk dumps from individual partitions or from a hard drive that contains more than one partition. The ladder has the advantage that you can restore the computer by dumping back the image onto the same or another hard drive. But if you want to access an individual partition from a hard drive image, you need to know where the partition boundaries are. You can note them down from the output of fdisk. However, fdisk -l gives the partition boundaries, but the unit is sectors. You need to multiply this number by the logical sector size to get the partition boundaries in bytes.Alternatively you can use parted (after invoking parted, execute commands unit, B, print in that order) to display the partition boundaries in byte. parted can be also used on a disk dump, e.g. parted /home/backups/diskdump.img to determine the partition boundaries.jeltsch@Michael:~$ sudo parted /home/backup/diskdump.img GNU Parted 2.3Using /home/backup/diskdump.imgWelcome to GNU Parted! Type 'help' to view a list of commands.(parted) unit Unit? [compact]? B (parted) print Model: (file)Disk /home/backup/diskdump.img: 160041885696BSector size (logical/physical): 512B/512BPartition Table: msdosNumber Start End Size Type File system Flags 1 1048576B 524287999B 523239424B primary ntfs boot 2 524288000B 80282124287B 79757836288B primary ntfs 3 80283171840B 160041009151B 79757837312B extended 5 80283172864B 122626684415B 42343511552B logical ext4 7 122626768896B 157924769279B 35298000384B logical ext4 6 157932322816B 160041009151B 2108686336B logical linux-swap(v1)(parted)Then you just mount the image as a loop device with the additional parameter offset using the start boundary of the partition you want to mount:sudo mount -o loop,ro,offset=524288000 /home/backup/diskdump.img /mnt

Being the boss

Fri, 01 Nov 2013 00:00:00 +0000

Almost accidentally, I got promoted. I am now a principal investigator or group leader. I never have been especially keen on being the boss. There are enough cushy and mediocre PIs in this world and my (now former) boss Kari Alitalo with his level of devotion and excellence is a shadow probably impossible to step out of.Nevertheless, before I was too old to apply for a group leader position from the Academy of Finland , I decided in 2011 to give it a try. I might regret if I never even tried. The first attempt failed. One year later, my PhD was 9+ years old and I had to pledge special reasons to be able to compete again (I had taken long childcare time-outs for both of our children). Although I essentially submitted the same application I got lucky this time in what has been described by someone as the “Academy Lottery”.And my worst expectations became reality: Instead of doing research I mutated into a money acquisition machine. That is partly due to the Academy giving substantially less funding than I applied for. Every year the Academy has less and less money to distribute and faces the tough decision to fund fewer researchers or to fund the same number of researchers, but give everybody less… I once had an email conversation with Alexander Stubb (when he was still approachable for ordinary people like me) about the declining budget for research, but at least the present Finnish government seems to underestimate the long term effects of the continuously deteriorating financial situation of academic research in Finland. The situation is so bad, that most talented people are leaving this country at the first opportunity.Due to the full cost model , I am practically forced to stick to the budget when it comes to the labour cost. And that’s why there’s no money left to pay for the day-to-day expenses like chemicals and reagents. Until one of my grant applications is successful, we’ll have to do research on a shoestring budget…BTW: My lab’s new web pages hosted by the university’s servers are still not up. But since they’re ready, I put them up on my own server .

Stripping

Fri, 01 Nov 2013 00:00:00 +0000

Reprobing membranes with with a different antibody is a very common task in the lab. Various protocols exist to strip membranes and the classic method is the one that uses SDS, β-mercaptoethanol and heating. I used to do it that way, but it’s a smelly business, because β-mercaptoethanol smells like rotten eggs. Then suddenly everybody in the lab started to use the Re-Blot Plus Solution from Millipore and so did I. Until I realized by chicking the Material Safety Data Sheet that they sell cheap chemicals for a premium price. Now I make the stripping buffer myself. My 10x solution has the following composition:

A Nobel Prize for angiogenesis research?

Sun, 27 Oct 2013 00:00:00 +0000

In 2008, during a dinner in Stockholm (when I participated in the Novo Nordisk Foundation 8th Annual Conference on Vascular Biology in Diabetes Complications) I proposed to Christer Betsholtz to award the Nobel Prize to the world-wide community of postdocs, which are the unsung heroes of today’s research. But the Statutes of the Nobel Foundation forbid to award the price to more than three people. However, statutes can be changed and the Nobel Foundation did exactly that 40 years ago when they stopped awarding the price to dead people. And in this changing world, less and less discoveries and inventions are made by individuals. But here’s my newest proposal, which adheres to the rule of maximally three: Kari Alitalo is probably the only Nobel Prize worthy researcher in the country where I work (Finland). Seriously: after Judah Folkman has passed away, there are not many options to award the prize to somebody from the angiogenesis field. Judah Folkman was the father of the hypothesis, that all tumors should be treatable by anti-angiogenesis ( Folkman J. Tumor Angiogenesis: Therapeutic Implications. New England Journal of Medicine. 1971;285(21):1182–6 ). The Nobel Prize committee missed that chance. And because the field has already significantly contributed to the treatment of cancer (and arguably will still contribute much), it is not so far off to think of a shared prize for the discoverers of the VEGFs. VEGF was discovered more or less independently by several research groups around 25 years ago, among them Napoleone Ferrara ’s and Harold Dvorak ’s. Most notably, Ferrara’s group at Genentech continued the research most successfully until today resulting in the first antiangiogenic cancer drug in 2004. While the discovery of VEGF and the resulting angiogenesis research was not dependent on any single lab, the lymphangiogenesis field was essentially single-handedly re-invented and brought into the molecular era by Kari Alitalo in the years following 1995 - after it had become senile and was lingering without any significant progress since the 1960s. A shared prize to Ferrara, Dvorak and Alitalo? There is an anti-VEGF-A cancer drug on the market and the only thing lacking is a successful anti- or pro-VEGF-C drug. Both are in clinical trials as of this writing ( anti-VEGF-C , pro-VEGF-C ).

Self Archiving and Open Access

Sun, 07 Jul 2013 00:00:00 +0000

I recently wrote a review article for the journal Lymphologie in Forschung ind Praxis . Its title was “Die lymphangiogenen Wachstumsfaktoren VEGF-C und VEGF-D” and it was the first paper I wrote in my mother tongue, German. This journal’s impact factor has been consistently below 1, which is not uncommon for non-English journals. However, in the big European countries like Germany, France and Italy, there are still many doctors who are not comfortable reading English. I though I’d help them out catching up on the latest in lymphatic research. Opening up access to science and visibility of science is all good, so I thought.Because my boss argued that it was a waste of time (I hope to prove him wrong - help me out here DLG !), I minimized the effort by engaging another knowledgeable German researcher at the University of Helsinki. Luckily I had already a draft when I was asked to write the review, even though I started to write it about two years ago and it was targeted for my website. When the article was published I received two physical reprints. When I tried linking to the online version of the article, I had to realize that it was behind a paywall . Because most publishers nowadays support self archiving , I asked the publisher about their policy. I presume that the publisher did not have any policy in place concerning self archiving, because they said they would agree to it, but I would have to get the green light from the board of directors of the DLG .I really hope to get this permission because this is the only way I can fulfill reprint request without hassle (yes I could copy the pages and send them by post (but aren’t we living in the 21st century?). If I won’t get the permission, one legal and easy way to distribute this article would be to put a pre-print version (i.e. the manuscript that I wrote) online. Luckily the copyrights of the publisher cover only the published version and not the pre-print versions. Others have done it this way (and they attached a list of the changes, that were made to make the pre-print version identical to the published version). This is a suboptimal solution, but maximizing accessibility and visibility. My University has a loose requirement to publish only in Open Access journals. However, exceptions to this policy of the University of Helsinki concerning Open Access are made on a regular basis, but they will get more and more difficult as the EU tightens their funding policy including the requirements for Open Access to research results . According to the EU’s interpretation, a journal could be considered Open Access if it allows for self archiving of the published article, self archiving being the second, “green” route to Open Access. The Academy of Finland (my main funding source) has a similar interpretation: “We further recommend that Academy-funded researchers publish their articles in open-access scientific journals, if there are online journals in the field in question that are at least of the same high quality as traditional subscription journals. The articles can also be saved in open-access electronic archives.” For employees of Helsinki University, self archiving is mandatory since 2010 .That makes sense to me: As a scientist I work with tax payers’ money; therefore all tax payers should have access to the results of my work. Even though I worked for this review only in my spare time, technically the requirements still apply as I used a computer, that was paid with tax payers’ money… Stay tuned and if you need the article now (and don’t want to wait for the DLG to decide), please e-mail me!

Prisma Viikki and customer's rights revisited

Wed, 03 Jul 2013 00:00:00 +0000

I bought a lamp from Prisma for 24,95€. Because it was named “plafondi”, I assumed it is a ceiling lamp: “plafond” is French for ceiling. But I was wrong. It was not for attachment to the ceiling, but for wall-mounting (strangely on Prisma’s website it is called “Plafondi-seinävalaisin” which is an oxymoron). I realised that when I saw that the plug was of the regular type and not for a ceiling socket. So I exchanged the plug and attached it to the ceiling. When I screwed in the bulb and turned the light switch, it remained dark. I had bought the bulb (Megaman Liliput 11W E14 thread) together with the lamp from Prisma. I was even more perplexed when another E14 bulb worked perfectly in that lamp.

The old LEGO motors are still going strong

Mon, 24 Jun 2013 00:00:00 +0000

While the LEGO motors of my childhood are still going strong, the motor from the set 8287 broke barely three years after I bought it. Actually the motor is OK, but the battery box or the switch has a slack joint somewhere inside. And what is worse: I cannot get a spare part! I hope LEGO is not following the trend producing throw-away toys. The motors from my childhood (which you can see in the background) are nearly 40 years old. This proves that one can build durable toy motors.

Cyclical PhD production

Tue, 11 Jun 2013 00:00:00 +0000

I was wondering why recently nobody graduated with a PhD from our lab. My first (and wrong) conclusion was, that our lab is not as productive anymore as it used to be. When I looked at the data carefully I discovered an interesting phenomenon: The PhD production rate in our lab follows a 5-6 year cycle. And lo and behold: The cycle is about to peak again in 2013/2014, which is exactly what I expect to happen as many of our PhD students are about to finnish this or next year. I wonder whether this is specific for Kari Alitalo’s lab or whether this a general phenomenon. In any case I am looking forward to all those parties (“karonkka”) that lie ahead.The figure above shows the number of PhDs received any given year that were supervised by Kari Alitalo averaged over a window of one or three years. Shared supervision was counted as 0.5.

Screw cap of Elmex mouth wash always breaks

Sun, 09 Jun 2013 00:00:00 +0000

This is my third bottle of Elmex mouth wash. The screw cap of every single bottle broke, there must be a design flaw!

Academic Portfolio 2013

Mon, 27 May 2013 00:00:00 +0000

Below my updated Academic Portfolio in PDF format. Since it is public, I had to black out confidential information concerning ongoing confidential collaborations and my research plans.

A view to the Baltic sea

Sun, 05 May 2013 00:00:00 +0000

Just to prove that one can see the Baltic sea from our living room’s window.

Reset MacOSX user passwords

Sun, 28 Apr 2013 00:00:00 +0000

Boot up with command key and S key pressed (Single user mode)
fsck -fy
mount -uw /
password username

Waffel recipe

Fri, 19 Apr 2013 00:00:00 +0000

After some awful experience with an OBH Nordica electric waffle maker (one waffle took about 12 minutes and still was not entirely done), I have bought a cast-iron waffel maker from Skeppshult. After burning it in and several unsuccesfull attempts, I actually manged to make some waffles. However, I have not yet tried to use it over an open fire, but that was actually the idea when I bought it. I used it on our electric oven and one waffle takes about 4 minutes (on position 7-8 out of 9). It has 25 years of warranty and weighs about 4-5 kg. I used the following recipe:

Updating drupal

Tue, 19 Feb 2013 00:00:00 +0000

Here’s what I need to to to update drupal (minor updates, e.g. from 7.18 to 7.19) on my Ubuntu server. I have installed drupal from the drupal source itself and not from the Ubuntu repository (because the Ubuntu repository is usually quite old and not updated as frequently). Actually the update is quite painless; I am sure somebody automated that already somewhere…cd /var/wwwsuwget http://ftp.drupal.org/files/projects/drupal-7.19.tar.gztar -xvzf drupal-7.19.tar.gz chown -R jeltsch:www-data drupal-7.19rm drupal-7.19.tar.gz cp -a drupal-7.18/sites/ drupal-7.19/The above cp command makes a copy of the complete site, which can take a long time and use lots of disk space. Instead, you can delete the “sites” subdirectory in the new drupal folder and make a link to the old “sites” subdirectory:cd drupal-7.19rm -rf sitesln -s ../drupal-sites/ sitesHere you should log into your site and put it into maintenance mode! mysqldump -u root -p --databases drupal7_jeltsch_org drupal7_claudia_jeltsch_org drupal7_lammertlab_org > drupal7_all.sqlrm drupal7ln -s drupal-7.19/ drupal7Here you should click the link to the update script. After the updates were successfully performed you can put your site online again.** ****Drupal 9**Updating Drupal 9 is most easily done using composer:composer update "drupal/core-*" --with-all-dependenciesAlso the modules can be updated. However, in my case the update was not always targeting the module that was actually in use but a module that was lower in the priority list in some other directory. For minor version updates:composer update drupal/modulename --with-dependenciesFor major version updates:composer require drupal/modulename:^2.0After this, don’t forget to visit https://yoursite.com/update.php !

x11vnc as a nxserver replacement

Thu, 29 Nov 2012 00:00:00 +0000

Now that nomachine ’s great nxclient is defunct on MacOS X and its new nxplayer is still in beta (and completely nonfunctional on my setup), I needed another solution to connect to my work desktop from home. I tried many things, but then settled for x11vnc . My work desktop is running Ubuntu Precise Pangolin (12.04) and I connect from a MacOS X 10.8 (Mountain Lion). I only had to install x11vnc and openssh-server on my work desktop and add an x11vnc.conf file to /etc/init with the following content:x11vnc -forever -rfbauth /etc/x11vnc.pass -bg -o /var/log/x11vnc.log -scale 1280x800 -display :0 -auth /var/run/lightdm/root/:0I have to create the password file:x11vnc -storepasswd password /etc/x11vnc.passThen I just have to get into my work desktop by some means or another. At the moment I jump there via the UNIX computers of the university, because direct ssh access is not possible because of a firewall. So I ssh into the UNIX mainframe and from there I ssh into my work computer. Once I am in, I establish a reverse ssh tunnel to my Macbook Pro at home:ssh -R 19999:localhost:5900 IP_address_of_homecomputerOn my Macbook at home I had to enable Sharing - Remote login first. Then I just use the inbuilt Screen sharing of the OS “Connect to server” and then I type “vnc://localhost:19999” and voila I can see my work desktop’s login screen.Alternatively I could use my openvpn server that I have installed on my Macbook and use an openvpn client on my work desktop to establish a connection to my Macbook. Then I could directly log in and avoid the hops via the university UNIX machines to set up the reverse ssh tunnel.Another, although very slow method to access the GUI of my work desktop is X11 forwarding via ssh. All I need is a working ssh connection to the server, X11 forwarding enabled in the ssh server configuration file and an X11 server on the local machine (e.g. XQuarz on MacOSX):ssh -X username@remote-server.comxclock &

Upgrading mysql on Ubuntu Lucid Lynx (10.04) hangs

Wed, 28 Nov 2012 00:00:00 +0000

Already the third time this happens to me: An update is available for the mysql server and I just “apt-get upgrade”. The upgrade process gets totally stuck at the following task:Preparing to replace mysql-server-5.1 5.1.66-0ubuntu0.10.04.1 (using …/mysql-server-5.1_5.1.66-0ubuntu0.10.04.2_i386.deb) …mysql stop/waitingThe process that got again stuck in some eternal loop (or whatever) is an egrep replacement of some textfile:egrep -qi -r ^[^#]*ndb.connectstring|^[:space:]*\[[:space:]*ndb_mgmd /etc/mysql/I just killed that process and the upgrade resumes as nothing would have happened.

Online food shopping in Helsinki

Wed, 14 Nov 2012 00:00:00 +0000

If we want to replace our Saturday’s general food shopping trip with online ordering, there seem to be only two major options in Helsinki ruoka.net and Alepa kauppakassi . We had been using ruoka.net before, but we stopped, because their online store was very user-unfriendly and the prices quite high. But maybe we should have another look, because Alepa kauppkassi’s quality of service has deteriorated during the last few months.We have been ordering our food via Alepa kauppakassi already for more than a year, but now that I have broken my leg this service is essential for us. Unfortunately, it has never been working without problems. E.g. when they delivered a week ago, they forgot completely to deliver all the frozen foods that we had ordered. They had forgotten the frozen food already once before, but back then, it was promptly delivered at the next possible time. Not so this time: It took them one week to deliver the rest. And we had to complain multiple times before anything happened. And what was the compensation? One lousy free delivery (worth 6.9€). But today, things got even worse:Let me please reliably know if the delivery will be lateYesterday, my wife placed an order for about 150€ and the delivery was supposed to happen today between 9-12 am. However, until 1:30 pm nobody had been ringing the door bell and I skyped my wife whether she had received any SMS or phone call. She had received an SMS at 8:30 am that the goods had been gathered and were awaiting delivery. Later she had received a call attempt from an unknown number while she was talking on the phone with her doctor. Later it appeared that this had probably been the delivery driver trying to announce that he would be late. However, what should my wife have done? Call back an unknown number? This is one of the things that went wrong. The driver should have sent an SMS message or called again.**Stuck in traffic in Helsinki? - Give me a break!**When I called the customer service at 1:30 pm, they promised they would figure out why the delivery is late and call me back asap, what they did. They said that the delivery was delayed due to the traffic situation and that he will be delivering in about 15-20 minutes. In fact, at 13:50 the food was delivered. Some stuff was temporarily finished and therefore missing from the delivery, but more importantly, all frozen foods had already melted. No surprise, as they were simply delivered in a plastic bag. From 8:30 am to 1:50 pm is 5 hours and 20 minutes - long enough for pizza to melt completely.Traffic jams on Wednesday between 9 and 12 am in Helsinki? You must be kidding! You can pull this argument in New York or London, but in Helsinki? The driver told me that the delivery started only at 11:30 am… Apparently there was simply nobody available to start the delivery in time.**Don’t sell stuff you don’t have!**It is difficult to understand, why an online store would list food items that it cannot deliver. For example we have ordered already 5 or 6 six times frozen strawberries (including this order), but every single time the berries were not delivered due to “temporary shortage”. Such a situation is called “permanent shortage”. It is bad practise to list food items in the online store that the shop is never able to deliver. It makes frustrated customers.Some tips against the melting of frozen goodsNow for the melted foods: This is dangerous and avoidable. It can be avoided by not delivering too late (or by not gathering too early). If this overstrains the logistic capabilities, there is still another option: a styrofoam box and a few cooling elements. I was talking to the driver and he told me that he started delivery at 11:30 am, which was 3 hours after the food had been gathered. Why that late? According to the driver they are permanently understaffed.Customer serviceAlready during the first phone conversation I clearly indicated that my patience was already very stretched and that I did expect a decent apology and compensation. I received a phone call a bit later by Janina Henttilä (I hope I spelled her name correctly), asking me whether they can replace the frozen foods with a new delivery today in the evening between 7 and 9 pm. Yes, that would be ok. However, again a bit later, I got another call, telling me that they have run out of one of the pizzas that I have ordered and whether I want partial delivery today and the rest tomorrow or rather everything at once tomorrow. Tomorrow everything at once would be ok. Again a bit later, I got another call - they don’t have that pizza at all and whether I want a similar type. No, I don’t want replacements done by other people for me and we always check the box “don’t replace products by similar ones when the exact product is temporarily not available”. Bad things can happen: a Dr. Oetger pizza might get replaced by a Saarioinen pizza . That might be OK for some people but not for me. So I asked them to call back later, when I had the possibility to check from the computer what replacement options they offered. We also were promised some unspecified compensation for all the trouble. I was also asking for some names higher in the hierarchy to complain to, because I am very well aware, that the problems must be structural and not only due to somebody not doing his or her job. I got two names and two phone numbers which I will call once this online food shopping adventure is over.P.S.: The replacement delivery was scheduled the next day between 9 and 12 am and it really happened. The “compensation” (a 20€ gift card for any shop of the S group ) arrived timely 2 days later.P.P.S.: I did the next online shopping exactly one week later. This time delivery was in time (sheduled between 9 and 12 am, delivered at 10:30 pm). Almost everything was ok except from the bill which overcharged us by 61 cents: They billed one 250g frozen strawberry bag (2.3€) instead of one 200g raspberry bag (1.69€). I really didn’t feel like complaining again. It just shows how hard it is for them to get it right…

One firewall to block them all

Tue, 06 Nov 2012 00:00:00 +0000

Helsinki University’s firewall prevents employees from workingWhile I was lying in hospital with a broken calf-bone I couldn’t get any work done because of the Helsinki University’s firewall. Even if the Android OpenVPN client would have allowed me in, I wouldn’t have been able to work. The purpose of a VPN is to allow remote clients the same access to the LAN resources as those machines, that are physically located in the LAN. Obviously Helsinki University doesn’t think so and doesn’t give VPN clients equal privileges. In my case it meant that I cannot ssh into my work computer. This makes remote work expensive, because it required my boss to buy a laptop for me just because the firewall between HY-VPN clients and local machines blocks ssh connections. Without this restriction I could do all the work from my 400€ tablet using e.g. nomachine Player).The work-arounds failed alsoIf I had managed to login into one of the University’s UNIX servers (myntti, kruuna, klaava or ruuvi), I could have logged into my work computer from there. However, my Android ssh client ConnectBot was not able to ssh into them. I presume this to be the fault of my mobile phone network provider Tele Finland , because I couldn’t log into my own ssh servers either (which I normally can, when my Android is connected via WLAN). Once I can connect via ssh to my work computer, I can establish a reverse ssh tunnel and use X Windows or the NoMachine Player to do all the work I usually can when sitting in the laboratory in front of my work computerPlex and no end of video playback troubleHowever, I couldn’t get the OpenVPN configuration right on Android and neither could the helpdesk support to this date. So I was totally bored in the hospital and since we use Plex at home as our media center, I decided to watch some movies. However, Plex is still after four years development in beta and we had our fair share of trouble with media playback. Also this time: I couldn’t play back a single movie or a single song using the Android client . It made the connection to our (Ubuntu 10.04) plexmediaserver without problems, but the only thing that worked was the “Photos” section. By trial and error, I found out that a part of the problem was, that the videos were in Apple’s QuickTime format (they had been encoded on a Mac). So I was looking for a way to batch-convert hundreds of files from .mov into .avi. Certainly this would be faster than filing a bug report and waiting that the Plex guys fix the problem. QuickTime is anyway dead, isn’t it? ffmpeg was certainly the way to go, but Google flooded me with hits concerning batch conversion and the problem was finding the one that works. There is unfortunately lots of crap and noise on the web. The following one-liner did work:find . -name '*.mov' -exec sh -c 'ffmpeg -i "$0" -sameq "${0%%.mov}.avi"' {} \;

What a bummer!

Sat, 03 Nov 2012 00:00:00 +0000

I broke my distal calf-bone (fibula) in a bicycle accident. The street must have still been icy in the afternoon or maybe it was the wet leaves. It happened on the way home, so it is technically a work accident according to Finnish law. Nevertheless, it allowed me another peek into the local public health care system. I just was discharged today from Töölö hospital after spending there four nights in a mixed 6-bed room.Surprisingly little painAs long as keep my leg up, the pain is so profoundly absent that I skipped the last day’s pain medication completely after consulting with the doctor. I wanted to feel at least a little bit of pain. How else was I to know, that I should go easy on my leg?Keeping healthcare costs downThe first night I was in a two bed-room together with a bothersoom roommate, who didn’t even stop talking after I had clearly communicated that I wanted to sleep; that was around midnight. Then he repeatedly verbally attacked the nurses and later barricaded himself in the toilet. When the security guards came to resolve the situation I was first hurried out of the room to the corridor and later into the 6-bed room. It goes without saying that I didn’t sleep much. This is how Finland keeps its health care costs down: The facility is overcrowded and the nurses overworked. I was actually suprised how well they managed considering the circumstances and patients like my room mate. They were always very friendly and helpful.SurgeryMaybe and hopefully the health care cost savings have not yet reached the expertise of the personnel. I don’t mind sleeping in a 6-bed room for four nights as long as the surgery is performed according to the standard of care. Surgery was necessary, because although the fracture was not displaced, it was sufficiently angulated to result in suboptimal healing when treated without operation (just by casting). The surgery was not performed under general, but instead spinal anaesthesia. The surgery went well, but healing will take its time, but so far everything is looking good. I got 6 weeks of sickness leave. Hospital foodThe hospital food confirmed to its reputation: I had so profound constipation on day four, that I thought my hemorrhoids would burst and the sutures rip when I was trying to pop out my poo. The fresh veggies and fruits were mostly a few thin alibi slices of cucumber or tomato. No wonder there was too little fibre. **The biggest loosers: Helsinki University Helpdesk and Tele Finland **The biggest letdown during the hospital stay was Helsinki University computing helpdesk and my mobile phone provider Tele Finland: I had several experiments going on in the lab and in order to give instructions how to proceed I needed to connect to my desktop computer at work via ssh (and nomachine via ssh). I did not manage to get the VPN working form Android. The detailed instruction link on the University help page was (as usual) broken. But even if it wasn’t, I guess nobody bothered so far putting up instructions for an OS, that has as little installations as 500+ Million worldwide.Helsinki University uses OpenVPN and there is an official OpenVPN client for Android . However, when I mailed the helpdesk, they didn’t even read my mail. They said I could get to my files via the VPN web interface. This is of course only true if one uses the networked folder on a Windows machine to store ones files. My second e-mail, where I clearly point out again, that I need ssh access to my desktop computer from Android is unanswered to this date.In order to circumvent this problem, I tried tethering using my Android phone (Samsung Galaxy S3) and my Lenovo convertible S10-3t (dual-boot Windows 7 and Ubuntu 12.04). And tethering didn’t work. I contacted Tele Finland to ask whether this is due to policy or whether there is just a bug somewhere. No answer until this date. So I presume its policy. Tethering has been working beautifully with my old HTC Desire (using CyanogenMod 7.1 ) and Saunalahti . I tried to update my Galaxy S3 from 4.04 to 4.1, but this process requires an online Windows machine (which I couldn’t get because thethering didn’t work).

Washing off the dirt from the dirty dozen

Sun, 09 Sep 2012 00:00:00 +0000

There has been much talk about the dirty dozen , a list of the 12 fruits and vegetables most contaminated with pesticides, that was assembled by the Environmental Working Group . Although I sympathize with many goals of the EWG, the EWG is nevertheless an organization with an agenda.Apples were leading the list of the dirty dozen and because apples are probably the number one fruit I eat, I decided to look closer at the methodology of the EWG’s study. The EWG states on their site: “Nearly all the studies on which the guide is based tested produce after it had been washed or peeled.” The data the recommendations are based on was not generated by the EWG themselves, but by the US Department of Agriculture (USDA) . The USDA has Standard Operating Procedures (SOP) for Laboratory Operations and looking at the relevant SOP ( PDP-LABOP Sample Processing and Analysis, Rev. 4, 07/01/12 ), I found the following: 5.3.3ApplesWash each apple under cold running tap water for approximately 15-20 seconds to assure that allsurfaces of the apple have been rinsed. Allow to drain for at least 2 minutes on paper towels on aflat surface. Do not peel. Remove the stem, if present. With a commercially available applecorer remove core or, using a clean, dry knife, cut each apple in half or quarters and remove thecore portion. Mechanically chop just until a visually homogeneous mixture is attained. Unitcounting is required. Refrigeration may not exceed 120 hours from the arrival time until thesample is homogenized.Now, from this it appears as if the apples were analyzed with the peel. Maybe apples are the exception that the EWG means when they write “nearly all”. Could it be that conventionally grown apples contain much of their pesticides on their peel? Yes, that is a possibility, since “… peeling the apples significantly reduced all pesticide residues” ( Rasmusssen et al. 2003: Distribution of multiple pesticide residues in apple segments after home processing ). Actually, lots of research has been done to address the question of whether pesticide residues can be removed from fruits and vegetabled by washing. The results point all into the same direction: with few exceptions (systemic pesticides) a majority of the pesticide residues is located in or on the peel. Water temperature is important: the hotter, the better the pesticide residues are removed. Detergents and rubbing improve the result just as is the case for washing your hands ( Holland et al. 1994: Effects Of Storage And Processing On Pesticide Residues In Plant Products , Chavarri et al. 2005: The decrease in pesticides in fruit and vegetables during commercial processing , Keikotlhaile et al. 2010: Effects of food processing on pesticide residues in fruits and vegetables: A meta-analysis approach ).I guess that’s why many people routinely remove the peel and still others wash and rub apples under hot water. And if you like to eat the peel, just buy organic. At the very least, you feel better.Image based on Red Apple by Abhijit Tembhekar.

Hobbies

Sat, 05 May 2012 00:00:00 +0000

Running

Sat, 05 May 2012 00:00:00 +0000

I have done it all between 1500 meters and 100 km. But that was 15 years ago, and now I only run to the fridge and back during the commercial brakes in my favourite TV show. Apart from that, I visit once in a while the home page of Runner’s World to get some inspiration.Believe it or not, I took part in the Helsinki City Marathon on August 2nd, 2003. I finished 1857th with a brutto time of 4:10:02 and a netto time of 4:06:50 .

My new Helkama Jääkäri bicycle

Thu, 26 Apr 2012 00:00:00 +0000

My Trek bicycle lasted 10 years and approximately 50000 kilometers before I had to retire it. I don’t do any preventive maintenance and fix things only when they are broken. In 2006 I bought a 450€ bicyle from Biltema . It lasted not even 5 years before it needed a major repair (including replacing the expensive bits like wheels, brakes, derailleurs, freewheel and many less expensive ones). Last June I decided to get a [Helkama Jääkäri]([img_assist|nid=581|title=Helkama Jääkäri|desc=|link=url,http://www.helkamavelox.fi/en/models/men/jaakari_3_gear-hmj3nhr_arv_k|align=left|width=240|height=160]) for about 700€. It’s an old style army bicycle and I hoped that it would last longer than the Biltema quality.This winter I cycled with my new Helkama bicycle several hundreds of kilometers on bumpy snow tracks and in February my rear wheel allmost fell of. The screws had not been tightened sufficiently and the thread was already badly damaged. To continue my way I had to remove the washer to expose some undamaged thread and tighted the screw. I contacted Helkama, because the bicycle was not even a year old. They responded quickly and I received a replacement rear wheel by post within a week. That’s good customer service and a reason to stick with the brand: When I bought a new bike for my son last month, I choose the Helkama Yoker , even though it was certainly not the cheapest choice.

The flu shot works

Fri, 20 Apr 2012 00:00:00 +0000

Last week my son was down with the flu. He got diagnosed with influenza A. He was terribly sick having more than 39°C fever for more than 4 days and was staying at home for 10 days before he was able to go to preschool again.My daughter didn’t get sick. Neither did my wife nor did I. Guess why? Because we got the seasonal flu shot. Here in Finland, the seasonal flu vaccine is free of charge for infants between 6 and 35 months, senior citizens 65 years or older, pregnant women and those with chronic diseases or medication that put them at higher risk for a severe disease or complications . Additonally, many employers offer free flu shots for their employees.Because my son doesn’t belong to any of those that gets the shot for free and because he strongly opposed to the shot and because the risk of infection for unvaccinated individuals for any given year is maybe only 5%, we let him go unvaccinated. Bad decision. There is a very good article about flu vaccinations on the Science-based Medicine blog and a very good podcast by pediacast.org about the topic. Unfortunately the flu mist (the vaccination that is inhaled as opposed to be injected) was not yet available on the Finnish market for the 2011/2012 flu season. Flu mist is produced by MedImmune , a subsidiary of AstraZeneca . According to my health care provider Mehiläinen the intranasal vaccine will be very likely available in Finland for the next flu season. The vaccine’s name will be Fluenz , under which it has been approved for by the European Medicins Agency in 2011 for the whole European Union.My son just opposed the injection, not the flu vaccine per se. Flu mist is as effective as the flu shot and it might even confer better protection compared to the shot. That makes sense, because the antigen enters via a natural route. And since it is a life vaccine, the immune response might be better and more sustained. Maybe my employer’s health care provider Mehiläinen should offer also free seasonal flu shots for the children of employees, because despite being vaccinated, I missed several days of work because I had to take care of my son.

½ year and 1000+€ for Win7 & Office 2010

Mon, 02 Apr 2012 00:00:00 +0000

In the beginning of 2011 I bought a netbook ( Lenovo IdeaPad S10-3t ). I bought it with my own money. It was preloaded with Windows 7 Starter Edition. Because I prefer to use Ubuntu , I shrank the Windows 7 partition and installed Ubuntu as my primary OS. I installed the University-licensed Microsoft Office XP, for which there were still installation media around in our research program. There are only two occasions when I boot into Windows: when I needed to work on collaborative publications or grant applications at home with my co-authors using Microsoft Word or when there is a program that has no equivalent on Linux (which has rarely happened during the last years).However, last October, more and more compatibility problems appeared between the aging Office XP and the newer versions of Office, that use the new XML format (.docx). On one occasion, after my boss had opened a Word file (created by Office XP), modified it and send it back to me (using compatibility mode), it became uneditable in Office XP. Word would crash whenever I tried to edit two of the three embedded images. In fact, I spent hours of recreating an editable version of that document from scratch.That was when I decided to upgrade my privately owned computer’s Windows and Office versions. Helsinki University’s license agreement with Microsoft allows staff and students to run Windows and Office on their home PC. To university researchers, it happens all the time that they need to work from home. In fact, I wrote almost a complete research paper ( Jeltsch et al, JBC 2006 ) from home. Thus it should not be difficult and not expensive to upgrade from Windows 7 Starter to Windows 7 Ultimate and from Office XP to Office 2010, right? Helsinki University wants to get higher and higher in the [Alma intranet pages]( http://www.topuniversities.com/university-rankings/world-university-rankings/2011?page=1>international rankings. Therefore, one might think the University would have made sure their researchers have easy access for the right tools to do their job. WRONG!Helsinki University has provided instructions on their Ohjelmistojakelu page of the university. Under the <a href=) (Home Use Program) link hides the “Microsoft Home Use Program and software delivery to members of the staff”. I downloaded the file (“koodi.txt”) which is a text file cotaining a code (something like “XXX0000”). With this code I went to the Microsoft Home use Program site. I had to type in my work e-mail address and the code and I received the following error message: “We are sorry, but we are unable to complete your request. the following problem(s) exist: - Please contact your benefit administrator to learn if you are eligible and to retrieve your program code.“I phoned the helpdesk of the University to ask what is wrong. The answer: “The University and Micorsoft are negotiating a new licensing deal and the old code doesn’t work anymore and the new code is not yet there.” How long will it approximately take for the new working codes codes to appear? “A few weeks.” I waited a few weeks. To be precise: I waited six weeks. I went through the same procedure as before. But the code still did not work. Retrospectively, I suppose that the helpdesk’s first answer was wrong: The codes were probably still fine, but the instructions on the university’s pages were wrong (they sent me to the wrong page to type in the code and at the time of this writing - 5 months later - the university’s pages are still wrong).In the beginning of the new year I submitted a formal support request to the helpdesk. I received the following answer:Hi MichaelUniversity of Helsinki has made a new agreement with Microsoft (moved from MSCA to EES) starting this month and now that our agreement is changing codes won't work. I assume we get new codes to our new agreement from Microsoft after all paper work is done, and this will take approx. couple of weeks or so.All we can do now is wait, you can check in february if Home Use Program -option is working. Sorry for the inconvenience.Best regards,Tommi also send me the Alma link with the instructions . I tried several of the links in the document (which were links to sites where one could order Windows and Office installation media/downloads), but already the first link was broken: Microsoft Windows operating systems: e-Academy (no CD/DVD option, only downloadable versions). It is still broken at the time of this writing.The other option (“Microsoft Home Use Program HUP (Digital River, also installation medias)”) linked only to the instructions that I already knew (and which do not work). Because apparently nobody had ever tried before to leaglly aquire Windows and Office for home use via this program, I went in March together with my computer to our physical help desk at Meilahti campus. Iivari was very friendly, but the only thing he managed to do was to replicate the problem and to convice somebody that there is a problem that should be looked at. A few days later he sent me the link to a page from where I could order Windows and Office for 20€/DVD: https://hup.atea.fi/ .This link I have never found anywhere in the university’s online instructions (as I learned later, it is somewhere there, but almost impossible to find). I am not surprised that otherwise law-abiding citizens of this country use illegal versions of Windows/Office at home if it is so difficult to be legal.I received the DVDs via Post a week later (I had to go to the post office and to pay there the 20€/DVD).Before I installed anything, I made a disk dumpdd if=/dev/sda of=/dev/sdbof my entire hard drive (250 GB hard disk, it took 20 hours via USB). Because I had Windows 7 Starter installed on my computer, I first tried to use the anytime upgrade . For this I actually only would have needed the license key, but not the physical installation disks. When I typed in the key, it started the upgrade, but failed without any details. So I decided to run the upgrade advisor (a program from Microsoft that determines whether your computer is “good” enough for the upgrade). The only thing it found was that I was short on disk space. So I freed another 5 GB by uninstalling software (mostly the bloatware that was put there by Lenovo). The second attempt also failed without any specific error message. I had no way of knowing what was the reason.So I tried a clean custom install. First I needed to transfer the Windows 7 install DVD to a USB stick (my computer has no CD/DVD drive and I or my lab doesn’t own an external CD/DVD drive). Fortunately this is easier with Windows 7 than with Windows XP. However, not all USB sticks seem to be equal and the first USB stick I tired (Verbatim) was rejected by the tool I used. I followed these instructions . Then I booted from the 4GB stick and started the upgrade. Everything went fine until the very end, when I needed to reboot and I was greeted with “Your Windows 7 install is broken. Do you want Windows to fix it?” Then I made a bad decision: I said yes. After fixing, nothing worked anymore. Upon rebooting, there was only a blinking black cursor.OK, if I cannot upgrade, I can do a fresh install. I wiped my hard drive clean and started the install. Everything went fine until I had to type in the product key. It complained that it is not a valid product key. Of course I had not thouroughly read and understood the pages at www.atea.fi . Probably because they are only in Finnish. Apparently, the University’s deal with Microsoft does not provide the staff with full installers, but only with upgrade installers. Consequently I need to keep my old Windows version around for the install. Luckily I had my diskdump. I wrote it back to the hard drive. This took only about 6 hours.This Monday I went (together with my laptop) to the local computing support. Perttu enlightened me about the possible upgrade paths to Windows 7 and tried to do the custom install using an external DVD drive. And it worked! Hallelujah! It took several reboots, but finally I had a running Windows 7 Ultimate. Installing the drivers took also about three hours. It took an eternity to download the drivers from Lenovo’s site, despite them being akamaized. Maybe they didn’t pay their bills. Now I just needed to create an iso image from the Office 2010 DVD, move it over to the computer and start the install, which went flawlessly this time.I presume that the first time I tried the custom install, the system was somehow compromised by the failed anytime-upgrade. Who knows. 500 Million lines of code, that nobody really understands anymore. It’s close to a miracle, that Microsoft is managing to keep Windows afloat.Of course the Windows installer had screwed up my grub boot loader and I had to start the machine from a System rescue CD on a USB stick and write back the MBR from my disk dump:dd if=/dev/sda of=/dev/sdc bs=512 count=1I still don’t exaclty know now, whether the Windows 7 Starter Edition does or doesn’t qualify for an upgrade using the University licensed upgrade plan. I stupidly assumed that if a 10 year old Windows XP Home qualifies, a Windows 7 Starter edition would too.The whole procedure lastet about half a year and taken together, I spent maybe seven to ten days of work for it (about half of this time during working hours, the other half during my weekends). Let’s estimate the real costs including the hours I had to put into this Windows 7 & Office 2010 installation: conservatively at least 1000€. The system is broken and the worst thing is, that there is nobody to blame and nobody who can fix it. Maybe Helsinki University should invest some energy and time into the development and adoption of open source Operating Systems. After all, the most popular one (Linux) was started by somebody from Helsinki University .

rtmpdump - Die Sendung mit der Maus

Wed, 14 Mar 2012 00:00:00 +0000

In my post from 5 March 2010 , I wrote about Die Sendung mit der Maus. At last, you can now watch Die Sendung mit der Maus in its entirety as a Flash video online! For 7 days, until the next episode of Die Sendung mit der Maus. The resolution isn’t HD (512x288 at 25fps, H264), but at least you can save it to your hard drive – if you know how. The programme that makes this possible is, of course, open source: rtmpdump . The command line is:

Meine Podcast-Favoriten

Fri, 20 Jan 2012 00:00:00 +0000

Meine Podcast-Favoriten. Fast jede Episode ist fantastisch:

ComputerNachrichten und Informationen über Computer-Sicherheit und wie das Internet und Computer funktionieren: Security Now!
Alles über Linux: The Linux Action Show!
Jede Woche wird in FLOSS Weekly ein neues Open Source Projekt vorgestellt.

Wissenschaft und Skeptizismus

Rekombinante Proteine

Fri, 20 Jan 2012 00:00:00 +0000

Früher war hier eine dynamisch verlinkte Liste meiner Proteine. Leider musste ich die direkte Verlinkung zu unserem Labor-Datenbank-Server aus Sicherheitsgründen aufgeben. Irgendwann finde ich vielleicht die Zeit, mit einer sicheren Methode den Inhalt userer Labor-Gefrierschränke hier auf meiner Homepage zu publizieren. Bis dahin gibt es bloss eine Liste der Proteine, die ich produziert habe. Wer Fragen hat oder die Proteine für Forschungszwecke braucht, darf sich gerne an mich oder meinen Chef wenden:

Lymphangiogenese-Regulation durch Wachstumsfaktoren

Thu, 19 Jan 2012 00:00:00 +0000

Alle Zellen unseres Körpers benötigen Sauerstoff und sie werden über das Blut damit versorgt. Deshalb ist das Gefässsystem das erste funktionsfähige Organ im wachsenden Embryo. Bevor das Herz seine Pumpfunktion aufnimmt, deckt der Embryo seinen Sauerstoffbedarf einzig durch Diffusion. Dies ist ihm allerdings nur bis zu einer Grösse von einigen Millimetern möglich.Tumoren haben das gleiche Problem, wenn sie eine ähnliche Grösse erreichen. Beide - der wachsende Embryo und die Krebsgeschwulst - können ihr Wachstum nur fortsetzen, wenn es ihnen gelingt, ein Gefässsystem zu bilden, das ihnen den benötigten Sauerstoff und die Nährstoffe bereitstellt.Das Krebswachstum ist also abhängig vom Wachstum und von der Neubildung von Blutgefässen. Andererseits gibt es aber auch Krankheiten, die von unzureichendem Blutgefäss-Wachstum charakterisiert werden. Bei der koronaren Herzkrankheit z. B. können die Blutgefässe dem Herzmuskel nicht genügend Sauerstoff liefern.Neben dem Herz-Kreislaufsystem gibt es noch ein anderes Gefässsystem: das Lymphgefässsystem. Es leitet überschüssige Gewebsflüssigkeit zuruck ins Blut und spielt eine wichtige Rolle in der körpereigenen Abwehr gegen Bakterien und Viren. Ähnlich dem Blutgefässsystem spielt das Lymphsystem eine wichtige Rolle in vielen Krankheiten. Lymphödem-Patienten z. B. leiden unter Schwellungen der Gliedmassen, weil entweder nicht aysreichend Lymphgefässe vorhanden sind oder die vorhandenen in ihrer Funktion eingeschränkt sind. Auch die Verbreitung von Krebs (Metastasierung) hängt eng mit dem Lymphsystem zusammen, weil Krebszellen die Lymphgefässe als Transportwege innerhalb des Körpers benutzten.

My favorite podcasts

Thu, 05 Jan 2012 00:00:00 +0000

My favorite podcasts. I enjoy almost every single episode:

Computer-related stuffSecurity news and education about security and how computers and the internet work: Security Now!
Everything Linux: The Linux Action Show!
Every week one Open Source project is the topic: FLOSS Weekly

Science and Skepticism

Adjunct Professor

Wed, 04 Jan 2012 00:00:00 +0000

Since December 13th, 2011, I am an adjunct professor (Finnish: dosentti ) at the University of Helsinki. This is not a tenured position, but a title, which requires a certain amount of scientific success after completing the PhD and teaching experience ( more about this in Finnish ).

How I became an "Adjunct Professor" ("dosentti") at the University of Helsinki

Wed, 04 Jan 2012 00:00:00 +0000

Compared to getting my PhD degree, the “dosentti” thingy was easy. I started in the beginning of 2011 and received the title the same year in December. I don’t know whether the process differs between different Finnish universities and some of the formalities might be specific to the University of Helsinki , but nevertheless, below I list the steps I took to get the title. There are also instructions available from here .

Tobi's LEGO bricksets

Mon, 02 Jan 2012 00:00:00 +0000

SetNumberSetNameThemeSubthemeYear625-1Tractor DiggerTownClassic1978626-1Red Cross HelicopterTownClassic1978645-1Police HelicopterTownClassic1979661-1Spirit of St. LouisLEGOLAND 1976885-1Space ScooterSpaceClassic1979886-1Space BuggySpaceClassic1979889-1Radar TruckSpaceClassic1979894-1Mobile Ground Tracking StationSpaceClassic1979897-1Mobile rocket launcherSpaceClassic1979924-1Space TransporterSpaceClassic1979928-1Space Cruiser And MoonbaseSpaceClassic19791575-1Finnjet FerryFerries 19772114-1ChopovNinjagoSpinners20112116-1KraziNinjagoSpinners20113179-1Repair TruckCityTraffic20103179-1Repair TruckCityTraffic20103843-1Ramses Pyramid Games 20094915-1Mini ConstructionCreator 20075933-1Airport Building SetBricks and More 20115981-1Raid VPRSpaceSpace Police 320106191-1Fire Fighter Building SetBricks and More 20096801-1Moon BuggySpaceClassic19816821-1Shovel BuggySpaceClassic19806822-1Space DiggerSpaceClassic19816841-1Mineral DetectorSpaceClassic19806927-1All-Terrain VehicleSpaceClassic19816929-1Star Fleet VoyagerSpaceClassic19817138-1RahkshiBionicleStars20107241-1Fire CarCityFire20057245-1Prisoner TransportCityPolice20057245-1Prisoner TransportCityPolice20057566-1FarmerCityFarm20107610-1SpeedboatCreator 20067631-1Dump TruckCityConstruction20097732-1Air MailCityCargo20087741-1Police HelicopterCityPolice20087797-1Bi-PlaneCreator 20087930-1Bounty Hunter Assault GunshipStar WarsThe Clone Wars20117950-1Knight’s ShowdownCastleKingdoms20107953-1Court JesterCastleKingdoms20107977-1Seabed StriderAtlantis 20117978-1Angler AttackAtlantis 20117984-1Deep Sea RaiderAtlantis 20118015-1Assassin Droids Battle PackStar WarsThe Clone Wars20098056-1Monster Crab ClashAtlantis 20108072-1Sea JetAtlantis 20108073-1Manta WarriorAtlantis 20108083-1Rebel Trooper Battle PackStar WarsEpisode IV-VI20108086-1Droid Tri-FighterStar WarsThe Clone Wars20108088-1ARC-170 StarfighterStar WarsThe Clone Wars20108089-1Hoth Wampa CaveStar WarsEpisode IV-VI20108093-1Plo Koon’s Jedi StarfighterStar WarsThe Clone Wars20108095-1General Grievous’ StarfighterStar WarsThe Clone Wars20108096-1Emperor Palpatine’s ShuttleStar WarsEpisode III20108130-1Terrain CrusherRacersTiny Turbos20078137-1Booster BeastRacersPower Racers20078193-1Blue BulletRacersTiny Turbos20108221-1Storming EnforcerRacers 20118400-1Space SpeederSpaceSpace Police 320098665-1Highway EnforcerRacersTiny Turbos20068860-1Car ChassisTechnic 198010188-1Death StarStar WarsUltimate Collector Series2008

Tobi's LEGO bricksets

Wed, 09 Nov 2011 00:00:00 +0000

Introduction into lymphatic research

Thu, 20 Oct 2011 00:00:00 +0000

Lecture 1: The cardiovascular system vs. the lymphatic system: Anatomy and Physiology
Lecture 2: Molecular make-up of the lymphatic system
Lecture 3: The lymphatic system in disease
Lecture 4: Model organisms in lymphatic research , .tex file
Lecture 5: Fundamental techniques in lymphatic research
Lecture 6: Current questions in lymphatic research

Comment êtes-vous arrivé ici?

Tue, 20 Sep 2011 00:00:00 +0000

Structure/function relationships within the VEGF/VEGF receptor families

Wed, 03 Aug 2011 00:00:00 +0000

The 8th International Duodecim symposium on “Endothelial growth factors in cancer and cardiovascular diseases” took place in the Vanajanlinna mansion from 9th to 11 June, 2011. It is just a bit more than 100 km from Helsinki and I did the trip by bicycle. This is the abstract for the poster I made for the meeting:

Some useful PDF editing (and search) commands

Thu, 28 Jul 2011 00:00:00 +0000

Insert pages with interleave: pdftk A=input_odd_pages.pdf B=input_even_pages.pdf shuffle A B output collated.pdf(from the pdftk package)
Split an A2-sized PDF into two A3 pages for printing (no overlap): pdfposter -m A3 -p A2 Periodic-Table_A2.pdf Periodic-Table_2xA3.pdf
Split an arbitrary-sized PDF into A3 pages for printing at 100% size (= 1), no overlap: pdfposter -m A3 -s1 Poster.pdf Poster_split_to_A3.pdf
Reverse page order: pdftk input.pdf cat end-1 output reversed.pdf(from the pdftk package)
Reduce PDF filesize: gs -sDEVICE=pdfwrite -dCompatibilityLevel=1.4 -dPDFSETTINGS=/screen -dNOPAUSE -dQUIET -dBATCH -sOutputFile=output.pdf input.pdf Allowed PDFSETTINGS are /screen, /ebook, /printer, /prepress, /default. (from the ghostscript package)
Convert a color PDF into grayscale: gs -sOutputFile=output.pdf -sDEVICE=pdfwrite -sColorConversionStrategy=Gray -dProcessColorModel=/DeviceGray -dAutoRotatePages=/None -dCompatibilityLevel=1.4 -dNOPAUSE -dBATCH input.pdf (from the ghostscript package)
Export bitmap images: pdfimages -j original.pdf extracted (from the xpdf package)
Convert into a bitmap image: convert original.pdf converted.png (from the imagemagick package)
Split into individual 1-page PDF files: pdftk original.pdf burst (from the pdftk package)
Merge two or more PDF files: pdftk original1.pdf original2.pdf cat output merged.pdf (from the pdftk package)
Delete page 13 from a PDF file: pdftk original.pdf cat 1-12 14-end output page13deleted.pdf (from the pdftk package>
Rotate page 5 of the PDF file 90 degrees counterclockwise: pdftk Figures_LRES.pdf cat 1-4 5L 6-end output Figures_LRES2.pdf (from the pdftk package>
Assemble a new PDF where each 4 pages from the source files are merged into one landscape page: pdfjam *.pdf –landscape –nup 2x2 For portrait orientation use the “–no-landscape” option (from the pdfjam package).
Underlay a PDF with another (background) PDF: pdftk foreground.pdf background background.pdf output overlay.pdf (from the pdftk package).
GUI PDF editors: I tried out PDFEdit , but it is too difficult for me. The Master PDF Editor" is not free, but it seems to be much more usable without extensive initialization of the user.
**Encrypt a PDF with both a owner password (to change the file) and a user password (to open the file): **pdftk input.pdf output encrypted.pdf owner_pw PROMPT user_pw PROMPT (from the pdftk package).
**If you need to do a text search through many PDF files in the current directory and all of its subdirectories, you can use pdfgrep : **pdfgrep -r searchterm * (from the pdfgrep package).
**Convert & merge all jpg files in the current directory into one PDF file:**convert *.jpg pictures.pdfIn the recent Ubuntu editions, this batch operation is not allowed due to security risks and you can disable this policy by renaming the configuration file:/etc/ImageMagick-6$ sudo mv policy.xml policy.xmlout

Rescue from the vacuum cleaner

Tue, 05 Jul 2011 00:00:00 +0000

I have identified the top reason of LEGO pieces disappearing in our household: the vacuum cleaner. On suspicion I reluctantly decided to explore the bag’s content (Miele HyClean N/G) after it was full and here is what I extracted: Three LEGO pieces, three puzzle pieces, a screw driver head, a pinwall pin, a Mastermind pin and some yet to identify metal item.

Academic Portfolio 2011

Tue, 08 Mar 2011 00:00:00 +0000

This is my Academic Portfolio in PDF format. Since it is public, I had to black out confidential information concerning confidential ongoing collaborations, my research plans and the contract research I am doing for Vegenics Ltd./Circadian Technologies . I assembled this for my application for the title of Adjunct Professor .

LEGO

Sat, 05 Feb 2011 00:00:00 +0000

Tobi wants Lego. To make sure that you don’t buy him sets he already owns, he has made a list at brickset.com of all his sets. And so that you don’t have to register at brickset.com, there is a mirror of this list here: Tobi’s Lego bricksets .

Äkta Explorer FPLC core facility

Wed, 26 Jan 2011 00:00:00 +0000

Nowadays I spend much of my time at work on the purification of proteins which regulate angiogenesis and lymphangiogenesis . Therefore, I am taking care of the necessary machinery that the Molecular Cancer Biology Research Program owns: the fast protein liquid chromatography (FPLC) machine. Prof. Jorma Keski-Oja acquired about 15 years ago one of the first (and in 2010 discontinued) Äkta Explorer machines from Swedish producer Pharmacia (who merged in 1997 with Amersham to become Amersham Pharmacia Biotech, who was in turn bought by GE Healthcare in 2004). In the year 2000 the equipment moved from the Haartman Institute into the Biomedicum Helsinki . While I have maintained web pages for this piece of research infrastructure for the last five years (including online reservation and data backup), they were only available from inside the Helsinki University network.Now, I managed to have web pages about the Äkta Explorer FPLC core facility added to the web site of the Medical Faculty . At the moment, we are adding the WAVE cell culture system to our facility to be able to produce large amounts of cells/cell culture supernatant (up to 25 liters of bacterial, insect or mammalian cell culture) for protein production.

Statistics about Finland

Thu, 09 Dec 2010 00:00:00 +0000

Finland makes frequently headlines for its good rankings in international comparisons. Three recent notable rankings were the 2006 OECD PISA study , the yearly Corruption Perception Index and Newsweek’s best-country-to-live-in study . When Finland doesn’t fare that well in international comparisons, there is not that much to report. Here are some of the statistics that I have missed:

Statistiken über Finnland

Thu, 09 Dec 2010 00:00:00 +0000

Finnland macht oft Schlagzeilen mit seinem guten Abschneiden in internationalen Vergleichen. Zu solchen gehört etwas die 2006 OECD PISA-Studie , der jährliche Korruptionswahrnehmungsindex und Newsweeks Bestes Land zum Leben-Studie . Wenn Finnland nicht so gut im internationalen Vergleich abschneidet, wird nicht viel berichtet. Hier einige Statistiken, die ich in der öffentlichen Wahrnehmung vermisse:

Old City Museum Power Plant

Wed, 08 Dec 2010 00:00:00 +0000

Ever since we have moved into our new apartment, we have been subscribing to environment-friendly electricity (“Ympäristöpennisähkö” from Helsingin Energia ). We decided to “receive” the energy from a hydropower plant which is located near our house at the rapids of Helsinki Vanhakaupunki . The Vanhakaupunki hydropower plant started its operation in 1876 and operated about 100 years before it was shut down about 40 years ago. Supported with EU money the power plant was restored and resumed operation in the year 2000 as a museum power plant which is free for visitors during the summer months.Buying environment-friendly electricity is mostly a statement towards your electricity supplier. All what it means is that your supplier is buying some certificates that guarantee that somewhere electricity is produced environment-friendly. Electricity is electricity is electricity. Once it is in the grid, there is no way to distinguish between electricity from nuclear power plants or coal-burning power plants and wind- or water-generated electricity. Physically, you get most of the power from the closest source. If you buy ecological electricity and you live close to a nuclear power plant, you’ll get most of your power from there whether you like it or not. Thus we have actually real chances to get some of our electricity from the museum power plant next to our house. That is: if it was working.The generator broke about two years ago and a spare part had to be ordered from Austria (the generator axle needed to be custom made). The spare part had been delivered in 2009, but for some reason, the generator was still not fully operational.The power plant’s operation is dependent on the water level in the Vantaa river. Low water levels were to blame e.g. during summer of 2010, but the generator has mostly not been operating even when when water levels did permit its use (the statistics can bee seen here ).I visit the power plant frequently together with my son and thus I can say that during the approximately 10 visits during 2010 we have never found the generator turning. In 2007 it was turning almost every time we visited. Even more disappointingly, the museum staff was only able to confirm that something must still be wrong with the machine despite the replacement axle; but they were not able to tell us any details.Most surprising is the fact that nobody from the operating company told us anything, although we were allegedly receiving our energy from this power plant. Therfore on August 24th I wrote a e-mail to Ulla-Maija Alander from Helsingin Energia asking about the situation and encouraging to make more information available for their customers. After not receiving any answer for three weeks I resent the mail on Sept. 15th and after waiting for another three weeks I finally phoned. During the phone conversation I was promised an answer which came via e-mail:Dear Mr Jeltsch,first I would like to apologize for not responsing to your feedback earlier, and also thank you for your interest in Vanhankaupunginkoski power plant.The reason why the generator is not operating at the moment is - as you correctly assumed - the lack of water, as it often has been. However, there has also been technical problems since the generator was repaired in May 2009. This year, the lack of water caused “zero production” in January and February. In May and June, unfortenately, there were problems in the turbine that prevented the use of the generator. After these problems were solved, the water level sunk again in August.I don’t know if the demonstration use has been a daily procedure, but I will get back to you as soon as I find more information about that and the reasons why this may have been changed.You are absolutely right about the lack of information on our website and towards our valuable Ympäristöpenni customers. And you are right that it is inexcusable. We clearly have to improve our performance. We will.Thank you for the feedback!Best regards,Anna-Maria AsellProduct ManagerHelsingin Energia00090 HelenKampinkuja 2, HelsinkiTel. 09 617 3168anna-maria.asell@helen.fiwww.helen.fi

HBGS course

Mon, 10 May 2010 00:00:00 +0000

All documents related the the HBGS course Tags in protein expression, detection and purification. Most documents are available in both PDF and OpenOffice format. Feel free to repurpose the documents. They are licensed under the Creative Commons Attribution-Noncommercial-Share Alike 1.0 License .

Customer rights at Prisma Viikki

Wed, 10 Mar 2010 00:00:00 +0000

This January our Esprit/Sigikid Frog broke. It’s a musical toy to keep our baby occupied during diaper changes. It stopped playing its Schlaf, Kindlein schlaf melody after winding up its mechanism by pulling on the string that comes out of its bottom.The mechanism has been probably been operated about 300 times. Right from the date of purchase, there has always been a peculiarity with the winding mechanism, notably that when pulling on the retracted string, an initial resistance could be noticed that required very strong pulling to overcome. However, after the initial resistance, the string was easy to pull and we did not pay attention to this anymore after we got accustomed to it. Until the mechanism failed to operate after pulling. That’s when we realized that maybe it should not have been all that difficult to start pulling and maybe this was indicative of an initial problem that only manifested itself after sufficient usage.This frog was by no means cheap. In fact, the Finnish Prisma shop (Viikki branch) took a large margin of profit by selling it for almost 19 Euros while it can be purchased for less than 9€ online ( Baby-Markt or 12,97€ at amazon.de ). This, the EU directive that regulates such cases of seller liability ( Directive 1999/44/EC of the European Parliament and of the Council of 25 May 1999 on certain aspects of the sale of consumer goods and associated guarantees ) and the fact that it is a product designed (but not made) in Germany by Sigikid made me reason that I should get it replaced without any trouble after a mere 8 months of use (we really started to use it only after the birth of our daughter in June).However, what I encountered at the customer desk of Prisma Viikki , was completely different from my expectations. First I was told that this product has a warranty of 6 months and thus I won’t get it replaced. Since I insisted on a formal return of the product, the employee filled out the return form for me. I have to mention that the conversation went in Finnish which is not one of my strong languages. And retrospectively I realize, that I should have filled out the form myself (in English) to make my point that the product was most likely defective right from the start.A few days later I received a phone call where the “you don’t get the defective product replaced” was repeated. I mentioned the EU directive which requires 2 years of seller’s liability. And since Finland is a member of the EU I should be able to exercise my EU-given rights. The shop representative at the other end of the phone line surprisingly admitted that she does not know of such directive and that she would contact the Finnish customer protection services and come back to me later.Again a few days later, I had another long phone conversation about the topic where I finally had the opportunity to express the situation in detail in English. Actually it appeared that the Finnish law doesn’t have any time limit for seller’s liability, but handles every case individually. This could be bad or good for me, depending whether you argue that such a musical toy’s expected lifespan is substantially more or less that approximately 11 months. In the end of this conversation the Prisma representative admitted that the situation might be different from what she originally perceived.Again a few days later I received another call from somebody else who ask me to submit a detailed description of my request in written form, which I did via e-mail yesterday (March 9th). Now I am waiting for a mutually satisfying resolution. I actually think that the mechanical problem is probably minor and had the failure to function occurred a bit later I probably would have “operated on the frog” to fix it myself. This case has already consumed an unreasonable amount of my time and alone for this reason the incident will probably (independent of its outcome) leave me with some uneasy feeling about Prisma’s customer care.Comparing goodwill (is there a closer English translation of the German word “Kulanz”) of sellers between Finland and Germany makes most German expatriates here in Finland nostalgic and home-sick. About half of the money I spend, I spend in the exact same Prisma Viikki shop that refused to replace the Esprit/Sigikid frog. Luckily, we live exactly half-way between the Arabia shopping center and Prisma Viikki.UPDATE (April 14, 2010): Today - after more than 2 months - the importer sent us the repaired frog.

Kid's series on German TV

Fri, 05 Mar 2010 00:00:00 +0000

The online offering from Germany’s public service broadcasters (i.e. ARD) for children ( kinder.ard.de ) is rather limited (although they do produce good children’s television). You can find plenty online, but rarely the actual programmes themselves – instead, there’s a lot of Flash rubbish . Selected ‘Sachgeschichten’ and clips from Die Sendung mit der Maus are the only things that interest my son. I want the whole Sendung mit der Maus! And Sesame Street isn’t available online at all, neither in full nor in part. That’s exactly what I’d like: I don’t just want to decide for myself WHAT my children watch, but also WHEN they watch. If I lived in Germany, I could record the broadcasts onto a hard drive. Fortunately, German law not only permits digital recording for personal use (“ private copy ”), but also the sharing of the recordings with friends. That’s how I get Sesame Street , The Show with the Mouse , Was ist was TV and the Bibliothek der Sachgeschichten .

Internet services of Finnish TV stations (YLE Areena & Katsomo)

Thu, 04 Mar 2010 00:00:00 +0000

Apparently a significant number of people (I guess about 1-2% of the Finnish households) did not succumb to the political and advertisement pressure to upgrade their TV to receive digital broadcasts. Here in Finland analog broadcast has stopped in 2007. Thus without purchasing a “digibox” or a new digital TV, one cannot receive any Finnish broadcasts anymore and one should not need to pay the TV license fee to support the national public TV station YLE (“YLE maksu”). Driven by the revenue loss of millions of Euros, the public broadcasters lobbied the politicians into a obligatory “media fee” for every household independently of their TV watching habits.One argument that I have heard was that those who did not upgrade their TVs are consuming the content produced by YLE via the internet or other means. While this is certainly true for many of them, it is no valid argument in the discussion as there are still many who don’t and who therefore should not have to pay. My household didn’t continue to pay the TV license fee after the analog signal was switched off: We don’t own a digibox, neither a digital TV nor any other digital receiver. Even before that we hardly watched the TV and every hour we watched cost us about 20 Euros TV license fee (yearly fee divided by yearly hours watched).I only started to use the (free of charge) internet TV services of the Finnish broadcaster YLE ( YLE Areena ) in the end of 2009 when I heard that the TV tax is a done deal and will be introduced next year or so. I sincerely hope that when the obligatory media fee is introduced, YLE’s internet services will not be restricted to a few selected series as they are now. I do not oppose pouring money into public broadcasting: The best documentaries on this planet are made by the BBC , a broadcasting monster that receives huge amounts of money from British taxpayers. Speaking of the quality of the public Finnish TV: The only program that I (or rather my son) is watching via the internet service of YLE Areena is not produced by YLE, but acquired from abroad. It’s the British childrens’ series Little Princess . And because of the limited availability (I think you can watch every episode only for 2 weeks after the initial broadcast) I have to record the streaming video, since there is no Download-to-disk option in the Flash player that YLE uses.Luckily, someone from the Technical University of Helsinki adapted the rtmpdump utility and made it work with YLE Areena ( rtmpdump-yle ). However, this is not for the faint of heart as you need to compile the program from source code yourself (it compiled smoothly on my Linux Ubuntu Hardy Heron system; UPDATE 10.5.2010: A Vanilla Lucid Lynx system required the libssl-dev package before it compiled). After compiling it is just opening the Yle Areena web page in your browser to play the program of your choice. Then you need to copy the id number of the program from the URL and insert it in the following command:rtmpdump-yle -r rtmp://flashk.yle.fi/AreenaServer/ --swfUrl http://areena.yle.fi/player/Application.swf -p http://areena.yle.fi/video/706793 -o /home/jeltsch/Multimedia/TV\ Shows/Kids\ \&\ Family/Little\ Princess/Pikku\ Prinsessa.flv UPDATE (10.5.2010): It got more user-friendly! yle-dl http://areena.yle.fi/video/950912[img_assist|nid=534|title=|desc=|link=url,http://katsomo.fi|align=left|width=160|height=90]The only other show I get via Finnish internet TV services is as well a foreign production: Mythbusters . However, I get this from Katsomo , the internet TV branch of MTV3 , a Finnish commercial TV channel. Also for Katsomo you need to resort to some command line wizardry to save it to disk. For Katsomo, you need the Mplayer : Open the Katsomo web page in your browser to play the program. Copy the id number of the program from the URL and insert it for the p variable in the following command. Sometimes the first version of the command doesn’t work (why not?).mplayer -playlist "http://www.katsomo.fi/metafile.asx?p=30911&bw=1000" -dumpstream -dumpfile mythbusters.avi``mplayer "mms://www.katsomo.fi/metafile.asx?p=30911&bw=1000" -dumpstream -dumpfile mythbusters.avi Sometimes this just won’t work due to network congestion and the connection is lost after a few (or two hundred) MBs. And even if it works you might get an error message (“Stream not seekable”), but you can ignore it, the stuff is downloaded nevertheless. However, it’s streamed in real time - saving takes the same time as watching, unlike the rtmpdump for YLE Areena, which downloads a 30 min series in about one to two minutes (provided your download speed allows for that).

Disk dumps (dd) and copying over the network (netcat)

Tue, 16 Feb 2010 00:00:00 +0000

On the receiving machine (disk sda MUST be unmounted, e.g. by booting from a live CD or USB stick):netcat -l -p 4778 | dd of=/dev/sdaOn the sending machine (disk sdb MUST be unmounted, e.g. by booting from a live CD or USB stick):dd if=/dev/sdb | netcat 192.168.0.4 4778(-l listen; -p port)To copy a directory over the network, enter the directory and execute on the sending machine:tar -cz . | nc -q 10 -l -p 45454On the receiving machine, create the directory, enter it and execute:nc -w 10 192.168.0.11 45454 | tar -xzBTW: If you want to see the progress of a disk dump (how much was already copied in what time at what average speed), you can use (in newer versions of dd) the status option. I guess this might not work for network copying, but I have not tried… dd if=/dev/sdb of=/target status=progress

VEGF-C/VEGFR-2 complex structure took 13 years to solve

Wed, 03 Feb 2010 00:00:00 +0000

Finally our paper was accepted for publication in PNAS (downloadable also from here ). I started the project by making the first construct 13 years ago, but it went nowhere for the first 9 years due to insufficient concentration of efforts and a few unlucky choices in the experimental design. I opted for bacterial protein first, but although the refolding worked, it was very inefficient (Ala mutation and a smart trimming of N- and C-terminus. More…

A permanent static route in Ubuntu Karmic Koala (9.10), Precise Pangolin (12.04) & Trusty Tahr (14.04)

Sat, 26 Dec 2009 00:00:00 +0000

Karmic KoalaTo add a permanent static route to a Karmic Koala system with one NIC, you need to edit the/etc/network/interfaces file. The following section needs to be replaced:# The primary network interfaceauto eth0#iface eth0 inet dhcpModify as follows:# The primary network interfaceauto eth0iface eth0 inet dhcpup route add -net 10.8.0.0 netmask 255.255.255.0 gw 192.168.0.3down route del -net 10.8.0.0 netmask 255.255.255.0 gw 192.168.0.3**Precise Pangolin (12.04)**With the Precise Pangolin, I did it by adding a script called add_route to /etc/network/if-up.d:#!/bin/sh#if [ "$IFACE" = "eth0" ]; then route add -net 10.8.0.0/24 gw 192.168.0.18#fiI never added a corresponding script (del_route) to /etc/if-down.d, but that seems to be OK.**Trusty Tahr (14.04)**With Trusty Tahr, I was adding the route command as a line to the /etc/rc.local script:…route add -net 192.168.1.0/24 gw 192.168.0.3exit 0The route command needs to be before the “exit 0” line!**MacOS X 10.8 (Mountain Lion)**And here is how it is done on MacOS X 10.8: http://nellen.it/blog/2012/01/permanent-static-routes-for-mac-os-x . They details of how to to it in MacOS X have changed over time; here is the way how it was done on MacOS X 10.4.7 .

Recombinant proteins

Fri, 25 Sep 2009 00:00:00 +0000

A dynamically updated list of proteins used to be here, but I shut down the communication to our lab’s database server due to security concerns.

Growing tomatoes on a balcony in Finland

Sun, 30 Aug 2009 00:00:00 +0000

We live in Helsinki , Finland. Helsinki is something like 60° North and the climate is anything but favorable for anything except mushrooms, blueberries and reindeer lichen . But our apartment has a glassed balcony facing South and so I thought it should be possible to grow some veggies there. I seeded tomatoes inside in mid-April, which is a time when the temperatures can easily fall below 0°C and also snow storms are not unheard of during this time of the year.Not enough lightThat was too early as there was still not enough light and rank growth was the consequence: very thin, fragile and tall plants trying to reach more light. I don’t think it is very ecological to use artificial light, but it would have helped in this case. The other mistake was that the pots we used were much too small. We used 2 and 5 liter pots, harboring each 2 plants. Next time we’ll only use one plant per 10 liter pot. However, when the temperatures went up in the middle of May, we transferred the tomato plants to the balcony. Because now there was plenty of light they grew very fast and soon there were lots of yellow flowers.Pollination troublesHowever, there were no tomatoes. It appears that tomatoes need either insects or wind for pollination, none of which we had on our glassed balcony. To replace the wind one can shake the plants to release the pollen. Once we did that and opened the glass windows they promptly developed fruits. The tomato species was of the indeterminate type - meaning that it kept constantly growing and producing flowers. We had to support them with strings attached to the balcony ceiling. The one thing that was most laborious was the watering and fertilization. Since the plants had very little soil, they needed to be watered daily and fertilized twice a week with a dilute fertilizer. In addition we had to put the balcony blinds into use during the sunny hours of the summer days to prevent the plants from frying. Lots of work for a few tomatoes. I agree with Wise Bread that growing your own fruits and veggies is more of a hobby than a way to save money.Superior tasteAdmittedly, the tomatoes from our balcony taste better then those from the grocery store; my four year old son said today he only eats self-grown tomatoes. Especially in the Northern part of Western Europe, many people have never tasted really good tomatoes. The deprecatory name for a tomato that has no taste whatsoever is (in German language) “ Hollandtomate ”. I guess the lack of taste is due to the optimal conditions they are grown in, maybe also the specific strain. E.g. in order to develop full flavor, tomatoes need also dry periods. Dry periods, however, result in smaller fruits. And because commercial producers are paid by the kilogram their tomatoes never see any dry periods. Taste is much more difficult to measure than weight. The lack of flavor is probably not due to artificial fertilizer (as I suspected before). We used artificial fertilizer and the result was still superior to everything commercial I have tasted this year.YieldI harvested alltogether more than 70 tomatoes (about 7 kg) from the plants. The harvest started quite late (in the beginning of August) and lasted until mid-October, when I picked all tomatoes including the green ones to prevent them from freezing. All green tomatoes finally ripened inside and a few managed to rotten. The last own tomatoes we ate in the end of November. Even those that ripened after picking had a much better taste than the stuff from our supermarket.

How to use jhead or exiftool to add a time stamp to a jpg image

Mon, 24 Aug 2009 00:00:00 +0000

If the jpg image doesn’t have exif header you need to create it first:jhead -mkexifThen enter the time stamp data:jhead -ts2009:08:15-10:30:00Apart from jhead ( http://www.sentex.net/~mwandel/jhead/) , there is another frequently used tool to edit exif data: exiftool ( https://www.sno.phy.queensu.ca/~phil/exiftool/ ). When you execute exiftool to display the exif data, you get a list like this:user@laptop:~$ exiftool IMG_001.jpgExifTool Version Number : 10.80File Name : IMG_001.jpg[…]Date/Time Original : 2018:09:02 13:20:13Create Date : 2018:09:02 13:20:13[…]However, in order to modify a value you need to address the individual tag and the tag name that the command line expects is NOT the same that is given in the list (the tag for “Create Date” is e.g. “CreateDate”):exiftool -CreateDate='2009:11:32 09:11:24.991000' IMG_001.jpgExiftool is probably the most capable tool, but for the same reason, it is not the most easy to use.IN order to remove all exif data, try:exiftool -all=IMG_001.jpg

Chicken embryo

Tue, 18 Aug 2009 00:00:00 +0000

Through a hole in the egg shell you can visually follow the complete chicken development. Click the video link below to see the heart beat!

Finally some good self-made chocolate ice cream

Fri, 07 Aug 2009 00:00:00 +0000

Last summer I bought this ice cream maker. Some of the ice cream I made was quite OK, but only now did I succeed in making ice cream that compares favorably to Mövenpick or similar. The secret is: EGGS and lots of FAT and SUGAR. Here is the recipe:

The Molecular/Cancer Biology Lab 2008

Sat, 11 Jul 2009 00:00:00 +0000

Giant soap bubbles

Thu, 11 Jun 2009 00:00:00 +0000

There are hundreds of web pages describing recipes for giant soap bubbles. Some of the more interesting ones are The Bubblesphere , Bubble Town , Soap Bubbler , Riesenseifenblasen durch polymere Additive (in German) , Nanotech Kids . Why another web posting about soap bubbles? Because almost all of them use ingredients that are not available where I live (i.e. Finland). I got a recipe from a soap bubbler who performed at a kindergarden event in my neighbourhood and here is my modified version (including brand names which were absent from the original recipe):

The Molecular/Cancer Biology Lab 2008

Mon, 11 May 2009 00:00:00 +0000

The Molecular/Cancer Biology Lab 10 years ago

Tue, 05 May 2009 00:00:00 +0000

I cleaned my computer files and I found this historical photo collage…

And here is another historical document. It’s an article about the Alitalo laboratory in the “Yliopisto” magazine from September 2002:

How to determine and convert text file encoding (file, enca, iconv)

Wed, 22 Apr 2009 00:00:00 +0000

To determine the file type of the file “sample.txt” you just type:file sample.txtUsually it’ll tell you only that it is a text file. To get to know more about the encoding type:enca -L none sample.textThe -L switch tells the program what language is used in the file. If you don’t know, just use none.To convert the encoding from ISO-8859-1 (latin1) to UTF-8:iconv --from-code=ISO-8859-1 --to-code=UTF-8 sample_iso8859-1.txt > sample_utf-8.txt

File permissions on html server (recursive chmod) differentiating between files and directories

Sun, 12 Apr 2009 00:00:00 +0000

I recursively screwed up the file permissions in my html servers root directory. To fix it I needed to deploy some “advanced” chmod settings. Obviously I want to treat directories and files differently. I didn’t come up with a better solution than the following:chmod -R u=rw-x,g=rw-x,o=r-wx *chmod -R a+X *

Old Macs and USB support

Tue, 17 Mar 2009 00:00:00 +0000

We have a few legacy Macintosh computers at work which are still running different flavours of MacOS 9 . Although these machines have USB ports, they are mostly non-functional. I think MacOS 9.0 was the first version that supported USB mass storage devices, but apparently support has been shaky until and including version 9.2.2. Apparently the various updates to MacOS 9 mainly addressed the problems with USB (and firewire) support. At least for one of these machines (running MAcOS 9.2.2) I managed to fix the USB support. I removed all non-Apple USB- and firewire-related extensions from the system folder (e.g. some from Lacie). Then I downloaded the MacOS 9.1 upgrade from Apple and extracted all USB-related extensions using TomeViewer and replaced the existing (9.2.2) extensions by these (9.1) counterparts. After a reboot my (PC-formatted) USB stick was recognized immediately. Here is the list of extensions that I replaced:

youtube to iPod and how to check video files

Mon, 23 Feb 2009 00:00:00 +0000

I was trying to extract the audio file from some youtube videos in order to play it back from my iPod shuffle. I tried various methods (including the otherwise quite versatile VLC Player , but finally settled on the following two step procedure:1. Download the flash video (file ending .flv) file to your local disk. You can use any method to accomplish this task, but as usual Firefox has the perfect plug-in for this task: Download helper .2. Extract and convert the audio file with ffmpeg using the following command: ffmpeg -i video-infile.flv audio-outfile.mp3 It is also possible to convert the flv file into a mpeg file. You need to do this e.g. if you want to import the video into iTunes . For some strange reason Quicktime can play Flash Videos, but iTunes doesn’t allow their playback. The command is almost the same: ffmpeg -i video-infile.flv audio-outfile.mpegAnother nifty usage of ffmpeg is to check video files for corruption and other problems:ffmpeg -v 5 -i file.avi -f null - 2>error.log

My rare use of LaTeX

Mon, 02 Feb 2009 00:00:00 +0000

Compiling I sometimes use LaTeX . I would like to use it more often, but I guess I belong to the Wysiwyg generation. In fact I use it so rarely that I even forget how to compile a document. The following is therefore just a reminder for myself; the filename is doc.tex:

Changing the MAC (Media Access Control) address of NICs (Network Interface Cards)

Sun, 25 Jan 2009 00:00:00 +0000

In some networks, computers have to be registered to get connected. Upon registration, the computer will receive a name and an IP address. Every time it connects to the network, the DHCP server assigns it the same name and IP address. The DHCP server identifies computers based on the MAC address, which is unique to every NIC. However, if you know the MAC address of a registered computer, you can use it to connect to the network, faking the MAC address:

cryptsetup

Sun, 25 Jan 2009 00:00:00 +0000

I switched already quite a while ago from the old cryptoloop technology to the newer cryptsetup technology. However, I still forget how to manually create and mount encrypted volumes, because I do this rarely. Here are the commands:cryptsetup create cryptovolume /dev/mapper/logical_volumemount /dev/mapper/cryptovolume /mountpointIn this case I mapped a logical volume, but of course you can map physical volumes, too:cryptsetup create cryptovolume /dev/sdb1mount /dev/mapper/cryptovolume /mountpoint

How to access encrypted volumes from live CDs

Sun, 25 Jan 2009 00:00:00 +0000

Once you have decided to encrypt your hard drive, you might find yourself in the situation where you need to pull off data from it when the regular decryption mechanisms you use are not in place. E.g. when the OS is not booting or the drive has some physical problems. In that case you need to boot from a CD/DVD that supports the encryption technology that you used. In my case I need a live Ubuntu CD/DVD, preferably the same version that was used to encrypt the disk! Otherwise there might be incompatibilities:sudo apt-get install lvm2 cryptsetupsudo modprobe dm-cryptsudo cryptsetup luksOpen /dev/sda2 crypt1 (result: key slot0 unlocked, command successful)sudo vgscan --mknodes (result: Found volume group "default")sudo vgchange -ay (logical volumes become active)sudo mkdir /volume1, etc.sudo mount /dev/default/root1 /volume1

How to erase hard drives (shred, dd)

Sun, 25 Jan 2009 00:00:00 +0000

You could write zeros to the whole hard drivedd if=/dev/zero of=/dev/hdaFor newer versions of dd, you can monitor the progress:dd if=/dev/zero of=/dev/hda status=progressHowever, it has been recommended to write a few passes of random noise (n = 3 is the default). If the writing process entirely got rid of the magnetic history and your source of randomness was perfect, a single pass would ALWAYS be enough. In reality, you only need n>1 if you are dealing with the state secrets since recovering anything after an n=1 erase requires special equipment which you cannot buy in any store. shred -vfz -n3 /dev/hda

More of Tobi's kindergarten songs (Finnish X-mas songs)

Wed, 24 Dec 2008 00:00:00 +0000

METSÄMÖKIN TONTTU

Kas metsämökin ikkuna, sielt tonttu ulos kurkistaa.Ja jänö laukkaa laputtaa ja oveen kolkuttaa:Auta, auta pyydän sua, metsämies kun vaanii mua.Sulle suojan tarjoan siis kätes ojenna.

How much toothpaste is safe to swallow for a 3 year old?

Mon, 22 Dec 2008 00:00:00 +0000

My son doesn’t like to brush teeth and he is probably no exception. In order to protect his teeth, we started to use a fluoride-containing tooth paste when he was about 2 years old. However, we were always careful and didn’t let him swallow the toothpaste in order to avoid overdosing. There are likely still quite a few cases of acute fluoride poisoning in small children every year (Shulman & Wells, 1997) and not surprisingly they are mostly caused by ingestion of large amounts of fluoride containing toothpaste. Just now I made the calculation and my son was probably never in danger of overdosing due to the fact that the water we get here in Helsinki from our local utility supplier Helsingin Vesi is very low in fluoride (0.1 mg/l or 0.1 ppm). He brushes his teeth twice a day and uses each time a pea-sized amount of tooth paste (equaling about 0.15 g). The toothpaste he uses (OralB Stages) contains 0.11% sodium fluoride (equaling 0.05% fluoride). This means that if he swallowed all of his toothpaste he would ingest 0.15 mg of fluoride per day. This is 30% of the daily amount of fluoride supplementation recommended by the American Dental Association for children between 3 and 6 years of age and still less than the daily amount recommended for children of ages between 6 months and 3 years (0.25 mg). I have not encouraged him to swallow the tooth paste although there seems nothing to argue against doing so apart from my parental inconsistency. Daddy probably doesn’t know as he changes his mind all the time… But I guess since he is chewing very avidly his xylitol chewing gum , he should be fine even without much fluoride.

WINE regression testing

Sun, 30 Nov 2008 00:00:00 +0000

I am using Textco ’s Gene Construction Kit (version 2.5) do draw my DNA vector maps. Unfortunately this company doesn’t care about Linux users. Therefore I have to use WINE to run the Windows version of the program. Admittedly, I could run VMware, VirtualBox or Parallels, but all that just to run a small program? Unfortunately either the Gene Construction Kit (GCK) is not coded according to standards or WINE is still not able to deliver full compatibility but now and then a WINE upgrade renders the program unable to run. Therfore I had to resort to regression testing to find the version that can still do the trick for GCK. Here is the command listing and what I did:cdmkdir winecvs -z 3 -d :pserver:cvs@cvs.winehq.org:/home/wine checkout wine (password 'cvs')cvs update -PAd -D"2007-06-01 CDT"./configuremake dependmakesudo make installThe source from the date above it the latest that appears to work.

The E-numbers of ADHD-like behaviour inducing food colors and additives

Fri, 28 Nov 2008 00:00:00 +0000

There has been a publication about artificial colors and other food additives influencing children’s behaviour ( McCann, 2007 ), making it more ADHD-like. This is perhaps due to the chemicals’ influence on brain chemistry. This claim is not new, just the methodology (double-blind, randomized). I just checked out this paper and figured out the corresponding E numbers. Unfortunately the research used “cocktails” of these additives and therefore some of these might be harmless. But nevertheless, here is the list:

Chocolate and onion-syrup against cough

Thu, 27 Nov 2008 00:00:00 +0000

Cough serves a useful purpose if it is productive, i.e. if it removes excessive mucus from the airways. However, unproductive cough can be problematic, especially since there seems to be no safe cough medication for children; many of the over-the-counter drugs for treating cough in children have been banned due to their serious side effects. On the search for safe alternatives, I came across commonly used food items which effectively suppress cough and dilate the airways (chocolate) and which (presumably) help against respiratory tract infections (honey and onion).ChocolateTheobromine is used as an effective anti-tussative agent and as a brochodilator ( Usmani 2005 , Simons 1985 ). Therefore it should be possible to achieve the same cough-suppressing effect by consuming cocoa or chocolate. A typical dose of theobromine is 500-1000 mg (i.e. about 10 mg/kg). The theobromine content of cocoa varies between 0.5% and 2.7%. In order to get into the therapeutic range, my son (16 kg) would have to eat about 200 mg of theobromine. The maximal cocoa content he tolerates in chocolate is 85% (which is quite surprising, but since I hardly eat anything below 70% cocoa content he got used to it early on). So he needs to eat about 10-20 grams of very dark chocolate. Children metabolize theobromine quite fast, so the effect is not very long-lasting. My son has agreed to test this and it seems to work.Honey-onion syrupThe other remedy against cough is onion syrup. I take an onion. I prefer red ones as they are not as hot as the white ones. I cut it into very small pieces (cubes of 1-2 mm length) and then I mix them with about the same amount of crystalline, good-quality honey. After a a few hours the mixture becomes liquid as the sugar pulls out the water from the plant cells (osmosis). Then I squeeze out the juice from the mix. One onion per day is the approximate dosage for respiratory tract infections. Honey and onion contain both anti-bacterial compounds, but I haven’t found any good studies showing that this mix really helps. However, unlike the chocolate, this is an old, traditional recipe against cough.

Storage and Handling of Proteins

Wed, 22 Oct 2008 00:00:00 +0000

Reinstallation of packages from a list

Fri, 26 Sep 2008 00:00:00 +0000

If I install a new computer for myself (or if I do a fresh reinstall on an old machine), I want the computer have the software I am used to. To automatize this process, there a different approaches. If you use Ubuntu, you can use Ubuntu One to syncronize your software selection across many different machines (starting from Ubuntu 11.10 Oneiric Ocelot). If you use something else, it is getting tricky. You can use the following commands to generate a list of installed packages and load the list later for installation:dpkg --get-selections > installed-packages.lstdpkg --set-selections < installed-packages.lstdselectHowever, this creates big problems, because the list contains ALL packages including those that are hardware-specific. Actually you are only interested in the user-installed software. For reloading the software onto the same (or an identical) machine, this command works fine, but what if you want to use KDE instead of Gnome on the new computer? You still want to use the same programs, but the commands above will wreak havoc and may even break your desktop experience. Unfortunately I have not found anything better, but to open the text file generated with dpkg and to manually erase all lines that do not contain user-installed software (which is most of them).

tar copying via ssh

Fri, 26 Sep 2008 00:00:00 +0000

tar czv sourcepath | ssh -l username 192.168.0.5 tar xz -C targetpath

mysql server restart

Thu, 11 Sep 2008 00:00:00 +0000

My mysqld runs on Ubuntu Hardy and after replacing the complete mysql data with a dump from another server the “/etc/init.d/mysql stop” command fails, because the system administration account doesn’t work anymore. So I had to recreate it again:GRANT ALL PRIVILEGES ON *.* TO 'debian-sys-maint'@'localhost' IDENTIFIED BY 'password' WITH GRANT OPTION;The password can be obtained from /etc/mysql/debian.cnf.

Neulimburg - Die Siedlung im Wald

Tue, 02 Sep 2008 00:00:00 +0000

The village of Blota was founded in 1771. On Prussian orders, German settlers from the County of Limburg in Hesse set off with their carts, tools and livestock. This is also where the village’s German name, Neulimburg, comes from. Initially, 300 hectares of woodland were cleared and the resulting land distributed amongst the 30 or so farmers. The loamy soil was heavy and not very fertile. To improve yields, a three-field crop rotation system was adopted. Cereal crops were grown on two fields, whilst the third was left fallow. Later, by official order, potatoes and sugar beet were cultivated, and cattle breeding was also taken up. Straw became an export commodity for the army. In the second half of the 18th century, arable farming was intensified and the cultivation of fodder crops such as clover and fodder beet began. Vegetables were grown in the gardens behind the houses, whilst cows grazed in the front gardens. The village was a linear settlement. The houses were made of wood and thatched. Two rooms and a kitchen with washing facilities were separated from the servants’ quarters by a corridor. The corridor led round the back to the stables and the cellar.

The 1998 Annual Lapland Awards (10 year anniversary repost)

Sat, 30 Aug 2008 00:00:00 +0000

Good evening everybody and welcome to the 20th Annual Finland Alumni Lapland Awards. These awards are given in recognition of outstanding achievement in several fields of endeavour while on the 1998 Alumni trip to Lapland. The awards are judged by a panel of judges chosen because they said they would do it. This year it is MJ, MK and MS. The awards are of course only in the (perhaps warped) opinion of the judges, so all comments, congratulations and letter bombs should be sent to them and not to the Academy.

Judah Folkman dies at age 74

Fri, 15 Feb 2008 00:00:00 +0000

Judah Folkman died of a heart attack at Denver airport on January 14. He was in transit to a conference in Vancouver. His importance for the field of vascular biology cannot be overstated; the web is full of his obituaries ( The Lancet , Nature , Cell just to link a few). I personally met him first when he acted as an opponent in Arja Kaipainen’s PhD thesis defense in spring 1997. Dear Nobel prize committee: You were again waiting too long.

Tobi's kindergarten songs

Sat, 08 Dec 2007 00:00:00 +0000

Pikkuiset kultakalat

Pikkuiset kultakalat lammessa uipikkuinen kalaäiti huolestuiuikaa, uikaa jos osaatteja he uivat ja uivat sen uskotteHop-hop-däbä-däbä-hop-hop-huiHop-hop-däbä-däbä-hop-hop-huiHop-hop-däbä-däbä-hop-hop-huiJa he uivat ja uivat sen uskotteAika isot kalanpojat lammessa uiaika iso isäkala huolestuiuikaa, uikaa jos osaatteja he uivat ja uivat sen uskotteHop-hop-däbä-däbä-hop-hop-huiHop-hop-däbä-däbä-hop-hop-huiHop-hop-däbä-däbä-hop-hop-huiJa he uivat ja uivat sen uskotteJättiläis kultakalat lammessa ui…Mini, mini kultakalat lammessa ui…

Sheep

Sat, 27 Oct 2007 00:00:00 +0000

*And always remember: That everyone is doing it is a good enough explanation!

Finding files with find

Mon, 24 Sep 2007 00:00:00 +0000

Finding files with the find command is actually more difficult than it should be. This finds and lists the largest files (more than 200 MB) on the whole file system:find / -type f -size +200000k -exec ls -lh {} \; | awk '{ print $9 ": " $5 }'The same, but simpler syntax:find / -size +200M -lsThis finds the most recently changed files under the current directory:find . -type f -printf '%TY-%Tm-%Td %TT %p\n' | sortAnd this command pipes the results of the find command into another command. First find looks for Quicktime movies (based on the file extension .mov) and then ffmpeg converts them into avi files.find . -name '*.mov' -exec sh -c 'ffmpeg -i "$0" -sameq "${0%%.mov}.avi"' {} \;This commands finds and lists all filenames that contain the string ‘bitcoin’:find . -name '*bitcoin*' -lsAnd this command finds Quicktime movies and deletes them:find . -name '*.mov' -exec sh -c 'rm "$0"' {} \;And this finds files that have been modified (created or updated) during the last 2 minutes:find . -cmin 2This finds crap which you copied over from a Macintosh and which you don’t need under Linux:find . -name '*.DS_Store' -type f -deleteSimilar story here:find . -name '._*' -type f -deleteWhen being in the root directory, this should find all files with the name ‘syncthing’:find . -name 'syncthing' -lsAnd this finds all files larger than 200MB in the /home directory:find /home -size +200M -lsFind recursively all files that end in .gz and count them:find . -name '*.gz' | wc -lFind recursively all files that do NOT end in .gz and count them:find . -not -name '*.gz' | wc -lWhen you want to search recursively through the content of text files, you need to use the grep command:grep -rnw '/path/to/target-directory' -e 'pattern'When you search for PDF files modified in October 2024:sudo find / -type f -name "*.pdf" -newermt "2024-10-01" ! -newermt "2024-11-01" 2>/dev/null

Encrypted backup using BackupPC, LVM and cryptsetup

Sat, 22 Sep 2007 00:00:00 +0000

I do offsite backups using BackupPC. The amount of data increases constantly so I need to add occasionally hard disks. Additionally I want the data to be encrypted, at least after powering off the system that is running the BackupPC application. So I decided to use logical volume management (LVM) and block device encryption (cryptsetup). The following steps were needed (on Ubuntu Feisty):

cryptsetup on lvm on Ubuntu Feisty

Thu, 20 Sep 2007 00:00:00 +0000

I wanted to encrypt my Documents. My home folder is on a logical volume. So I made some space by removing another logical volume and creating a new one, which gets encrypted by cryptsetup. Here are the commands:

E-mail: migrating from kmail to Evolution

Tue, 17 Jul 2007 00:00:00 +0000

I recently switched from kde to gnome and at the same time from kmail to Evolution. There is no easy way to transfer you mail if you have organized it in several mailboxes in kmail. You need to select all messages in a folder and then right-click and save them in mbox format. This step you need to repeat for every folder. Then you can use the import function of Evolution (import from single file). If you can accept that all files end up in the same folder, you can concatenate your .mbox files to save you the trouble of importing multiple files:cat *.mbox > allmail.mbox

Installing awstats on Ubuntu Feisty

Wed, 27 Jun 2007 00:00:00 +0000

I started to use awstats for creating the site statistics on our server. After installing the ubuntu package, there are still a few things that I had to do:

Why some scripts in the cron.hourly directory do not become executed

Sat, 09 Jun 2007 00:00:00 +0000

Because I have a very basic mp3 player that cannot play back anything but ISO-standard mp3s, I often need to re-encode podcasts which my podcast-catcher downloads (I use Amarok). I created bash scripts to re-encode all downloaded mp3s and to generate a new RSS feed based on the directory content where the re-encoded mp3s get stored. However, the scripts did not get executed every hour and the reason was their naming (“podacst_downsampling.sh”). There are quite strict rules how the names have to look like (which I don’t remember), but if you use only a-z characters you should be always fine. After renaming to “podcastdownsampling” everything worked fine.

(Re)installing GRUB bootloader

Sat, 26 May 2007 00:00:00 +0000

We had the following problem on the computer:2 hard drives (hda and hdb).hda contains the MBR (master boot record) and a Windows 2000 install on the first partition. hdb contains Linux (and its first partition is a boot partition that contains a GRUB installation as done by the RedHat 9 installer).In the BIOS you can only specify one hard drive into the boot priority sequence and that was hda (probably defined by it being the master on the first IDE chain). Therefore we had to start Linux from a boot floppy (because the floppy drive had boot priority over the hard drive). To get a functioning GRUB, we did the following:$/sbin/grub (starting grub shell)grub> root (hd1,0) (telling which one is the boot partition where grub got installed)Filesystem type is ext2fs, partition type 0x83 (tells us that it found the partition)grub> find (hd1,0)/grub/stage1(fd0)(hd0,0)(hd1,0)(hd1,1)(hd1,2)(hd1,5)(hd1,6) (this command is maybe not necessary, it apparently list all possible partitions on which the grub bootloader could be installedgrub> setup (hd0)Checking if "/boot/grub/stage1" exists… noChecking if "/grub/stage1" exists… yesChecking if "/grub/stage2" exists… yesChecking if "/grub/e2fs_stage1_5" exists… yesRunning "embed /grub/e2fs_stage1_5 (hd0)"… 16 sectors are embedded.succeededRunning "install /grub/stage1 d (hd0) (hd0)1+16 p (hd1,0)/grub/stage2 /grub/grub.conf"… succeededDone. (this installs the bootloader onto the first hard drive, apparently not into the first partition, maybe into the MBR?)grub> quit (exit the grub shell)emacs /boot/grub/grub.confNow you just have to edit the grub configuration file. Ours looks like this:grub.conf generated by anacondaNote that you do not have to rerun grub after making changes to this fileNOTICE: You have a /boot partition. This means that all kernel and initrd paths are relative to /boot/, eg.root (hd1,0)kernel /vmlinuz-version ro root=/dev/hdb3initrd /initrd-version.imgroot=/dev/hdb1 default=0 timeout=10 splashimage=(hd1,0)/grub/splash.xpm.gztitle Red Hat Linux (2.4.20-19.9)root (hd1,0)kernel /vmlinuz-2.4.20-19.9 ro root=LABEL=/ hdd=ide-scsiinitrd /initrd-2.4.20-19.9.imgtitle Red Hat Linux (2.4.20-18.9)root (hd1,0)kernel /vmlinuz-2.4.20-18.9 ro root=LABEL=/ hdd=ide-scsiinitrd /initrd-2.4.20-18.9.imgtitle Red Hat Linux (2.4.20-13.9)root (hd1,0)kernel /vmlinuz-2.4.20-13.9 ro root=LABEL=/ hdd=ide-scsiinitrd /initrd-2.4.20-13.9.imgtitle Red Hat Linux (2.4.20-9)root (hd1,0)kernel /vmlinuz-2.4.20-9 ro root=LABEL=/ hdd=ide-scsiinitrd /initrd-2.4.20-9.imgtitle Red Hat Linux (2.4.20-8)root (hd1,0)kernel /vmlinuz-2.4.20-8 ro root=LABEL=/ hdd=ide-scsiinitrd /initrd-2.4.20-8.imgtitle Windows 2000rootnoverify (hd0,0)chainloader +1title Floppyrootnoverify (fd0)chainloader +1title Rebootreboottitle Halthalt

Acrobat Reader 5.07 for Linux

Sat, 26 May 2007 00:00:00 +0000

There is an rpm for Acrobat Reader 5.07 for Linux from Gurulabs . It anyway didn’t work on my machine, so I had to stick to the old reader (version 4.05 that is). But today I found a fix on the web:OK, this is the error message:$ /usr/local/Acrobat5/bin/acroread$ Warning: charset "UTF-8" not supported, using "ISO8859-1".$ AbortedBut editing the acroread file (/usr/local/Acrobat5/bin/acroread) really works. After the line:install_dir=/usr/local/Acrobat5/Readerjust insert these two lines:LANG=Cexport LANGBTW you need to have root accession rights to be able to modify the acroread file.

Audio CDs to the Rio 500 mp3 player using Linux

Sat, 26 May 2007 00:00:00 +0000

OK, it is easier on a Mac. iTunes is free and does it all for you (and does it well). To replace iTunes I need at least three applications on Linux :-(

Binhexed attachments and Mozilla (hexbin, macutils)

Sat, 26 May 2007 00:00:00 +0000

OK, today I tried to open the final version of the manuscript for Cell & Tissue Research. My boss sent it to me as an e-mail attachment some 2 weeks ago. I use Mozilla Mail and saved the attachment. Open Office didn’t manage to open it. Obviously my boss uses still Macintosh binhex encoding to attach files to his e-mail instead of MIME to make himself as incompatible to the rest of the world as possible. There is luckily the command line utility hexbin in Linux, which converts the binhexed file into some readable stuff:hexbin -3 Lymphangio_review_CTR.docThat is the theory. The conversion didn’t succeed with the error message “unexpected EOF”. I suspected that Mozilla was involved and thus I used pine to extract the attachment and voila hexbin managed to convert the macintosh-gibberish into three files.For these three different files the only useful part (the Word Document data) appeared as Lymphangio_review_CTR.doc.data. From this I still had to delete the .data ending and Open Office had no problems anymore to open it. Whow. It took me only 2 hours to figure out all that stuff (including to set up pine locally to access the e-mail server via SSL-secured connection). I still have to figure out why Mozilla Mail handles binhexed attachments wrongly…The hexbin utility is e.g. included in the macutils package (available for Suse and RedHat).

BitTorrent

Sat, 26 May 2007 00:00:00 +0000

Today I installed the latest in file sharing: BitTorrent. Was a bit cumbersome as I first had to install wxPython. And to install wxPython, I needed wxGTK. There is apparently a RedHat9 RPM around, but the download site was down all day long, so I got the source wxPythonSrc-2.4.1.2.tar.gz from sourceforge. After that I tried to download the RedHat9 CDs as I need a clean Linux install to test Adobe Acrobat 5.0.7 and Crossover Office (Acrobat 5 crashes immediately after start on my RedHat9 system and the Crossocer Office seems also to be somehow compromised by excess fiddeling). BitTorrent is said to be very fast. So far the download rate is 23 kB/s.

Changing the Runlevel (inittab, telinit)

Sat, 26 May 2007 00:00:00 +0000

Usually you change the default runlevel by editing /etc/inittab. However, sometimes you boot into runlevel 3 (e.g. by selecting safe mode from the grub menu) and then want to change to runlevel 5. This you accomplish on the fly with the command: telinit 5In RedHat 9, just change in the /etc/inittab file the runlevel from 5 to 3 and you will have only the command line left by default upon booting. No X11 graphical login etc. In newer Ubuntu releases, this apparently doesn’t work anymore, although telinit + number should still change the runlevel, but at least in the Precise Pangolin (12.04), telinit 2-5 appears not to do anything. Telinit 1 tries to shutdown the machine, but the shutdown got stuck halfway when I tested it. To achive something similar to changing to runlevel 3, you will have to shutdown the GUI (meaning to kill the gdm or lightdm process). The runlevel concept seems to be dead.

Comparing two directories (diff)

Sat, 26 May 2007 00:00:00 +0000

diff -r path1 path2

Creating a shared directory under Linux

Sat, 26 May 2007 00:00:00 +0000

When two users on Linux need to share files, accession rights can be quite a problem. By default only the one who creates the file can read and modify it, even if it is saved in a directory that is accessible by the other. It appears to me still impossible to solve this problem completely as Linux cannot “inherit” privileges to newly creates/saved files based on their parent directories privileges (BTW: how has Mac OS X solved this problem?)The following instructions create a shared directory, but require additional tweaks.As root

Floppies and Linux

Sat, 26 May 2007 00:00:00 +0000

Since I started to use html and CSS to create my presentations (instead of OpenOffice instead of Microsoft Office), even quite large presentations fit on regular 1.4MB floppies. Thus I popped an empty floppy into the drive and formatted it as ext2. Funnily the GUI floppy mounter is not able to recognise the file system when it is set to autodetect. Thus I formatted as MS-DOS and the autodetect file system works. Strange…

Hot-swapping different user GUIs under Linux

Sat, 26 May 2007 00:00:00 +0000

I read that Windows XP has a “new” feature that lets users hot-swap their desktops. Instead of logging out, a user can put his session into the background and another user can log in. This is of course very useful if you are downloading large files or running services and you don’t want to interrupt the process. If figured out that Linux is able to do the same already for years:When I have a process with a GUI running in GNOME (or KDE; let’s say lmule) and another user wants to access his account using GNOME and I don’t want to terminate my own GUI session, I switch to another (virtual) terminal via Ctrl-Alt-F2 and the other user logs in and starts an x session (“startx – :1”). Using RedHat 9, the new x session started from F2 is initially accessible via both consoles (F2 and F8).When the other user has finished his work, I can without problems go back to my GNOME with Ctrl-Alt-F7 and resume whatever I have been doing under GNOME.However, when the other user wants to access again his x session, it can only be accessed via Ctrl-Alt-F8. When switching to the F2 console one might get the impression that X has crashed (which is not the case).If the Ctrl-Alt-Fx combination doesn’t work, you have selected a wrong keyboard layout (one that is not meant for x windows sessions, but for a command line terminal). You can switch to correct terminal via the GNOME keyboard layout switcher. The GNOME keyboard layout switcher is an applet that you can add to your panel (click the panel in an empty area, add to panel, utility, keyboard layout switcher). To choose a correct keyboard layout right-click the keyboard layout switcher icon in the panel, Preferences, Add. When you click the triangle in front of the different languages and then the triangle in front of the country, you sometimes see two different options (in my case: Finnish keymap and Finnish xkb keymap). You should choose the xkb keymap, otherwise Ctrl-Alt-Fx won’t work.

How do I run the Gene Construction Kit under Linux?

Sat, 26 May 2007 00:00:00 +0000

There are only a few Mac or Windows programs that don’t have a good equivalent on Linux. One of these few is the Gene Construction Kit (GCK) from Textco . GCK is available for both Windows and Mac. So it should be possible to run it on an i86-Linux machine using wine (a sort of emulator). I tried that and failed (I didn’t try really hard). However, probably any Windows program can be run under Linux using VMware . Unfortunately VMware is commerical and expensive (but there is a fully functional time-limited demo). GCK does run under VMware 4.0/W2K/RedHat9 without problems. The only disappointment in VMware is the “Shared Folders” option. It is much better to share your Linux home directory via Samba and then have it automounted when you log into your emulated Windows OS. I even managed to hide Linux-specific files in my home directory that start with a dot (like .mozilla) by inserting “hide dot files = yes” into the samba configuration file /etc/samba/smb.conf. Although I am using VMware at the moment, I plan to switch to Wine in order to avoid any Microsoft code.

lmule and xmule trouble

Sat, 26 May 2007 00:00:00 +0000

Suddenly lmule stopped working (or xmule). Somehow files is the ~/.lmule/ can get easily corrupted. Just remove all the files (or even delete the whole directory) and the program works again. Don’t forget to save the files from the Temp and Incoming directories! You can copy them later back into the newly created ~/.lmule/Temp and ~/.lmule/Incoming directories.

Mac-Linux Connectivity (netatalk, atalk, Appletalk)

Sat, 26 May 2007 00:00:00 +0000

Connecting from a Macintosh to LinuxI did this already a while ago, but just for documentation purposes: You need to install a Appletalk server on your Linux machine. The package you need is called netatalk. Things worked OK, I just had a problem concerning Appletalk zones. Despite setting the default zone in the atalkd.conf file as “Biomedicum cancerbio” (the zone I want to be in), netatalk overrides this upon service restart. Thus my linux machine ends up always in the default zone (which is called in Finnish “Kadotus”).The atalkd obviously has to negotiate the zone somehow with the router, but how? Macs obviously manage to stay in the zone that they specifcy in their Preferences. They only end up in “Kadotus” when they do not specify a zone, consequently it should be possible to do so as well under Linux. By try and error I figured out that changing the zone in /etc/atalk/atalkd.conf doesn’t do the trick. One has to delete the default entry in /etc/atalk/afpd.conf and replace it by another entry (in Suse 9 the location is /etc/netatalk instead of /etc/atalk):"Michael's Linux Box@Biomedicum cancerbio" -transall -uamlist uams_clrtxt.so,uams_dhx.so -nosavepasswordand then the definition of the shares (in the AppleVolumes.default):"Public" -uamlist uams_guest.so -loginmesg "Welcome guest!"However, netatalk is actually only needed in order to connect from older Macs to Linux. Mac OS X can run SAMBA and to my experience file sharing using SAMBA is more reliable than netatalk. Long file names (I think >31 characters) got netatalk to choke in several cases, while SAMBA did the trick without any problems. Both Mac OS X and Linux support filenames >31 characters, but apparently netatalk doesn’t.Connecting from Linux to MacintoshNow this depends on whether you want to connect to a Mac running OS 9.2 or below or Mac OS X. To be able to connect to a Mac running OS 9.2 or below, you need the afpfs module. This module is not maintained and the last compilation has been done for the 2.1 kernel. Meaning: you are most probably out of luck unless you are a real geek (or you use the still the 2.1 kernel). In order to connect from Linux to Mac OS X, you just should use SAMBA. In GNOME you just need to type smb:// into the Location field of the Nautilus browser window and you will see the domains/workgroups/computers that are visible on the network. I admit network discovery is quite slow. So if you know the workgroup or domain name (e.g. mcbl as in my case), just type smb://mcbl

Mount Samba shares (why doesn't Nautilus work?) and making smb mounts permanent

Sat, 26 May 2007 00:00:00 +0000

Mount Samba sharesApparently it is very easy to connectfrom within Nautilus to Windows computers (or rather to computers running smb services). The only thing you have to do is to type smb:/// into the URL bar and the network is browsed for available domains, workgroups and services. However when one tries to open some files (e.g. some image) there often appears the error message that those files cannot be accessed via samba.What to do? I figured that when you mount smb shares, that this works correctly. In order to mount my user directory on another computer this is the command:sudo mount -t smbfs -o username=michael,password=here_goes_my_password //paula/michael /mnt/smbpaula is the netbios name of the other computer and michael is the name of the share.You can also set the owner of all the files of the mounted file system with the -o uid=owner option:sudo mount -t smbfs -o username=michael,password=here_goes_my_password -o uid=500 //paula/michael /mnt/smbIf you don’t want to type your password, you can save it in a file like this:username=susannepassword=0sdf7band then you can refer to this “credentials” file:sudo mount -t smbfs -o username=susanne,credentials=/home/susanne/.smbpasswd //patolmac217/susanne /mnt/smbIn order to unmount use:sudo umount /mnt/smbThis mostly fails as you are likely to have some open windows/terminals that keep the connection active. Close them and try again. You also might try umount -f.Making smb mounts permanentWhen you mount an SMB share, it will be gone upon system restart. To make it mount automatically during system bootup, you have to create a new entry in the /etc/fstab file. In my case e.g.://paula/michael /mnt/smb smbfs credentials=/home/jeltsch/.smbpasswd 0 0In the .smbpasswd file is my username and my password. Probably not very safe, but who cares? .smbpasswd should be anyway only readable by yourself!

Mounting disk image files and encrypted filesystems/partitions

Sat, 26 May 2007 00:00:00 +0000

To dump a disk (or a partition) into a file, you use the following command:dd if=/dev/hda3 of=file.binThis command writes the complete data on the hda3 partition into the file file.bin.To mount the filesystem that is in the file, you need to create a loopback device:losetup /dev/loop0 file.binNow you can mount the filesystem as usual:mount -r -t filesystemtype /dev/loop0 /mnt/mountpointApparently, one can combine the last two commands into one:mount -t filesystemtype -o loop ./file.bin /mnt/mountpointIf you want to encrypt the data on a file, that contains a whole filesystem, it is getting a bit more complicated:sudo mkdir /mnt/secure (create mount point for the filesystem)dd if=/dev/zero of=path/to/file bs=1k count=409600 (create an empty file with 400 MB size) sudo /sbin/losetup -e xor /dev/loop0 path/to/file/sbin/mkfs -t ext2 /dev/loop0 409600 (format the device as ext2)sudo mount -t ext2 /dev/loop0 /mnt/secure (mount the device file)cd /mnt/securechown username . (change the owner of the top level directory of the filesystem)If you want to unmount the filesystem:sudo umount /dev/loop0If you want to get rid of the filesystem, you have to un-associate it from the loop device 0: /sbin/losetup -d /dev/loop0For some reason RedHat 9 doesn’t come with DES support, so for the time being (until I patch the kernel or move to Suse Linux) I am using the faster, but much weaker xor encryption.Suse 9 comes with inbuilt strong encryption and offers already during the installation the possibility to create an encrypted partition. Suse 9 asks during booting for the passphrase to mount the encrypted filesystem. The boot process stops and waits for 2 minutes before continuing if you don’t type in the password. In order to reduce this time, you can edit the file /etc/init.d/boot.crypto. Change in the following line 120 to e.g. 10::${TIMEOUT:=120}If you have missed your chance to type in the passphrase during boot time, you can mount the encrypted partition as follows:/sbin/losetup -e twofish /dev/loop0 /dev/hda7 mount /dev/loop0 /media/confBTW: The information about encrypted filesystems resides in /etc/cryptotab.

rio500-0.7-1.i386.rpm works under RedHat 9

Sat, 26 May 2007 00:00:00 +0000

I again tried to compile rio500-0.8.1, but without success. Compiling fails under kernel 2.4. This is an unresolved issue and mentioned in the discussion forums. So I installed the Rio500 package rio500-0.7-1.i386.rpm. Interestingly I managed via the command line to a) format the internal memory: rio_formatb) create a folder (which is necessary before one can upload a song): rio_add_folder c) upload mp3s: rio_add_song ). That’s a big advantage to the crappy Windows Rioport interface. Next time I try to install the Gnome GUI.When listening to the first songs on the Rio500 that I transferred under Linux, they appeared very silent. When I encode next time some songs I should try the lame option –scale . However, I don’t know what argument to use to get some decent amplification of the sound.

Some partition rearrangements under Linux

Sat, 26 May 2007 00:00:00 +0000

The Linux installation is as follows:/dev/hdb1 100 MB /boot/dev/hdb2 8 MB /home/dev/hdb3 8 MB //dev/hdb4 Extended partition/dev/hdb5 1 GB Linux swap/dev/hdb6 100 GB NTFSThe idea was to use the 100 GB partition (/dev/hdb6), which has been formatted with the NTFS (= Windows 2000) file system to store large files under Linux. NTFS file systems cannot be used by Linux yet. The only DOS/Windows filesystem, that is compatible with Linux is FAT32. Unfortunately FAT32 is a quite inefficient system and has a maximal partition size of 32 GB (actually Windows can use FAT partitions up to 127 GB, but it cannot format them itself, one needs a third party utility to format them). Anyhow, Linux can only read and write to FAT partitions up to 32 GB. An additional requirement is that /dev/hdb6 should be mounted to two different mount points. Therefore we have to split this partition into 2 smaller ones. Now this appeared to be impossible under Linux. The reason of this is - like with so many other things that suck - Bill Gates. Similar to his “640KB RAM is enough for everybody” decision, he decided that only four primary DOS-type partitions can be on one physical hard drive. Soon this appeared to be too little and thus a work-around was introduced: “Extended Partitions”. One of the four primary partitions of a disk can be a so-called “extended partition” and contain several (actually I think unlimited amount of) logical partitions. Thus in the above layout of the hard disk /dev/hdb partition number 4 (/dev/hdb4) is an extended partition. It contains two logical partitions: /dev/hdb5 and /dev/hdb6. The problem is the following: The Linux utilities cfdisk and fdisk cannot access these two logical partitions separately. If we want to split /dev/hdb6 into two smaller partitions, we first have to delete this partition and then create two new ones in its place. But both cfdisk and fdisk can only delete /dev/hdb4 as a whole. That would delete the Linux swap partition (quite a disaster while you are running the operating system).The way how to solve the problem is the following: Boot into Windows 2000, delete the 100 GB NTFS partition and created two smaller ones instead (/dev/hdb6 and /dev/hdb7). You have to format them FAT32 or NTFS as Windows cannot do anything else. If you have Partition Magic 8 or higher (preferably on a boot floppy), you can immediately format the two new smaller partitions as Linux partitions (that is: ext2 or ext3). Reboot into Linux. Funnily when mounting the partitions that were formatted using Partition Magic 8, already 5 percent of the space is already occupied although there are no files anywhere (at least this is what the Hardware Browser/Hard Drives utility shows). To reclaim this lost space you have to reformat them under Linux using the command mkfs.ext3 /dev/hdb6. If you want to use the newest (and probably one of the best) file system for Linux, you can format them with the ReiserFS file system (command: mkfs.reiserfs /dev/hdb6). Reboot and add those partitions into the fstab file to automount them on startup.

Startup script for VNC server

Sat, 26 May 2007 00:00:00 +0000

To start up the VNC server automatically as a service during booting, you need this shell script . You probably also can write a much simpler shell script yourself, that does the same job. In fact you will have to as this script is broken on RedHat 9. The simplest shell script is of course the command “vncserver” alone… This script goes into the folder /etc/init.d. Then you make a symbolic link in the directory /etc/rc5.d that points to the script. The /etc/rc5.d directory contains a bunch of links to scripts in the init.d file which are executed when the system is entering runlevel 5 (runlevel 5 is the one where you have the gui and multiple users enabled, the one you most likely use in 95% of all cases). There are other directories for other runlevels (e.g. /etc/rc3.d for runlevel 3, etc.).

The ls command

Sat, 26 May 2007 00:00:00 +0000

I have been using is for years, but hardly have used its “advanced” options. That is:ls -t to sort the content of the directory according to modification date. ls -d to display the directories and not their contents. ls -alh lists the complete content of the directory in long, human-readable form (that means file sizes are given in B, K, M or G and not in bytes).The -d option I mostly use as: ls -d .* This shows me all “hidden” directories which are located in the current directory. If I just typed ls .* I would get a recursive listing of all contents of all hidden directories.

The sticky bit, bzip2 and automatic start of programs upon login

Sat, 26 May 2007 00:00:00 +0000

The sticky bitI am still wondering what exactly the “stick bit” in the file permissions is doing. My suspicion is that if the sticky bit is set for a directory in the group field (chmod g+s foldername) that the permissions are inherited (that is all newly created files in that folder and below will have the same permissions as their parents. But maybe I am wrong as there is still the weird “umask” command that influences permissions of newly created files. I have to figure out how to automatically set the permissions of a specific directory (which is going to be shared among different users to g+rw.bzip2 and bunzip2To uncompress a bzip2 file, execute the following command:bunzip2 filename.txt.bz2 (where filename.txt.bz2 is the name of the file you wish to uncompress). The result of this operation is a file called filename.txt. By default, bunzip2 will delete the filename.txt.bz2 file.Automatic start of programs upon loginTo start up automatically a program upon login, e.g. gaim, I just added the following line to the end of my .bash_profile: “gaim &”. I don’t know whether it’s a good way to implement it like this but it works. I then did the mistake to start the vncserver with this method. What happend was, that upon logging in, the vncserver started up. And of course .bash_profile got executed within the first xdisplay of the vncserver (which happens in case of Red Hat 9 to start up KDE as window manager). So from within this session another instance of vncserver was started. this repeated itself until I had about 80 vncservers running on my machine and the speed slowed down dramatically.

VNC (Virtual Network Computing) via ssh

Sat, 26 May 2007 00:00:00 +0000

I am sitting at home and want to use the GUI of my Linux at work. But my work computer which is running the VNC server (mcblpc2.hi.helsinki.fi) is behind the University firewall. The only connection I can get into the firewall is via one of the university mainframes, e.g. vesuri.helsinki.fi. In order to connect using VNC, I need just two commands:ssh -L 5901:mcblpc2.hi.helsinki.fi:5901 mjeltsch@vesuri.helsinki.fivncviewer localhost:1To make the connection faster, you can use compression (helps only if you have a slow connection, e.g. a modem). When using VNC with ssh, the vncviewer really thinks you make a connection to the local machine and therefore chooses a wrong encoding. So the second command actually should be: vncviewer localhost:1 -compresslevel 0 -encodings "copyrect hextile"When you run the vncserver on a computer that has its own firewall, you need to have sshd running and to open the ssh port (22). Then you establish a tunnel from that ssh server on that computer to a port on your local computer:ssh -L 5901:remotemachine:5901 username@remotemachine vncviewer localhost:1When you run KDE desktop sharing on Suse 9.0, you share the physical screen (:0). Thus, if you are logged out, you cannot connect using desktop sharing. You have to start up additionally a vnvserver instance:vncserverThis server will use by default the :1 session and that’s why the forwarded port must be 5901 and not 5900 (like for the first session).

What corresponds to the Windows ipconfig /all command in Linux?

Sat, 26 May 2007 00:00:00 +0000

I think /sbin/ifconfig displays at least the ip address, the hardware address and the subnet mask and some other stuff. But not much about anything else like DHCP or DNS addresses…

Wine and Crossover Office

Sat, 26 May 2007 00:00:00 +0000

Being fed up with VMware (because it’s so slow and using half of my memory) I turned to Wine . But Wine appears to be very difficult to set up. Typical Linux. It will work but unless you spend a whole week you don’t get it working. That’s where the Corssover Office application comes in. It’s just a bunch of helper applications to make setting up wine easy. That is with certain Windows applications and most Windows applications are not supported. So I got a demo version of Crossover Office and started installing (as root). The application installed without problems. After installation I started the Crossover Office Setup application. That is the place from where you install your Windows applications. So I wanted to try Microsoft Office XP (as it is licensed for the whole university). I made the mistake to select “Install everything”. The installer forced me to install also Microsoft’s Internet Explorer and a bunch of other crap. Than the Office XP installer stopped to respond in the middle of the process. Waited for 2 hours but the progress bar didn’t move and there was no disc activity. So I had to cancel the setup and leave a mess behind. A second attempt to install failed as well. So I thought to use the Windows uninstaller. Failed as well. Uninstalling from within crossover office failed also. So I thought to uninstall the whole crossover office (there is an uninstall script in the bin directory of crossover office which is hardly mentioned anywhere in the documentation). That worked but apparently didn’t uninstall everything. I still had to manually remove several directories, but worst of all the Gnome menu entries were not deleted. The gnome menu entries are quite a tricky thing since they are not located in one place. Gnome uses some “virtual folder” (vfolder) system to create the menus. That is the menus are assembled on the fly based on several xml files located in several places. But I guess I found all of them and removed the entries manually. I must have made a coding mistake since after this the whole menu was gone. Apparently the mistake was in my ~/.gnome2/vfolders/applications.vfolder-info file. Of course I didn’t have a backup, so I copied the same file from /root/.gnome2/vfolders into my home folder.After that I reinstalled crossover office and only installed Microsoft Word XP and that worked! An nice entry was visible in the menu “Windows Applications/Programs/”. Then I installed Adobe Photoshop 6.01. Installation was painless, but after that, the Microsoft Word entry in the menu had disappeared. Also there was no Photoshop entry under “Windows Applications/Programs/Adobe”. There was only an ImageReady entry. It appears that every newly installed application erases the menu entries of the previously installed application. However the hierarchical folder structure remains, only the last entry ins gone and replaced by a dot in the last menu folder. BTW Photoshop worked as one can start it up from within ImageReady.Both Office XP and Adobe Photoshop are applications that are “supported” by the Crossover Office. Now I tried to install an unsupported application, i.e. the Gene Construction Kit 2.5 (GCK2.5). The first thing was that the Crossover Office complained that the installer CD has some hidden files and that I have to make some changes to the fstab entries as root to enable reading these files. I did that and continued installation. The installer finished and there was a menu entry under “Windows Applications/Programs/Gene Construction Kit 2.5” which was named “Uninstaller”. I concluded that the Uninstaller program had been installer after the GCK2.5 application and thus erased the latter entry. Even more strangely after logging out and in again even the Uninstaller item was gone from the menu. Also all other program entries had disappeared.I figured that all the menu entries are single files in the directory /home/jeltsch/.gnome2/applications. They have the extension .desktop and are xml files with a relatively easy structure. One example:> more Internet\ Explorer.desktop[Desktop Entry]Name=Internet ExplorerType=ApplicationComment=Internet ExplorerExec=/opt/cxoffice/bin/wine “C://Program Files//Internet Explorer//IEXPLORE.EXE” X-Created-by=cxoffice Icon=/home/jeltsch/.cxoffice/dotwine/fake_windows/Windows/Icons/9d75_iexplore.-32528.xpm [jeltsch@mcblpc2 applications]$ more CXTree-Windows_Applications-Programs-Internet_Explorer.desktop[Desktop Entry]Name=Internet ExplorerType=ApplicationComment=Internet ExplorerExec=/opt/cxoffice/bin/wine “C://Program Files//Internet Explorer//IEXPLORE.EXE” X-Created-by=cxoffice Icon=/home/jeltsch/.cxoffice/dotwine/fake_windows/Windows/Icons/9d75_iexplore.-32528.xpm Categories=Application;X-cxoffice;X-CXTree-Windows_Applications-Programs;It appears that all entries that were made by the Crossover Office Installer are still present in this directory. Now I just have to figure out why they don’t show up. Of course I can start the applications by just typing the entry under Exec into the command line but that is somehow cumbersome. To test GCK2.5 I started it from the command line and it really came up. First it asked for the installer CD (some kind of copy protection mechanism). It was in the drive but somehow I had to eject it and insert it again to make it visible. That worked fine and the dialog appeared where I entered my name and organization. But then it miraculously complained: “Could not start the application because there is not enough memory”.Now I have to tackle this problem, because GCK2.5 is probably the most important application for me that has not Linux equivalent.

BackupPC (and MacOS X)

Fri, 25 May 2007 00:00:00 +0000

BackupPC seems to be a cool application. Except for the fact that it is not easy to start working with in the first place. I downloaded BackupPC-2.0.0.tar.gz and installed it into the directory /usr/local/backuppc. Then I executed the config.pl and answered all I could. The place where I want to backup my stuff is my second hard drive /dev/hdb5 which is formatted as reiserfs and mounted at /mnt/hdb. After the config script there was a new directory in /mnt/hdb: backuppc, which contained 6 other directories: conf, cpool, log, pc, pool and trash.BTW you cannot use a smbmount to store the backup data (at least not easily). The configure.pl script tries to chown the stuff on the smbmount and this leads to the abortion of the perl script (could be modified and the chown could be done manually by defining the correct uid and gid in the fstab). I struggled with this for a day (gave the smbmount even fmask=777,dmask=777 and the correct owner/group), but to no avail as apparently the scripts wants to execute the chown command. I probably need to solve this problem as I need to backup via the network to a Macintosh running OS X and thus need to use samba (or nfs…).I use tar over ssh to backup my client (actually server and one of the clients are in my case physically the same machine). Anyway I have to setup ssh. As I have RH9, it’s OpenSSH (ssh2).Another client is running MacOS X (10.3). Works quite well after I figured out that the tar command on MacOS X is neither in the PATH nor in its normal location, but in /usr/bin/tar. I just made a link and BackupPC worked:sudo ln -s /usr/bin/tar /bin/tar

Changing environment variables (env, csh, bash)

Fri, 25 May 2007 00:00:00 +0000

I just install BackupPC. The perl install script complains that my environment variable LANG is set to en_US.UTF-8 and that it should be en_US. This setting is specificed in RedHat 9 Linux in the file /etc/sysconfig/i18n. To check what is the current value of the LANG variable type echo $LANG. To change or set the variable to en_US type LANG=en_US To show all environment variables, just enterenvat the command line.If you want to set an environment variable, you need to know what shell you are using. Many instructions still assume that you are using csh, but I guess it’s maybe only 1% of Linux users that use it. E.g. in the bash shell use the following command to set the environment variable DESTDIR to /usr/localexport DESTDIR=/usr/localwhile in csh typeDESTDIR = /usr/local

Connecting the external hard drive to my computer (Maxtor One Touch 200GB, FireWire & USB 2.0/1.1)

Fri, 25 May 2007 00:00:00 +0000

The hard drive was connected to Redhat9 Linux via firewire and the hard drive had a reiserfs filesystem. It was supposed to be used for backups, but suddenly stopped working (it was not anymore recognized during system startup). Probably that had something to do with the external USB zip drive. Both are apparently visible to the system as SCSI devices and the zip drive might have (via automount) occupied the sda number that was manually added to /etc/fstab to enable the Maxtor hard drive. To check whether everything is OK with the drive itself, I connected it to my work computer. My work computer, however doesn’t have a fire wire card, so I had to use the USB port. This shouldn’t make any difference as both USB and firewire are somehow treated as SCSI devices.I only edited /etc/fstab adding the following line:/dev/sda1 /mnt/usbhd1 reiserfs defaults 1 2I first forgot to create the directory /mnt/usbhd1. Thus after restarting the drive was not mounted. I checked with /sbin/fdisk -l and there was the following entry/dev/sda1 Windows 95 (or something like that)Funnily the resiserfs file system shows as a fat filesystem. I changed the “reiserfs” entry in /etc/fstab to “vfat” and created the directory /mnt/usbhd1. During startup there was an error (something like “no fat filesystem could be found on the partition”). So I changed it back to reiserfs, rebooted and the external drive was mounted during startup without problems.

Debugging GCK2.5 under wine

Fri, 25 May 2007 00:00:00 +0000

GCK2.5.9 works with wine (crossover office 2.01 version). The 2.5.9 update doesn’t show the “Could not start the application because there is not enough memory” error. GCK starts up without any trouble and is partially usable. In fact it seems to be fully functional (including Deluxe import) with one big exception: new files cannot be created (quits upon selecting “File - New”. The empty window box where you can select what type of GCK file you want to create (sequence, illustration, etc) is drawn with the title “New Window”, but its not filled with content and the application quits.

Dubugging GCK2.5 under wine

Fri, 25 May 2007 00:00:00 +0000

The new window that fails to be displayed, contains (when run natievly under W2K) the following text (and radio buttons for the four different file types):Select File Type Contruct (Ctrl-C)Illustration (Ctrl-I)List (Ctrl-L)Gel (Ctrl-G)New File NameOKCancelThe text associated with the different radio buttons appears first in the debug file in the following lines (as determined by the command “grep -n “List” all_output > List_output”, etc): 3890577 Gel3885836 Illustration3881107 List3876329 ConstructThat is within the range where we predicted the error to be. Let’s now look at what happend shortly before and after these commands were issued. After using GCK2.5 under wine a little bit more, I noticed that there is another function that causes the program to crash without error message, namely the “find sequence” function. Also in this case a dialog is displayed in which the user is supposed to type in a nucleotide sequence. Maybe there is something in common for these two crashes which could help to identify the crucial system call that makes the program to crash.

Gnome & KDE sessions autostart items

Fri, 25 May 2007 00:00:00 +0000

Always when I logged into a Gnome session, automatically several application started up without me wanting them to start up (two terminal sessions and a nautilus windows). To get rid of them (at least I think so, I will see at the next login), you have to go to Main Menu - Preferences - More preferences - Sessions. Under the “Current Session” tab, one can remove the programs that are automatically started upon login and also specify in which order the programs are started that are started automatically.In KDE, item in the /home/user/.kde/Autostart directory get executed upon session start. Just place a .desktop file into that directory to have it auto-executed.

grep to search for file content or rpm -qa output

Fri, 25 May 2007 00:00:00 +0000

In order to search a specific directory (path_to_directory) and all its subdirectories (-r for recursive) for files that contain a specific text string, use the following command:grep -r "textstring" path_to_directoryAlso very useful is to pipe the output of another process into grep. E.g. you want to know whether a specific rpm package is installed on your system, but you don’t remember the exact name. Thus you cannot use the “rpm -q packagename”. In that cast you can ask rpm for all installed packages (rpm -qa) and then pipe this output to grep and let grep look for a substring from the packagename that you do remember:rpm -qa | grep substringE.g. when the package modutils-2.4.22-8 is installed you have to ask rpm:rpm -q modutils OR rpm -q modutils-2.4.22in order to get an answer. The request rpm -q modutils-2.4 would be: The package modutils-2.4 is not installed. Thus if you don’t know the exact name of the package, it is a safe bet to grep the rpm output for something you remember exactly.

Location of launchers, panels, etc. in Gnome

Fri, 25 May 2007 00:00:00 +0000

The files that specify the different folders and buttons of the Gnome user interface are somehow really badly distributed all over the place. Here are just a few of the more common locations:Icons in the panel: ~/.gnome2/panel2.d/default/launchers/Contents of Start Here: ~/.gnome2/vfolders/start-here/user’s Home, Trash and Start Here: ~/.gnome-desktop/

Loosing your Windows softly

Fri, 25 May 2007 00:00:00 +0000

I have two hard drives and the partitioning is as follows:hda1 120 GB/dev/hda1 100 MB Linux ext3 /boot/dev/hda2 95 GB Linux ext3 /home/dev/hda3 1 GB Linux swap/dev/hdb4 Extended partition/dev/hdb5 17 GB Linux /hdb1 32 GB/dev/hdb1 100 MB Linux ext3 /boot/dev/hdb2 1 GB Linux swap/dev/hdb3 Extended partition/dev/hdb4 12 GB NTFS Windows2000/dev/hdb5 18 GB Linux reiserfsBoth boot partitions had grub installed (there used to be an old Linux Red Hat 7 install on hdb1). The bios was set to use the first hard drive (hda1) to boot. In order to boot Windows 2000, one needs apparently a Windows-written MBR (master boot record), which is to my understanding something like a hidden partition which is in any case the first partition of any drive (something like hda0). Since there was never Windows 2000 installed on hda1 (is was put later into the machine and put into the bios boot priority first), there was also no Windows 2000-like MBR written into its MBR. The other hard drive (hdb) has a Windows install (Linux was installed later), so there must have been a functioning Windows 2000-like MBR. That MBR most likely was destroyed at some time. This distruction did not happen during the first Linux Red Hat 7 install, as after that one could still boot into Windows 2000 via grub. It must have occurred later somehow (maybe during a grub update?). Then I put the 2nd hard drive in, installed Red Hat 9 and during this install the Red Hat installer put the second grub install onto its boot partition, which did contain a Windows entry (as I specified during the Red Hat 9 installation). Booting into Windows 2000 (which was on the other hard drive) was still possible. But as I never used to boot into Windows (I started to use vmware and then wine), I just recently realized that the Windows entry in the grub.conf had disappeared. Consequently I couldn’t boot into Windows anymore. I entered manually the Windows entry like everywhere advised:title Windows 2000rootnoverify (hd1,1)chainloader +1But no go. I always received an error (Error 13 invalid device). I thought I had chosen the wrong partition and tried all possible partitions from (hd1,0) to (hd1,5). Still no go. Although the error messages were different. For the:/boot partition (hd1,0): Grubloader error 25linux /home (hd1,1): Error 13 invalid or unsupported executable format linux swap (hd1,2): Error 12 invalid device extended partition entry (hd1,3): no error occurred, but I was thrown into the grub menu of the boot partition of the 2nd hard drive linux / (hd1,4): Error 12 invalid deviceany other (higher) partition that wasn’t present (e.g. hd1,5): Error 12 invalid deviceSo I booted with the Windows 2000 installation CD and tried to fix the the MBR of hdb. I went into the manual repair section and typed the fixmbr command. There was a warning: “This operation modifies your partition table and could render all your data on the hard drive inaccessible”. I had no choice, so I did it. It didn’t help. At least not much. Once thing improved, however: when I swapped the drives (made hdb the master and hda the slave and gave in the BIOS boot priority to the new master, I could boot into Windows 2000. That was already some improvement. However, I still couldn’t boot into Windows 2000 via grub. So I booted again with the Windows 2000 installation CD and executed another “dangerous” command: FIXBOOT. This was the end of my Windows. After that I couldn’t boot into Windows at all. I always received the error: ntldr is missing (NT loader is missing). I still managed to use this Windows 2000 installation together with VMware, but otherwise there was no possibility to boot it up. The Microsoft Knowledge Base Article 318728 describes many possible solutions to the “ntldr is missing” error, which I tried all, but without any positive results. Microsoft apparently admits, that this error is unrecoverable in some instances as the last method to rescue such a situation is: “Perform a Parallel Installation of Windows 2000 and use the Windows Explorer to copy the data you want to recover”.

Self-extracting compressed files

Fri, 25 May 2007 00:00:00 +0000

Today I created a self-extracting, compressed file from a pdf document (disclosure.pdf). First I compressed the pdf file:

bzip2 disclosure.pdf

Then I create a text file (header.txt) with the following content:

sudo is not only to sudo (execute files as another user)

Fri, 25 May 2007 00:00:00 +0000

If you want to execute a command with root privileges, you normally use the command “sudo”. But of course you can execute a command also as any other user. E.g. I need to execute some script for my backup as user “backuppc”. then I just type:sudo -u backuppc /usr/local/backuppc/bin/BackupPC_serverMesg status infoInstead of the username (backuppc) one can also use the user id (uid).

Suse 9

Fri, 25 May 2007 00:00:00 +0000

I switched to Suse 9. I can’t figure out from RedHat’s announcements what they are really up to. So I better get used to an alternative right now. I also switched from Gnome to KDE and at least on Suse 9, I like KDE more than Gnome on Red Hat 9.

Changing job priority under Linux

Thu, 24 May 2007 00:00:00 +0000

If the job is already running use:renice 19 -p 2478This gives the job 2478 (as identified with ps -aux) the lowest possible priority. renice -20 would give it highest priority. If the job is not yet running you can execute it with nice command:nice +19 amuleto execute amule with lowest possible priority) andnice -20 amuleto execute it with highest priority.

Editing the crontab

Thu, 24 May 2007 00:00:00 +0000

We have a shared directory (/home/shared) on our computer and a usergroup called “shared”. The purpose is that we put things there that should be accessible (including writable) to several users of the system. If one user puts a file there, it can be read by others but not e.g. deleted. In order to fix this, we edited the crontab to execute every 5 minutes the following two commands: chgrp -R shared /home/sharedchmod -R 744 /home/sharedIn order to do this we edited (as root of course) the /etc/crontab file by adding the line: */5 * * * * root run-parts /etc/cron.minutelyThis means execution every 5 minutes, every hour, every day, every month, every weekday the script run-parts should be executed as root taking all scripts from the /etc/cron.minutely as argument (we created this directory newly in addition to the already existing /etc/cron.hourly, etc.). We restarted crond (the crontab deamon) via the GUI (under RedHat 9 Menu-System Settings-Server Settings-Services).

Installing Staden 2003b on Suse 9

Thu, 24 May 2007 00:00:00 +0000

Download the sources .
cd into /usr/local and become su.
tar -xvzf /home/jeltsch/Documents/staden_linux_2003.0b1.tar.gz (jeltsch is my usename, thus has to be replaced for other users!!!!)

More about GCK2.5 under wine

Thu, 24 May 2007 00:00:00 +0000

After working with GCK2.5 under wine I have identified more bugs that make the program quit unexpectedly. However, now I have not been using cross-over office (as its evaluation period has expired and of course my boss wouldn’t spend a cent for Linux programs). So I am using the default installation of wine that comes with Suse 9. I copied over the fake windows directory from the former .cxoffice directory. The following bugs do exist (they always appear when a window opens that requires you to enter alphanumeric values via the keyboard):1. Create new file (I knew about that before). Interestingly the (empty) new file that opens upon program start can be saved without problems…2. Find sequence (one shortly sees the window “Find occurence” and then the program quits)3. Sometimes (not always), when changing the color of a selected sequence the program quits.4. Features -> Make Region5. When selecting a sequence and getting info

No chown or chmod on samba mounts

Thu, 24 May 2007 00:00:00 +0000

I figured out (hopefully correctly) that owner, group and accession rights to files and directories on an smbmount are not changeable, not even by root. Thus you have to specify everything at mount time, e.g.:sudo mount -t smbfs -o username=jeltsch,credentials=/home/jeltsch/.smbpasswd5 -o uid=backuppc,gid=users,fmask=644,dmask=755 //patolmac217/jeltsch /mnt/jeltsch@patolmac217.hi.helsinki.fi

Problem to access X desktop from a root terminal

Thu, 24 May 2007 00:00:00 +0000

It never happened to me under Red Hat 9, but when I am working in KDE as a normal user and try to execute emacs from a terminal, in which I am su, I occasionally get the following error message:jeltsch@mcblpc2:~> suPassword:mcblpc2:/home/jeltsch emacs test.txtXlib: connection to ":0.0" refused by serverXlib: Invalid XDM-AUTHORIZATION-1 key (failed key comparison)emacs: Cannot connect to X server :0.0.Check the DISPLAY environment variable or use -d’.Also use the xhost’ program to verify that it is set to permit connections from your machine. In order to allow root to access X, you need to execute the following command: mcblpc2:/home/jeltsch export XAUTHORITY=/home/jeltsch/.Xauthoritymcblpc2:/home/jeltsch emacs test.txtOf course, I can use emacs without its GUI and just type:emacs -nw test.txt

ps2pdf

Thu, 24 May 2007 00:00:00 +0000

I got a bit confused about the ps2pdf conversion utility. Some people claim, that it invariably creates pdf files with letter pagesize. However there is the argument -sPAPERSIZE=a4 and that should make pdf files with a4-sized pages. It apparently works. If one uses eps files as input files, ps2pdf puts the eps image directly to the border of the pdf file which gets cut off during printing. There should be some utilities to correct this.

RPM management

Thu, 24 May 2007 00:00:00 +0000

Example: The quanta packagerpm -q quanta Check whether and which version of quanta is installedrpm -ql quanta List all files (and their installation location) that are provided by the quanta packagerpm -ivh quanta Install quantarpm -e quanta Erase (deinstall) quantarpm -aq | grep quanta If you don’t know exactly what you are looking for you can list all packages and grep them with a substring.rpm -q -f filename Search for rpm packages that provide filenameA good manual for rpm managemant: http://www.rpm.org/max-rpm/ .If you want to query an RPM that is not installed, you need the following syntax:rpm -qpl --requires quanta.rpm This would list all requirements and all files that are in the package.cat package.rpm | rpm2cpio | pax -r Extract a file from an rpm package.

Starting up and shutting down network cards

Thu, 24 May 2007 00:00:00 +0000

STARTING:(/usr)/sbin/ifup eth0 (or eth1)STOPPING:(/usr)/sbin/ifdown eth0 (or eth1)STATUS:(/usr)/sbin/ifconfig -a

Using Riositude under VMware

Thu, 24 May 2007 00:00:00 +0000

I have to admit, that there is no really functioning GUI for the rioutils. Meaning that if I want to upload mp3 files to my Rio500 under Linux I have to use the command line (and even the command line seems to be somehow instable as the rpm was created a while ago and compiling fails under the recent Linux releases (Red Hat 8,9, Suse 8, 9). So I used first the Rioport AudioManager 3 under VMware. It is slow and the GUI is as bad as it gets (bloatware). A really cool replacement program for Windows is Riositude . It’s much faster, easier to use and takes not even 200 KB disk space. It works great from VMware provided I start it up immediately after plugging in my Rio500. Otherwise the Linux takes over (I guess a usb kernel module is loaded automatically upon plugging in the Rio). The kernel module has to be removed manually by “sudo /sbin/rmmod rio500” to allow VMware to control the Rio. To check which kernel moduls are loaded, use “/sbin/lsmod”. I should somehow get rid of this module if I want to stick to Riositude/VMware to operate my Rio. There are of course other programs for Windows, that can do a similar job, e.g. Rio FXP . Unfortunately this one didn’t work for us under WindowsXP. A listing of Riosoftware can be found at rioworld.org .

VNC server (aka KDE Desktop Sharing) under Suse 9

Thu, 24 May 2007 00:00:00 +0000

Suse 9 has an inbuilt VNC server called KDE Desktop sharing (under the System -> Remote Access menu). It can be configured in the Control Center -> Internet & Network. Unlike when you start up VNC via the command line (“vncserver”) this tool doesn’t start a new X desktop, but connects to your already existing X desktop. It is possible to run in addition to the inbuilt KDE Desktop Sharing a normal vncserver that starts its own X sessions.

VNC server under Suse 9

Thu, 24 May 2007 00:00:00 +0000

I tried to use vncserver on Suse 9, but to my surprise upon starting up with “vncserver” and then connecting with the “vncviewer” command I only saw the grey screen and an X terminal. I tried to execute xclock and gaim and they start up nicely. However I would also like to bee able to start up KDE. So I looked into the xstartup file (in the .vnc directory in your home folder) from my old Red Hat 9 install and compared it to the one from my Suse 9 install:Suse 9:!/bin/shxrdb $HOME/.Xresourcesxsetroot -solid greyxterm -geometry 80x24+10+10 -ls -title "$VNCDESKTOP Desktop" &twm &Red Hat 9:!/bin/shRed Hat Linux VNC session startup scriptunset SESSION_MANAGERexec /etc/X11/xinit/xinitrcI figured out that twm is a window manager; thus it replaces KDE in this context. If I replace the Suse script by the Red Hat script, KDE starts up upon starting vncserver.

What Text Editor for Linux?

Thu, 24 May 2007 00:00:00 +0000

I have been using emacs (or Xemacs) so far, but now I started to use Nedit . Seems to be quite powerful and fast (although nothing comes close to BBEdit, unfortunately only for Macs).

A good introduction to shell scripting

Wed, 23 May 2007 00:00:00 +0000

http://www.freeos.com/guides/lsst

Adding a Suse 9 to a Red Hat 9 (two different distros on the same computer)

Wed, 23 May 2007 00:00:00 +0000

Red Hat 9 is installed and the following partitioning is present:hdd1 /boot (ext3) 100MBhdd2 /home (reiserfs) 7.8GBhdd3 / (ext3) 7.8GBhdd4 EXThdd5 swap 1GBhdd6 /mnt/documents (reiserfs) 12GBhdd7 /mnt/music (reiserfs) 90GBThe task is to add a second Linux OS (Suse 9) onto this hard disk without destroying anything. The root partition of this system should be 10 GB. Additionally I want to put all user-created files on one partition (now they are on three different partitions: hdd2, hdd6 and hdd7). First I got a 200 MB external USB2/firewire hard drive (Maxtor, mounted as /mnt/sdb1) and copied the data from hdd1, hdd2, hdd6 and hdd7 onto it with “cp -ax /home /mnt/sdb1”, etc. Then I rebooted using the Knoppix 3.3 CD and from a root terminal executed partimage. I tried to save the image of the root partition directly to my external usb drive, but without success: everytime the program halted somewhere during the process. I then saved the image on /mnt/music and that succeeded. I rebooted into Red Hat 9 and copied the image manually from /mnt/music to the usb drive (/mnt/sdb1). Because I didn’t trust the partimage program, I additionally copied the filesystem manually to the usb drive using the following commands: mkdir /mnt/sdb1/redhat_root cd / find . -xdev -print | cpio -padm /mnt/sdb1/redhat_root Apparently this copies everything including special files, mount points, etc. preserving all the file meta data. After this I disconnected the external usb drive (to be on the safe side), rebooted into Knoppix and wanted to try out QTParted. It should be able to resize partitions. From a root terminal: “qtparted”. However, I was not able to resize anything (the options were greyed out). I could delete and recreate though (which didn’t help much). So I decided to go for a clean sweep, popped the Suse 9 CD into the drive and rebooted into the Suse 9 installer. I choose expert partitioning and deleted all partitions that were present and recreated the following partitions. I made sure to use exactly the same amount of blocks (1019) for hdb3 as had been used for hdd3 because I knew that partimage can only restore images onto partitions that have exactly the same size or are bigger:/dev/hdb1 1 8 64228+ 83 Linux (ext3) /boot/dev/hdb2 9 1314 10490445 83 Linux (reiserfs) //dev/hdb3 1315 2333 8185117+ 83 Linux (reiserfs) /redhat/dev/hdb4 2334 14945 101305890 f Win95 Ext'd (LBA)/dev/hdb5 2334 2464 1052226 82 Linux swap/dev/hdb6 2465 14945 100253601 83 Linux (reiserfs) /homeAfter the install had finished, I rebooted into Knoppix and tried to restore the Red Hat root partition onto hdb3. Partimage told me that the partition was smaller than the image, thus a restore was not possible. So rebooted into Suse 9 and manually copied the Red Hat 9 root system back to hdb3 (with the same command sequnce that was used to copy it manually to the usb drive). Then I changed /redhat/etc/fstab to reflect the new partitioning and copied all the files from /boot (but not the subdirectories from /boot) onto the new boot partition (except those files that had already equivalents in /boot). Then I modified /boot/grub/menu.lst by adding a line for the Red Hat install:title Red Hat 9 Linuxroot (hd1,0)kernel /vmlinuz-2.4.20-19.9 root=/dev/hdb3initrd /initrd-2.4.20-19.9.imgI also create the two user folders in the /home directory (which used to be the mount point for the /home partition). But I copy all the hidden files and directories (those starting with a .) into the userfolders.Then I tried to reboot into Red Hat 9. Without success. Kernel panic. No init found. Try passing init=option to the kernel. Actually the file system check of hdb3 failed (no superblock found). There are several error messages and the important ones come first and fast (and you don’t see them) and the bad, misleading error messages come late. Something like that you should manually repair the partition. And that root is mounted read-only. And that you can make it read-write by “mount -n -o remount,rw /”. And that only with Ctrl-D one can reboot into this state. Obviously that’s what I am going to do. However there is no hint about what command to use. Several attempts to do anything while having mounted from hdb failed (if reiserfs is read-only it cannot be repaired, if it is read-write it cannot be checked). So I reboot into Knoppix and do the repair from there: fsck (which executes reiserfsck) doesn’t do the job: it only checks, but doesn’t do any repairs. I figured that flagging reiserfsck –rebuild-sb /dev/hdb3 does repair the superblock. Still no go, so I do the slow complete rebuild of the filesystem from scratch with reiserfsck –rebuild-tree /dev/hdb3. It still doesn’t boot into RH9. Then I get the idea: the RH9 kernel might not support reiserfs (or the module is not loaded). Or (alternatively) copying some special files from a ext3 partition to a reiserfs partition might simply not work. So I delete (from Knoppix) the whole hdb3 and recreate it as ext3. Copy back all the data (QTParted still complains about too small size). And it finally works. I create two directories for the two users on the /home partitons and manually copy into them the non-hidden files of the old userfolders. I don’t copy the hidden files. There are many that would screw up Suse and make it impossible to log in (I had tried that out before). I log into Suse 9 as root and create the two users with exactly the same name as on RH9. There is a warning that the directory exists and that all its content will be owned by the new user. That is OK of course.

Adobe Acrobat 5.0.5 under wine

Wed, 23 May 2007 00:00:00 +0000

I reinstalled Acrobat 5 to run it under wine. It didn’t work. The reason appeared to be again a plugin: DocBox.api. After removing it everything went smoothly. Already before (using RedHat 9) I have had trouble with a Acrobat plugin (it was WebPDF.api at that time). Most manipulation of pdf files can be easily done with Linux tools, but one thing is tricky: cropping already existing pdf files. That’s why I need Acrobat.

Apache on Mac OS X

Wed, 23 May 2007 00:00:00 +0000

I still use one of our ancient Macintoshs (Blue/White G3) as a web server ( msbl.helsinki.fi ). I had set up some access restrictions for some of the pages containing confidential data. And of course I forgot how I did it. Now I needed to figure out as I wanted to add some new stuff. For the general server, the accession is restricted based on individual .htaccess files in directories. In my own user directory ( msbl.helsinki.fi/~michael ) only one folder is access restricted ( msbl.helsinki.fi/~michael/presentations/confidential ). This setting is done in the main configuration file of Apache (/etc/httpd/httpd.conf) and only two users (michael and mcbl) have access via the following entry: AuthType Basic AuthName "Confidental" AuthUserFile /Users/michael/.htpasswd require user michael mcbl

Burning CDs from the command line: cdrdao

Wed, 23 May 2007 00:00:00 +0000

K3b seems to be the best GUI for burning CDs on Linux. But today it failed to burn an image file (bin/cue) and I don’t know why. So I used:cdrdao write --device /dev/cdrecorder --speed 8 filename.cue

Changing sound volume or bitrate of mp3 files with lame

Wed, 23 May 2007 00:00:00 +0000

Sometimes the recording level of mp3 files is very low. If I do some jogging next to a busy road, I cannot hear anything even when the sound volume is on the max. Therefore I have to increase the volume of the mp3 file. Using lame you can do it with the following script: #!/bin/bashwhile [ $# -ge 1 ]; doinfn=$1outfn="${infn%%.mp3}_3x.mp3"echo $outfnlame --mp3input -v --scale=3 $infn $outfnshift 1doneThe only problem is that filnames with blank spaces make this script to collapse. Have to figure out something else. Also the bitrate can be modified in this way:#!/bin/bashwhile [ $# -ge 1 ]; doinfn=$1outfn="${infn%%.mp3}_LQ.mp3"echo $outfnlame --mp3input -V 9 $infn $outfnshift 1done-V 9 is the lowest bitrate/quality -V 0 is the highest.

Changing specific ownerships: chmod --from

Wed, 23 May 2007 00:00:00 +0000

I copied a bunch of preference files (those files and directories whose name starts with a dot) from my old RedHat home directory into my new Suse install. I had backed up the files being root and so all of them were owner:group root:root. In order to only change those files, that had root:root into jeltsch:users I executed from within my home directory:sudo chown -R --from=root:root jeltsch:users .*If you wanted to change all files on the system that belong to one user you could use:sudo chown -R --from=username newowner /

Creating a boot floppy for RedHat 8

Wed, 23 May 2007 00:00:00 +0000

Get the boot floppy image from the RedHat site and write it to a floppy. The floppy should not be mounted while writing:dd if=boot.img of=/dev/fd0That’s actually the command to write any floppy image back to a floppy.

Creating groups and changing group membership in Mac OS X

Wed, 23 May 2007 00:00:00 +0000

I want to store some files on a Macintosh (OS 10.2). They should be in the Public folder, but only accessible (= only readable) by certain people. Thus I would like to create a new group that has accession rights to these files. Strangely, the group command doesn’t exist on MacOS X (chgrp does exist though). I downloaded the User Manager application. But the version for OS 10.2 was not really easy to use. Thus I used the NetInfo Manager. I duplicated an existing group, changed its name to “gck” and id number and added two users (if you have more than one entry, you have to add them in brackets and comma-seperated). Then I created a directory in my Public folder and changed its group to “gck”. Permissions for this directory are drwxr-x—. The files inside this directory also belong all to the “gck” group and have -rwxr—– permissions.

Creating Konqueror Service Menus (aka contextual menus)

Wed, 23 May 2007 00:00:00 +0000

Konqueror Service Menues are additonal options that are displayed when you right-click on a file in Konqueror. They are file-type specific, meaning you can define which options are displayed depending what type of file you are right-clicking. Mac-people call these “contextual menues”. A good tutorial is https://techbase.kde.org/Development/Tutorials/Creating_Konqueror_Service_MenusIn short: In the directory /opt/kde3/share/apps/konqueror/servicemenus there is a buch of desktop files. Just duplicate one, rename it and edit its content to please you. In the following example I have created a new file (pdfpic.desktop), that adds a menu option that is displayed when I right-click jpg files and it starts an editor with which I can add or modify the embedded rdf (resource description framework) information of a jpeg file. The editor is a java application and the %U sais, that if many files are simultaneously right-clicked they should be opened in one instance of the program.[Desktop Entry]ServiceTypes=image/jpegActions=openInRdfpic[Desktop Action openInRdfpic]Name=Edit metadataIcon=backgroundExec=/usr/lib/java2/jre/bin/java -jar /usr/local/rdfpic-2.1/rdfpic.jar %U

Editing (resizing, format converting, compressing) images in the command line with ImageMagick (mogrify, convert)

Wed, 23 May 2007 00:00:00 +0000

Resize all tif images in the current directory:mogrify -resize 25% 25% *.tifResize all jpeg images in the current directory to a width of 614 pixels and keep the image ratio constant:mogrify -resize 614 *.jpgAs above, but resize the hight to 614 pixels:mogrify -resize x614 *.jpgConvert all bmp imgaes in the current directory into tiff images:mogrify -format tiff *.bmpCompress all tiff images in the current directory with ZIP compression:mogrify -compress ZIP *.tiffI tried to convert also pict files (from Macintosh), but without success, although the pict file format appears to be supported by Imagemagick. In order to make sure that ImageMagick knows that the file to convert is a pict file I used this command:convert pict:Photo0024.PICT tiff:Photo0002.tifThere is also a picttoppm utility in the netpbm package, but it was not anymore included in the version that Suse 9 uses; so I couldn’t check that out…Interestingly PixiePlus can display pict files, where does it take the routines from?If you have very large images, the default limits of ImageMagick are resulting in an error(e.g. mogrify-im6.q16: width or height exceeds limit) and you need to edit /etc/ImageMagick-6/policy.xml!

GRAMPS and Suse Linux 9

Wed, 23 May 2007 00:00:00 +0000

At first I thought there is no way to get the GRAMPS genealogy software running on Suse 9. Apparently GNOME support by Suse sucks; the GRAMPS developers even say there are several things broken in the GNOME support of Suse. But finally there is a Suse Linux 9 RPM, that works (at least for us): http://apt.bygden.nu/SuSE/9.0-i386/RPMS.suser-rbos/gramps-0.98.0-rb1.i586.rpm . Here also my favourite way to make a graphical report from GRAMPS (you need to have the graphviz package installed):If you want to make a pdf file:

How to import sequences from SRS into GCK2.5

Wed, 23 May 2007 00:00:00 +0000

Obviously you can import sequences into GCK2.5 directly from Genbank. But usually you are working with a web tool like SRS and end up having your sequences displayed in your browser. From SRS version 7 the import goes as follows: From your fancy display, click SAVE. From the pull-down menu “Use view” select * Complete Entries *. Then “Output to” FILE (TEXT). Check under “Save as type” SAVE TABEL AS ASCii TABLE/TEXT WITH. Click SAVE and save it somewhere with the file extension .ebl. Then from within GCK2.5 select IMPORT and select the file. Ready.

How to mount a NFS export

Wed, 23 May 2007 00:00:00 +0000

sudo mount -t nfs -o rw server:/var/www /webserverormount server:/var/www /webserverThe mount can be put into /etc/fstab, e.g.:server:/var/www /webserver nfs rsize=8192,wsize=8192,timeo=14,intr,userThis doesn’t mount the nfs export automatically during startup, but any user can mount it by executing “mount /webserver”. Be aware that if you have mounted another filesystem under /var/www (e.g. if you keep all html data on a seperate partition like /var/www/htdocs), these won’t be available unless you export the partition’s mountpoint seperately!

How to rescue a bad X configuration during Suse 9 install

Wed, 23 May 2007 00:00:00 +0000

During my first Suse9 install I screwed up X. During the configuration of X the installer suggested to me: vesa 1600x1200@75. I thought I was smarter and went to the manual configuration and selected my Nokia 445Xi monitor from the list. Then it tried to switch into the new mode and gave me buttons to adjust the settings (centering, width, etc.). I did that and after I was satisfied continued the installation. When X was supposed to start up for the first time, my screen showed only “out of synch”. The way how to repair this is: Reboot in safe mode; change in /boot/grub/menu.lst vga=xxx into vga=normal and remove the “showopts” entry. Reboot again in safe mode, change to runlevel 3 (“init 3”) and execute sax2 –vesa 0:1024x768@75. Then I again selected my Nokia monitor but didn’t do the adjustments (I centered and sized the image only via the front panel knobs on the monitor). And everything is fine again.

MySQL install

Wed, 23 May 2007 00:00:00 +0000

After installing the Suse 9 rpm, execute the following commands:sudo /usr/bin/mysql_install_db(Creating default databases & permissions. Apparently the same can be done by “sudo rcmysql start”)sudo /usr/bin/mysqld_safe --user=mysql &(Start the server for the first time)REMEMBER TO SET A PASSWORD FOR THE MySQL root USER ! This is done with: /usr/bin/mysqladmin -u root password 'new-password' /usr/bin/mysqladmin -u root -h hostname password 'new-password'Give all privileges to root and user:/usr/bin/mysql -u root -p Enter password:Welcome to the MySQL monitor. Commands end with ; or \g. Your MySQL connection id is 6 to server version: 4.0.15 Type 'help;' or '\h' for help. Type '\c' to clear the buffer.mysql> GRANT ALL PRIVILEGES ON *.* TO user@localhost IDENTIFIED BY 'Password' WITH GRANT OPTION; Query OK, 0 rows affected (0.00 sec)mysql> GRANT ALL PRIVILEGES ON *.* TO user@'%' IDENTIFIED BY 'Password' WITH GRANT OPTION;Query OK, 0 rows affected (0.00 sec)mysql> GRANT ALL PRIVILEGES ON *.* TO root@localhost IDENTIFIED BY 'Password' WITH GRANT OPTION; Query OK, 0 rows affected (0.00 sec)mysql> GRANT ALL PRIVILEGES ON *.* TO root@'%' IDENTIFIED BY 'Password' WITH GRANT OPTION; Query OK, 0 rows affected (0.00 sec)mysql> quit Bye``/usr/bin/mysqladmin version(later “/usr/bin/mysqladmin -u root -p version” is necessary)/usr/bin/mysqladmin variables(later “/usr/bin/mysqladmin -u root -p variables” is necessary)/usr/bin/mysqladmin -u root -p shutdown(can you shutdown the server?)sudo /usr/bin/mysqld_safe --log &(can you start the server?)ps -A | grep mysql(check whether the server process is running)/usr/bin/mysqlshow -u root -p(show all databases)/usr/bin/mysqlshow -u root -p mysql(show the tables of database “mysql”)To start the mysql daemon at system startup, you should go to the runlevel editor (advanced mode) and toggle the status for the mysql entry of init.d

Piping the output of find into a new command (find, xargs)

Wed, 23 May 2007 00:00:00 +0000

E.g. to change the permissions of all directories:find . -type d -print | xargs /bin/chmod ug+rxTo be able to handle directory names with special charactersfind . -type d -print0 | xargs -0 /bin/chmod ug+rxIn order to find all tif files in the current directory or below and to compress them (using the ImageMagick “mogrify” command and LZW compression):find . -name '*.tif' -print | xargs mogrify -compress LZWApart from the “xargs” method, some command (including find) accept the “-exec” argument. The following finds all files in the current directory that are smaller than 4k and deletes them:find . -size -4k -exec rm {} \;

Problems with vhosts on RedHat 8

Wed, 23 May 2007 00:00:00 +0000

We have httpd-2.0.40-11.9 installed and configured at our domain registrars site that jeltsch.org, marzidesign.com and sundayscam.com are forwared to our IP address (62.18.133.129). However, whatever site we requested from within our browser, the index.html files from vhost jeltsch.org was loaded. First it seemed that the browsers request didn’t include the name of the server. Because in such cases the webservers serves the first vhost in the list (which is jeltsch.org). However, the problem was another one: Under the vhosts directives we had the following configuration:NameVirtualHost *:80ServerAdmin webmaster@jeltsch.orgDocumentRoot /var/www/html/vhosts/jeltsch.orgServerName jeltsch.orgServerAlias www.jeltsch.orgErrorLog logs/jeltsch.org-error_logCustomLog logs/jeltsch.org-access_log combinedand then all the other vhosts. When we changed these settings to the following ones, things started to work:NameVirtualHost 62.78.133.129ServerAdmin webmaster@jeltsch.orgDocumentRoot /var/www/html/vhosts/jeltsch.orgServerName jeltsch.orgServerAlias www.jeltsch.orgErrorLog logs/jeltsch.org-error_logCustomLog logs/jeltsch.org-access_log combinedThis is not nice as it requires us to change the IP number in the httpd.conf file every time our dynamically assigned ip address changes. In theory the * should work.

ps2pdf versus pstill and password protection of pdf documents

Wed, 23 May 2007 00:00:00 +0000

While reading about ps2pdf (which is just a commandline front-end to ghostscript), I realized that despite its simple appearance, ps2pdf has almost all capabilities of Acrobat 5. ps2pdf14 outputs Acrobat 5-compatible files. According to the documentation strong password protection should be possible, however, I never managed with that.In theory the following commands should work:-sOwnerPassword= and -sUserPassword=In order to set the key length to 128 you have to useps2pdf14 -dEncryptionR=3 -dKeylength=128Another thing that I don’t know how to handle easily with ps2pdf is the cropping of documents.For the password protection, a very good alternative seems to be PStill ( http://www.pstill.com/ ). The command:pstill -Muserpassword=testpassword testfile.psdoes the trick.

Running wine from a real windows install

Wed, 23 May 2007 00:00:00 +0000

I thought wine might run better from a real windows install. So I resized my partitions to free some 8 GB space. Unfortunately the partitioning software was not really great as I lost one of my partitions (the one where I had stored all of my downloads…). So I decided to go for a clean start and formatted the whole hard disk. First I partitioned the disk using cfdisk. Then I installed Windows98 from the installer CD onto the FAT32 partition, after that Windows2000 from the installer CD to another FAT32 partition (I wanted to install WindowsXP, but the installer CD refused to boot my computer). After that I reinstalled Suse 9 and copied back my home folder from my backup disk. So far wine works fine (after some minor adjustments in $home/.wine/config and mounting the Windows98 partition withmount -t vfat -o uid=jeltsch,gid=users,fmask=644,dmask=755 /dev/hda1 /media/win98Without giving the uid, gis, fmask and dmask options you won’t be able to write anything to the partition.

Samba trouble (smb, smbadduser, smbpasswd)

Wed, 23 May 2007 00:00:00 +0000

If your samba is unreliable, there can be a number of reasons. I got the impression that YAST overwrites configuration data you have manually edited (e.g. in the password and user files) when you try to change settings via the YAST samba setup procedure. Here follows a checklist in case samba is again not responding or not visible in the network neighborhood. It could be that the unreliability is due to a PDC shutting down. Maybe I should make my Linux the PDC as it is always running. Anyway even if I manage to connect from W2K (using map network drive) I couldn’t connect from W98 by clicking the visible icon of my computer in the MCBL workgroup (“network path not found”). And in MacOSX my computer was not visible at all (but I could connect via the manual command “smb://128.214.186.42/homes”). Strange…In /etc/samba/smb.conf:

Spin down the harddisk with hdparm

Wed, 23 May 2007 00:00:00 +0000

The command to spin down the hard disk after 50 seconds (5x10) being idle: /sbin/hdparm -S10 /dev/hda

ssh host keys

Wed, 23 May 2007 00:00:00 +0000

When reinstalling an ssh server, one should keep the ssh key files from the old system. Otherwise ssh clients will receive messages of like “IT IS POSSIBLE THAT SOMEONE IS DOING SOMETHING NASTY!”. If you didn’t keep the files, the clients can of course delete the entries from the host key file (usually /home/user/.ssh/known_hosts). When the user connects after that again to the server, the new, changed host key files are added to the host key file.

The new iPod (3rd generation) and Suse Linux 9

Wed, 23 May 2007 00:00:00 +0000

I have bought an iPod. And it appears that the 3rd generation iPod is substantially different from the previous models. E.g. in its file system. In previous models you could convert the HFS+ file system into a FAT32 filesystem. HFS+ is the filesystem used by the new MacOS X OS. It cannot be read by Windows OS (unless you buy commerical third party software such as MacOpener or MacDrive). There are several Linux-interfaces for the iPod, but they all require that the iPod is mounted as a regular mass storage device. Suse Linux 9 luckily has support for HFS+ filesystems although it is still experimental. In order to be able to mount HFS+ formatted file systems, you have to load the hfsplus kernel module:sudo /sbin/modprobe hfsplusAfter that you can just plug in the iPod. After a while you will hear a beep meaning that it was recognized. To determine which device number it got you should check the system messages:tail -30 /var/log/messagesAs it is handles like a SCSI device it will get probably sda if it is your first usb/firewire device. If you have already usb or firewire devices connected to your computer it will get maybe sdb or sdc (and so on). Create a mount point:sudo mkdir /media/ipodThe 3rd generation iPod has apparently two partitions. The first must be for the firmware/system software (sdx1) and the second is for the data (sdx29. Funnily when I tried to mount it withsudo mount -t hfsplus /dev/sdc2 /media/ipodthe system complained that something is not OK with the device. However, when I tried:sudo mount -o umask=000 /dev/sdc2 /media/ipodeverything went smoothly. The umask option is necessary in order to give everybody read-write access. Otherwise only root can write. I installed gtkpod to move my mp3s to the iPod. There is even a Suse 9 rpm around.

Reading Macintosh Standard-formated disks (hfs)

Tue, 22 May 2007 00:00:00 +0000

Apparently the kernel module to read hfs-formated disks is less functional than the one for hfsplus-formated disks. I managed to crash my system mounting an hfs-formatted CD. A good alternative are the hfs utilities (hfsutils). There is also an easy GUI for them called xhfsutil.UPDATE (25.12.2023): I needed to mount an HFS+ formatted partition from a 2011 MacbookPro (macOS Sierra) to copy some data before disposing of it. Strangely, my Ubuntu 20.04 still cannot automatically manage to mount these if they are wrapped in a CoreStorage volume (which started in macOS 10.10). In order to mount these, you need to specify a size limit (for details, see https://superuser.com/questions/961401/mounting-hfs-partition-on-arch-linux/1088110#1088110) . To figure out the exact size limit, you use testdisk. You need to find out the size of the partition (which testdisk gives you in sectors). You need to multiply the sector number with the sector size (which you can figure out with fdisk; it’s usually 512). The command for mounting the partition is:mount -t hfsplus -o ro,sizelimit=N /dev/sdXn /mnt

autofs, automount, auto.master and mounting samba shares

Mon, 21 May 2007 00:00:00 +0000

First I added a symbolic link to /etc/init.d/rc5.d/:cd /etc/init.d/rc5.d sudo ln -s ../autofs S21autofsThen I added to the /etc/auto.master the following line:/media/automounts /etc/auto.smbmountsThen I created the file auto.smbmounts with the following content:michael_msbl.helsinki.fi -fstype=smbfs,username=michael,password=## ://paula/michael Then I created the mountpoint:sudo mkdir /media/automounts/michael_msbl.helsinki.fiThen I activated the autofs daemon:sudo /etc/init.d/autofs startNow whenever one tries to access the directory /media/automounts/michael_msbl.helsinki.fi, the autofs daemon will mount the smb share automatically and unmount after a certain period of inactivity.

Changing the host name with Yast2 (overriding the DCHP server)

Mon, 21 May 2007 00:00:00 +0000

I couldn’t figure out how to change the host name. The host name is e.g. displayed by default (Suse 9) in the command prompt and used by several applications. If you move your computer between different networks, this name changes as the default (Suse 9) is, that the host name is assigned by the DHCP server. But you can override these setting using Yast2: Control Center -> Yast2 modules -> Networ Devices -> Network Card -> authenticate! -> Edit already configured network cards -> Host name & Name server -> Uncheck the box “Change hostname via DHCP” and write the desired host name into the box. I presume you have to reboot for the settings to take effect. However, this doesn’t change e.g. the name of your computer that is visible on the windows network. To change this, you have to add an entry to /etc/samba/smb.conf like this: netbios name = “michael-laptop” (Is this correct?: The "" is necessary, otherwise you will only see the first part of the name (that is: michael).) This will change your name as it appears e.g. when you browse the network from a Windows NT computer. However, the samba implementation of MacOS 10.2 will still continue to display some generic name (in my case the name the DHCP server wants to give me: mcblmj-2).

Duplicating Macintosh-formated (hfs and hfs+) CDs under WindowsXP with Nero Express

Mon, 21 May 2007 00:00:00 +0000

Although a standard Windows XP Professional OS cannot read (= mount) Macintosh-formatted CDs (neither hfs nor hfs+), the burning program Nero Express can duplicate such CDs!

Editing names of desktop entries

Mon, 21 May 2007 00:00:00 +0000

How to change the name of items on the desktop (e.g. the Trash bin) Go to the directory ~/Desktop. There are .desktop files, which you can edit. To change the name of directories (e.g. the trash bin) edit the hidden file called .directory.

Formating an mounting an external firewire reiserfs disk

Mon, 21 May 2007 00:00:00 +0000

I didn’t know how to format an unformatted drive under Linux. I attached a firewire case with an old 12 GB Macintosh-formatted HD to my computer. In order to format it with reiserfs, I used Yast2. I had to go to expert mode and rewrite the partition table. By this action Yast2 puts an entry into the fstab, that I modified to:/dev/sda1 /media/firewire reiserfs noauto,user 0 0since I don’t want to have it connected every time I boot up. Instead I can now mount it as a regular user manually with:mount /media/tmp/To make the drive writable to normal users (or to whomever you want to grant access) you need to change the ownership and/or permissions of the mountpoint:chmod -R a+rwx /media/firewire

Good rpm repositories for Suse Linux 9

Mon, 21 May 2007 00:00:00 +0000

You can search specifically for suse 9 rpm packages under http://rpm.pbone.net/ but there are two good sites that have specialized on Suse Linux rpm packages: http://guru.linuxbe.org http://packman.links2linux.de/

Reiserfsck and repairing the root partition using the Knoppix CD

Mon, 21 May 2007 00:00:00 +0000

When I booted my laptop today, I got the following error message:Fsck failed. Please repair manually and reboot. The root file system is currently mounted read-only. To remount it read-write do: bash mount -n -o remount,rw / Attention: Only CONTROL-D will reboot the system in this maintainance mode. sgutdown or reboot will not work. Give root password to log inI logged in and executed:reiserfsck --fix-fixable /dev/hda7Several error messages appeared, among them in the end:reiserfs_open: the reiserfs superblock cannot be found on /. Failed to open the filesystem.Then it said somthing like that the superblock is corrupted and if I am sure that I am dealing with a reiserfs partition, I can rebuild it using the command:reiserfsck --rebuild-sbThen I realized, that /dev/hda7 is my encrypted filesystem and therefore no superblock was found. I repeated the command:reiserfsck --fix-fixable /dev/hda6It told me that the option “–fix-fixable” will be ignored. I don’t know why. Maybe because I have mounted the system from the same partition I am about to fix. Anyway, the message in the beginning The root file system is currently mounted read-only. To remount it read-write do: bash mount -n -o remount,rw /tempted me to remount it in read-write mode and to execute the command again. But with no result. So I booted from the Knoppix CD and executed from there. The filesystem replayed, but no errors were found.Then I remembered that I had modified the fstab yesterday by adding: /dev/sda1 /media/firewire reiserfs noauto,user 1 2I thought that the noauto option prevents the partition from being accessed during bootup. Apparently not and the problematic entry a the two numbers in the end (1 2). They determine whether a filesystem is checked on bootup. I set them to “0 0” and tried to reboot.Voila, everything is fine again.Otherwise I might have tired to rebuild the superblock from Knoppix:reiserfsck --rebuild-sb /dev/hda6

Rio500 drivers for W98 and W2K under VMware

Mon, 21 May 2007 00:00:00 +0000

VMware W2K and W98 do not recognize my Rio500. As I run not from a physical disk, I cannot reboot into W2K or W98 and install the driver from there. I checked, however where the drivers go during the install under W98: the driver consists of two files: riousb.inf and RioUSB.sys. The riousb.inf goes to two places: to C:\windows\INF and (under the new name of RioPort.Comriousb.inf) to C:\windows\INF\OTHER. The RioUSB.sys goes to C:\windows\system32\drivers. I couldn’t check where W2K puts the drivers, becasue when I tried to start up W2K I got the following error: Cannot find file system32\ntoskrnl.exe. Please reinstall.

smb mounts via fstab or automount?

Mon, 21 May 2007 00:00:00 +0000

I have many computers I need to connect to from my Linux box. Network browsing works, but is terribly slow, so I want to create some shortcuts, that I can mount with a single mouseclick what I need from a list. First I thought to modify the fstab and put there entries that would allow me to easily mount smb shares as a normal user. E.g.://paula/michael /media/smbmounts smbfs noauto,user,credentials=/home/jeltsch/.smbpasswd1 0 0This works if I have the entry mounted at system startup (without the “noauto” entry). If the “noauto” entry is present, the smb share is not mounted at system startup, but must explicitely be mounted by the following command:mount /media/smbmountsBecause of the “user” option in the fstab, every regular user should be able to do this. Not so! First I had to enable the “suid” for the smbmnt command (it appeared to be in /usr/bin/smbmnt, but was linked to a link that linked to /usr/lib/samba/classic/smbmnt:chmod +s /usr/lib/samba/classic/smbmntThen I found contradicting information whether the mountpoint (in my case /media/smbmounts) has to owned by the mounting user or not. To be safe it did:chown jeltsch /media/smbmountsStill I got an error which I couldn’t figure out and I decided to use automounts.

Staden 1.4 and Suse 9

Mon, 21 May 2007 00:00:00 +0000

I installed today the new Staden package (version 1.4) to my Suse 9. I included the lines:export STADENROOT=/usr/local/staden-linux-rel-1-4 . $STADENROOT/staden.profilein my ~/.bashrc file.After this kprinter broke with the following error:kprinter: /usr/local/staden-linux-rel-1-4/lib/linux-binaries/libstdc++.so.5: no version information available (required by /opt/kde3/lib/kprinter.so)Apparently the usual file (/usr/lib/libstdc++.so.5) is not anymore used because the staden linux-binary directory is listed in the PATH variable in the very beginning and thus overrides all other entries. Thus I replaced /usr/local/staden-linux-rel-1-4/lib/linux-binaries/libstdc++.so.5 and libstdc++.so.5.0.1 by symbolic links to /usr/lib/libstdc++.so.5.0.5:cd /usr/local/staden-linux-rel-1-4/lib/linux-binariessudo ln -s /usr/lib/libstdc++.so.5.0.5 libstdc++.so.5.0.1sudo ln -s /usr/lib/libstdc++.so.5.0.5 libstdc++.so.5So far at least printing works without error messages, but I have not tried staden yet…

suid and executing programs as root without need of typing the root password

Mon, 21 May 2007 00:00:00 +0000

If you have executables (programs, scripts), that need root privileges to run (e.g. that mount something), you don’t need to type in the su password everytime.You can set the suid for that file and change its owner to root:chmod u+s filename chown root filename

VMware and nonstandard screen resolutions of laptops

Mon, 21 May 2007 00:00:00 +0000

My laptop screen is a 1280x800. This resolution is not supported by the graphic driver of VMware. Under Windows 98, I unchecked the autofit option, resized the VMware window to a weired size, went to the Windows registry (in Windows 98 it’s three hidden files called system.dat, user.dat and policy.pol) and changed the Resolution entry (which was something like 966,558) to 1280,800. After rebooting the resolution was OK when I selected fullscreen. However, in windowed mode the resolution does not become adjusted to the smaller size, but instead you get scroll bars. But in Windows 98, networking doesn’t want to work. I am connected (webbrowsing, etc. works) but whenever I try to browse the local area network I gt the error: “Unable to browse the network”. In Windows 2000, the same trick with the resolution didn’t work. The registry entry is also called differently “Resolution.KVM”. Before that entry there are different other entries called resolution. But as they consist of complex number series, I don’t know how to edit them. So I am using the 1078x768 resolution although it obviously locks fuzzy on my 1280x800 screen. After updating to VMware 4.5.2 (build 8848) I am able to adjust to 1200x800 also with the Windows 2000 guest OS. In full screen mode everything is fine, but when I run in windowed mode and “fit guest to window”, the settings are lost from the windows registry and I have to manually edit them, and reboot to be able to get full screen resolution back to 1200x800.

VMware and Samba

Mon, 21 May 2007 00:00:00 +0000

VMware can interfere with Samba. When you are running a samba server on your computer and install VMware, you might break your samba server. You can check that by:sudo /etc/init.d/smb statusIf the result is “dead” and if VMware is running its own samba server (which you can check by ps -aux and then looking for an entry like vmware-smb), then you have to rerun vmware-config.pl. In RedHat, there is an easy way to remove the vmware samba server from starting up (system Settings -> Server Settings -> Services; just stop the service and uncheck the box if you don’t want it to start up upon system boot). In Suse 9, I just re-run the vmware-config.pl script. When it asks something like: do you want vmware to set up file access to the host computer, then you should say no.

VMware setup error (libpopt)

Mon, 21 May 2007 00:00:00 +0000

The error message during VMware setup (vmware-config.pl) is due to the fact that Suse 9 has a too new package for the requested library:/usr/bin/vmware-smbpasswd.bin: error while loading shared libraries: libpopt.so.0: cannot open shared object file: No such file or directoryThe following fixes the problem:ln -s /usr/lib/libpopt.so.1 /usr/lib/libpopt.so.0

Where do man documents live?

Mon, 21 May 2007 00:00:00 +0000

When you install the Stuffit Expancer for Linux, you get not only the binaries, but also the man pages. I put the two files (named unstuff and stuff) into the following directory: /usr/local/man/man1. They are now available when I type: man stuff or man unstuff.

Wine and Adobe Illustrator (can't find AIRes.dll)

Mon, 21 May 2007 00:00:00 +0000

Adobe Illustrator didn’t want to start up under wine, because it couldn’t find the file AI90Res.dll. This file is located after the Illustrator install in:~/.cxoffice/dotwine/fake_windows/Program Files/Adobe/Illustrator 10/Support Files/Contents/Windows/SystemI just moved it up one directory and everything started working.

BSPlayer and corrupted DivX files

Sun, 20 May 2007 00:00:00 +0000

I have a couple of scratched CDs with DivX video files. Both VLC and DivX Player were not able to play these files beyond the first corrupted frames. They tried to resume, but because the damage was too much, they did get stuck completely. But I found a player that handles most of these problems quite well: BSPlayer . It is only available for Windows though…

Couldn't find MIME type application/octet-stream (Konquerer/Kdesktop)

Sun, 20 May 2007 00:00:00 +0000

This is copied from [http://users.pandora.be/Ice9/Linux stuff/Linux_tips.html]( http://users.pandora.be/Ice9/Linux stuff/Linux_tips.html). I have used the second method as the desktop file appeared to be disfunctional judging from its content and had been created during the time when the error appeared first (that was when I was playing with the File associations section of the control center).

File Associations in KDE

Sun, 20 May 2007 00:00:00 +0000

I have many files in strange formats that can be opened by applications that are not installed by default on any Linux distribution. How do I teach KDE to recognize these files based on their endings (like .ab1) and to open them - when clicked - with the correct application? Go to Control Center -> KDE Components -> File Associations -> Add -> Leave Group “all” and type in some short, descriptive name (e.g. ABI trace file) -> Under “Filename patterns” put the file extension (or any other pattern that enables KDE to recognize the file; e.g. *.abi1) -> Write something descriptive into the “Description” field -> Under “Application Preference Order” click “Add” and type the name of the application (if it is in the path) or browse and select the executable (for the .ab1 example it would be e.g. trev, the trace file viewer from the Staden package) -> Click “Apply” -> I have the feeling that you have to log out and log in again to make the changes active. For the above example you will see that Konqueror list for files with the .ab1 ending the File Type “ABI trace file” and when you click them, they are opened with the trev application.

Installation and configuration of disc-cover on Suse 9.0

Sun, 20 May 2007 00:00:00 +0000

libcdaudio libcdaudio-devel (for cdaudio.h) perl-audio-cd module disc-cover configuration: create all the configuration files, otherwise segmentation fault add servers to .cdserverrc ( http://www.freedb.org/modules.php?name=Sections&sop=viewarticle&artid=9 )

Quick edits of jpg files from within Konqueror (jhead, jpegtran)

Sun, 20 May 2007 00:00:00 +0000

I wanted to have a quick way to rotate the images I take with my digital camera. The Olympus Camedia C-4000 always writes “1” als orientation into the EXIF data (either it doesn’t have an orientaiton sensor or it is broken), therefore I cannot rotate the images automatically by the commandjhead -autorot *.jpgSo I created a desktop file ~/bin/rotate90clockwise.desktpop with the following content[Desktop Entry] ServiceTypes=image/jpeg Actions=rotate90clockwise [Desktop Action rotate90clockwise] Name=Rotate 90 clockwise Icon=/opt/kde3/share/icons/crystalsvg/22x22/actions/rotate_cw.png Exec=/usr/bin/jhead -cmd "jpegtran -rot 90 &i > &o" %UThen I made a symbolic linksudo ln -sf ~/bin/rotate90clockwise.desktop /opt/kde3/share/apps/konqueror/servicemenus/rotate90clockwise.desktop Now when I browse files in Konqueror, I get by right-clicking a jpeg file the additonal option of rotating it. The rotation is lossless BTW and the EXIF information in maintaned. It is also possible to integrate rotation commands into image viewing software. E.g. if the following script is located in ~/bin!/bin/sh jhead -cmd "jpegtran -rot 90 &i > &o" $*you can call it from within GQView by adding the scriptname in one of the free slots below the “big” image editors:Menu name Command line Rotate clockwise rotate_clockwise %fEdit -> Options -> Editors

Automatization of Sequence Handling (Staden's pregap4 and gap4)

Sat, 19 May 2007 00:00:00 +0000

Already a while ago I wrote a script, that tries to automatize most of the work involved in getting sequences from our ABI sequencer into a gap4 database. The script is far from perfect and looks like this:!/bin/sh rm *.seq *.log Log\ file.txt for i in ls .ab1; do echo "Renaming $i" mv $i echo $i | sed “s/ $.\{27\}$ ./\1.ab1/" done ls *.ab1 *.txt > tracefile.list pregap4 -nowin -config /home/jeltsch/bin/pregap4_gap4.conf -fofn tracefile.list gap4 test.0.auxI put the script into ~/bin; and this script is supposed to be invoked from within the directory where the sequences are located. Typically the ab1 trace files from a single sequencing run from our machine are stored in one directory together with some (for me) meaningless log files, etc.First the script deletes unnecessary files from the directory; then it truncates filenames to 27 characters plus .ab1 ending. Funnily pregap4 handles longer filenames well, but gap4 has problems. Then all the remaining files are put into a list (tracefile.list) that is read by pregap4. pregap4 is used non-interactively. It gets its instructions (the setup of the modules) from a configuration file (which in my case is also stored in ~/bin).pregap4 calls the gap4 shotgun assembler and puts the readings into a gap4 database. Unfortunately I havn’t figured out how to automatically assign a descriptive name for this database. At the moment they will all have the same names and can be only identified based on their location in a different directory. It would be good to give them automatically a unique name, e.g. the date when the assembly was done or something similar.After all this has been done, gap4 is called and loads the newly created database for manual inspection and editing.Most of our sequencing is done to check newly made vectors. Therefore we usually know exactly what sequence we expect. If (which is unfortunately not the case) people use any program to document their constructs that included full sequence information (such as the Gene Construction Kit), the trace files should be automatically compared to such “expected” sequence.At the moment I achieve this by exporting the DNA sequence from the Gene Construction Kit program (GCK) as plain text file (apparently I could also use EMBL format) and putting this file together with the ab1 trace file into the same directory before starting the script. Thus it is handles just as any other sequence and the sequence readings are aligned to it.However, there are several things that I would like to be set automatically when invoking gap4 because I always perform the same sequence of clicks when manually inspecting in gap4 the alignment:Displaying all forward reading frames: I presume that because the “expected sequence” is the longest, it is always present in forward orientation in the assembly and the reading frames are allways forward. This results from the fact that I maintain (for ease of reading) the vector sequence in GCK allways in such orientation that the CDS of the GOI is in a forward frame.Highlighting disagreements by background color should be switched on.Upper/lower case character differences should be not handled as disagreementsBecause the quality of our sequencing is modest, mostly the default values are to strict for gap4 to enter the readings into the same contig. Thus I usually end up finding internal repeats and entering them manually. This should be possible to set automatically in the gap4 assembly, but I haven’t got around to figure out how.

Changing the default to tree view in Konqueror

Sat, 19 May 2007 00:00:00 +0000

Make the changes how you want to window to appear.
Right-click on title bar, click “Store Window Settings”.
Click “Settings” -> “Save View Profile” ->Select “File Management” from the list of available profiles -> “Save”.
Close the window and reopen it to see that your settings stick.

Desktop Integration of the Staden Package in KDE on Suse Linux 9

Sat, 19 May 2007 00:00:00 +0000

I have installed the Staden package on my laptop. In order to convince other people from my lab to use it, it must be very easy to use. Ideally, they should just need to select some sequences, click and the preprocessing and assembly should be done automatically. In order to achieve that I did the following:

Installation of Duplicate File Finder

Sat, 19 May 2007 00:00:00 +0000

I was making order among my 50000+ files in my home directory and realized that I had multiple copies of the same file in different directories. Therefore I was looking for some convenient way to find those duplicates and to delete them.There are several applications that do something like this. However, none is perfect. E.g. mp3 files of the same song, but with a different id3 tag will be recognized by most programs as being different, whereas they might be essentially the same apart from the metadata in the id3 tag.I settled for Duplicate File Finder , a java application. Installation required JavaUnix , which appeared to be tricky to install.First of all, I needed to install the java2 SDK. The default on Suse Linux 9 is that only the runtime environment (java3-jre) is installed.For configuration and compilation to succeed (thanks to Ian Ballantyne) one needs to append the current install directory to the path:export PATH=$PATH:.But now the program crashes complaining thatjava.lang.UnsatisfiedLinkError: no javaunix in java.library.pathAgain I got some help:export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:$JAVA_HOME/jre/lib/ext/Linux/makes it work. The LD_LIBRARY_PATH is not set on my system. When you install the Staden package, it sets this variable to “/usr/local/staden-linux-rel-1-4/lib/linux-binaries”. You can copy the javaunix.so file to the location that is given in the environment variable LD_LIBRARY_PATH.

kaptain on Suse Linux 9

Sat, 19 May 2007 00:00:00 +0000

I am currently trying out several graphical front ends for the molecular software package EMBOSS and I have read good reviews of kaptain . However, because there are no rpm packages of kaptain for Suse Linux 9 available, I tried to compile it myself. First problem was that the configure script couldn’t find the libraries and headers for qt3:> checking for Qt… configure: error: Qt (>= Qt 2.2.2) (headers and libraries) not found. Please check your installation!Thus I executed ./configure with the option:> ./configure --with-qt-dir=/usr/lib/qt3 Now the configuration script proceeds to the end. However, the make still fails, the last lines of output are like this:Making all in kaptain make[2]: Entering directory /home/jeltsch/downloads/kaptain-0.71/kaptain’ g++ -DHAVE_CONFIG_H -I. -I. -I.. -I/usr/lib/qt3/include -I/usr/X11R6/include -D_REENTRANT -O2 -fno-exceptions -fno-check-new -c kaptain.cpp kaptain.cpp: In constructor Kaptain::Kaptain(Intermediate*, Kaptain*, QWidget*, QBoxLayout*, QDialog*, bool, const char*)': kaptain.cpp:99: error: assert’ undeclared (first use this function) kaptain.cpp:99: error: (Each undeclared identifier is reported only once for each function it appears in.) kaptain.cpp: In member function void Kaptain::button_pressed()': kaptain.cpp:1576: error: ostream_iterator’ undeclared (first use this function) kaptain.cpp:1576: error: parse error before >' token kaptain.cpp:1598: error: parse error before >’ token make[2]: *** [kaptain.o] Error 1 make[2]: Leaving directory /home/jeltsch/downloads/kaptain-0.71/kaptain' make[1]: *** [all-recursive] Error 1 make[1]: Leaving directory /home/jeltsch/downloads/kaptain-0.71’ make: *** [all-recursive-am] Error 2I got help from the author of the software Zsolt Terek. I had to insert at the beginning of kaptain.cpp:include include `.

The PATH in Suse Linux 9 (/etc/profile.local)

Sat, 19 May 2007 00:00:00 +0000

Several software installations modify the PATH environment variable. There are many different file that are read during bootup that contribute to the final PATH variable. Several software installs, however, break exisiting PATH entries. Among them is the Staden package. The staden installation instruction advise to include the following lines in ~/.bashrc:export STADENROOT=/usr/local/staden-linux-rel-1-4 . $STADENROOT/staden.profileIn order to quickfix PATH problems, you can give the full path that you need in /etc/profile.local:PATH=/home/jeltsch/bin:/usr/local/bin:/usr/bin:/usr/X11R6/bin:/bin:/usr/sbin/:/sbin:/opt/gnome/bin:/opt/kde3/bin:/usr/lib/java/bin:/usr/local/bio/bin/If you leave the entry in ~/.bashrc, the staden path will be inserted before all the entries in /etc/profile.local, thus will take precedence over other entries. This breaks certain programs as some of the libraries Staden uses are older than the ones on Suse Linux 9 (see some older posting).

DCOPserver error during KDE login

Thu, 05 Apr 2007 00:00:00 +0000

Yesterday my laptop ran out of power and during the emergency shutdown stuff got apparently screwed up. When I tried to log into KDE this morning, I got the following error message: There was an arror setting up inter-process communication for KDE /home/jeltsch/.DCOPserver_michael-laptop__0 could not read network connection list Please check that "dcopserver" is running This is again a very non-informative error message. The way to fix this was as follows: rm ~/.kde/socket-michael-laptop rm ~/.kde/tmp-michael-laptop rm -rf /tmp/kdesocket-jeltsch rm -rf /tmp/kde-jeltsch There were errors while removing the directories in /tmp. Even as root I couldn’t remove the directories; the error message claimed they were not empty. But there were no files when listed with ls -al. As a workaround a renamed the directories: mv /tmp/kdesocket-jeltsch /tmp/kdesocket-jeltsch.old mv /tmp/kde-jeltsch /tmp/kde-jeltsch.old After this I could again log in, but the items from my Panel had disappeared.

Desktop Integration of Staden into KDE 3.2

Thu, 05 Apr 2007 00:00:00 +0000

Two things have to be accomplished: 1. The menu should contain appropriate entries. 2. The files should be clickable and have appropriate “Open with” entries. 1. is easy to do. The (systemwide) entries for the menu are in /opt/kde3/share/applnk. I just added an addiitonal directory structure under this directory:Science – Staden |– Gap4.desktop |– Pregap4.desktop |– Spin.desktop |– Stadenlaunch.desktop -- Trev.desktop If you edit the menu as a regular user, the entries are only valid for yourself. Additionally Suse messes between two locations for user-defined menu entries: ~/.kde/share/applnk and ~/.local/share/applications. Once you have the entries in the systemwide /opt/kde3/share/applnk additonal changes made by individual users will replicate the directory under the users home directory. Because entries in the users home directory take precedence over systemwide entries, these will be valid then.

EMBOSS and GCK for the assembly and documentation of construct sequences

Thu, 05 Apr 2007 00:00:00 +0000

I am trying to use EMBOSS for the assembly of vector sequences. Long time ago, I used the CGC seqed program for this purpose and at the moment I use the Gene Construction Kit . EMBOSS doesn’t have a straight equivalent for seqed and one has to use a bunch of other tools to replace its functionality. Look at this comparison between CGC and EMBOSS .

Extracting files from rpm archives (rpm2cpio)

Thu, 05 Apr 2007 00:00:00 +0000

The command rpm2cpio finger-0.17-9.i386.rpm | cpio -imVd extracts all files from the rpm archive finger-0.17-9.i386.rpm. It creates the directory structure relative to the current directory.

Farfalle with Gorgonzola Cream

Thu, 05 Apr 2007 00:00:00 +0000

Serves 4 3 cups farfale (‘motylki’) 180 g gorgonzola cheese, any rind removed, diced 2/3 cup of heavy cream pinch of granulated sugar 2 teaspoons finely chopped fresh sage, plus fresh sage leaves to garnish salt and ground balck pepper Cook the pasta until al dente: 8-10 minutes or according to the instructions on the package. Meanwhile, put the gorgonzola and cream in a medium saucepan. Add the sugar and plenty of ground black pepper and heat gently, stirring frequently, until the cheese has melted. Remove the pan from heat. Drain the cooked pasta well and return it to the pot in which it was cooked. Pour the sauce into the pot with the pasta. Add the chopped sage to the pasta and toss over medium heat until the pasta is evenly coated. Taste for seasoning, adding salt if necessary, then devide among four warmed bowls. Garnish each portion with sage and serve immediately.

How to add comments to HTML code

Thu, 05 Apr 2007 00:00:00 +0000

Identifying your kernel version (ver)

Thu, 05 Apr 2007 00:00:00 +0000

To figure out what kernel you are running just type ver Of course you can also just look into /boot and look to which kernel the default links are pointing to.

Installing Windows95 under VMware

Thu, 05 Apr 2007 00:00:00 +0000

You need: the Windows95 installation CD and a Windows 95 version B boot floppy . As I don’t have a floppy drive I have to create a floppy image of the boot floppy. Under VMware boot from the Windows95 boot floppy. Create a primary partion that fills the virtual disk completely (options 1 and then 1 again and then yes). Reboot Windows95. Format the virtual disk and install Windows95: format C: /S R:\WIN95\SETUP /IS I couldn’t get my installation CD to work. So I made an image of it dd if=/dev/cdrom of=w95oem.iso Then the rest should be a routine install…

KMail, multiple SMTP servers and the alternative sendmail

Thu, 05 Apr 2007 00:00:00 +0000

KMail has always problems with multiple smtp servers. As a solution I installed sendmail. Then I just created a new outgoing mailserver and selected the sendmail option. No further configuration was necessary and it seems to work.

Making a Suse RPM for the Staden Package

Thu, 05 Apr 2007 00:00:00 +0000

As the binaries work on all Suse distributions, I though to skip the build process and just have the binaries unpacked by rpm and then add the suse-specific files to the correct places. These additional files are mainly kde.desktop files, icons andexport STADENROOT=/usr/local/staden-linux-1-4-1and sourcing /usr/local/staden-linux-1-4-1/staden.profilein ~/.bashrc.Thus the unpacking would be justtar --extract --verbose --gzip --absolute-names --file=staden-linux-1-4-1.tar.gzandchown -R root:root /usr/local/staden-linux-1-4-1

Making the Staden applications clickable in MacOS X

Thu, 05 Apr 2007 00:00:00 +0000

I have installed Staden on MacOS X and have been playing around with it. I used the ebiotools package created by Anders Nisters described in issue 10/1 of the embnet.news for the installation. It works, although not according to the Mac philosophy:

Manually uncompressing backup files creating by BackupPC (Zzzz)

Thu, 05 Apr 2007 00:00:00 +0000

The perl script /usr/local/backuppc/bin/BackupPC_zcat does it, but you need BackupPC installed for this purpose. There is a standalone frontend for the compression libraries available called Zzzz… made by the same guy who is behind mplayer.

Mexican Chilli Corn Pie

Thu, 05 Apr 2007 00:00:00 +0000

Serves 4 1 tbsp corn oil 2 garlic cloves, crushed 1 red pepper & 1 green pepper, deseeded and diced 1 celery stalk, diced 1 tsp hot chilli powder 400g can chopped tomatoes, 325g can sweetcorn, drained 215g can kidney beans, drained and rinsed 2 tbsp chopped fresh coriander salt and pepper tomato and avocado salad, to serve Topping: 125g cornmeal 1 tbsp plain flower 1/2 tsp salt 2 tsp baking powder 1 egg, beaten 100ml milk 1 tbsp corn oil 125g grated mature Cheddar Heat the oil in a large frying pan and gently fry the garlic, peppers and celery for 5-6 minutes or until just softened. Stir in the chilli powder, tomatoes, sweetcorn, beans and seasoning. Bring to the boil and simmer for 10 minutes. Stir in the coriander and spoon into an ovenproof dish. To make the topping, mix together the cornmeal, flour, salt and baking powder. Make a well in the center, add the egg, milk and oil and beat until a smooth batter is formed. Spoon over the pepper and sweetcorn mixture and sprinkle with the cheese. Bake in a preheated oven, 220C for 25-30 minutes until golden and firm. Serve immediately with a tomato and avocado salad.

Paglia e Fieno with Walnuts and Gorgonzola

Thu, 05 Apr 2007 00:00:00 +0000

Serves 4 300g paglia e fieno (‘flattened spaghetti’) 2 tablespoons butter 1 teaspoon finely chopped fresh sage or 1/2 teaspoon dried sage, plus fresh sage leaves to garnish (optional) 120 g gorgonzola 3 tablespoons mascarpone cheese 5 tablespoons milk 1/2 cup walnut halves, ground 2 tablespoons freshly grated Parmesan cheese freshly ground black pepper Cook the pasta in a large pot of salted boiling water, according to the instructions on the package. Meanwhile, melt the butter in a large skillet or saucepan over low heat, add the sage and stir it around. Sprinkle in the diced gorgonzola and the add the mascarpone. Stir the ingredients with a wooden spoon until the cheeses start to melt. Pour in the milk and keep stirring. Sprinkle in the walnuts and grated parmesan and add plenty of black pepper. Continue to stir over low heat until the mixture forms a creamy sauce. Do not allow it to boil or the nuts will taste bitter, and do not cook the sauce for longer than a few minutes or the nuts will discolor it. Drain the pasta, turn it into a warmed bowl, then add the sauce and toss well. Serve immediately, with more black pepper ground on top. Garnish with the sage leaves, if desired.

Pinnacle PCTV Deluxe and Linux support

Thu, 05 Apr 2007 00:00:00 +0000

I bought a USB TV card; a Pinnacle PCTV Deluxe. There is only one program for Linux available: dunerec . Here is how I got it working: Download and untar (tar -xvzf) dune2-linux.tar.gz After untarring you have two directories: dunetools and dunelib, two shell scripts (which function escapes me) and one README.txt with some installation instructions. You don’t need to compile anything, you just need to copy the executables (and some other files) into the correct directories: dunetools/dunerec/dunerec goes to /usr/local/bin dunetools/duneinit/duneinit goes to /usr/local/bin You need to create the directory /usr/local/lib/dune Now you need some files from the Windows program, that came together with the TV card. Obviously you need to have a Windows system and install the Program there first. You find the files yu need in “C:\Program Files\Pinnacle\Pinnacle PCTV Deluxe\Driver". You need to copy the files ending with .v (k2.v, etc.), DuneNTSC.sys and DunePal.sys to the newly created directory /usr/local/lib/dune As I am living in Europe, I need to use Pal.sys; therefore I rename it to dune.sys chown root /usr/local/bin/dunerec chmod u+s /usr/local/bin/dunerec chown root /usr/local/bin/duneinit chmod u+s /usr/local/bin/duneinit Scanning for channels is done with the command /usr/local/bin dunerec -i 0 -S 1 -d 1 Dune at 001/002 VID 2304 PID 061E Loading ezusb2 firmware… dune.sys: FWOff: 77736 FWLen: 10296 You have to restart the program! The “-d 1” option is only to print debugging information. You need to execute the command again, this is normal: dunerec -i 0 -S 1 >> /usr/local/lib/dune/channels.txt This command puts the output of the scanning into the file /usr/local/lib/dune/channels.txt; you still have to remove from this file the lines starting with . The error message “Cannot find dune!” occurs when the TV card is not plugged into the computer. I had it also occur when the TV card was present and I needed to remove the card, restart and hotplug it again to make it working. You should test whether the card is working: dunerec -R test.mpg -i 0 -a 479250 This records the TV signal on frequency 479.250 MHz into the file test.mpg. You can stop the recording with Ctrl-C and watch this mpg file with the video player of your choice. However, in order to watch live streaming TV, you need to pipe the data to a player. The only player I managed to get accepting the data is mplayer . There is a great rpm for Suse Linux 9.1 from Packman . Don’t forget to download the rpm with all the codecs! Here are some commands that I have used for piping: dunerec -R - -i 0 -a 479250 | mplayer -cache 8192 - You can adjust the cache size to reduce the waiting time to start playback. dunerec -R - -i 0 -a 479250 | mplayer -framedrop -vo x11 - Without cache you need to allow the player to drop frames. dunerec -i 0 -a 479250 -t dvd -R - | mplayer -ao arts -vo xv -double -cache 4096 -framedrop - This is the complete command that I use now. I copied it from the gtk2 GUI.GTK2 GUI for TV card “Pinnacle PCTV Deluxe” http://pctvgtk.sourceforge.net” . The installation work according to the instructions and the stuff really works. I had some problems with the scanning. it didn’t find all programs. I had to do the scanning under Windows (using the Pinnacle program) and then write down the frequencies and add them manually to the channels.txt files. But that went also without problems.

Problems installing VMware tools (manual installation)

Thu, 05 Apr 2007 00:00:00 +0000

For some reason VMware 4.5.2 didn’t manage to update the VMware tools using the regular option under “VM -> Install VMware tools…”. So I had to install them manually: sudo /sbin/losetup /dev/loop1 /home/your_username/vmware-distrib/lib/isoimages/windows.iso mkdir /home/your_username/temp sudo mount -r -t iso9660 /dev/loop1 /home/your_username/temp/ As my home directory is visible under VMware, I started the setup.exe manually. Everything went OK, although VMware still complains after the reboot that my VMware tools are out of date…

Quanta crashes during start-up (moving my account to a new user)

Thu, 05 Apr 2007 00:00:00 +0000

When I start Quanta as a regular user, it crashes. The output of the terminal is: jeltsch@michael-laptop:~> quanta QGDict::hashKeyString: Invalid null key Invalid entry (missing '=') at /opt/kde3/share/apps/quanta/doc/javascript.docrc:241 TagAction::property( "accel" ) failed: property invalid or does not exist TagAction::property( "accel" ) failed: property invalid or does not exist TagAction::property( "accel" ) failed: property invalid or does not exist jeltsch@michael-laptop:~> However, when started as root, things work OK, although the error messages are the same. At the moment I changed the desktop entry from the start menu so that Quanta starts up as root. Of course, I have to allow access to my X windows, e.g. by executing xhost +. I created a new regular user (mjeltsch9 and executed quanta as mjeltsch, quanta worked also fine. Apparently something is fishy with some user-specific settings. I tried to figure out what, but to no avail. Therefore I decided to make a clean start. As root, I chowned recursively all files in my home directory to mjeltsch and moved them (excluding hidden files) into /home/mjeltsch. All hidden files I put into a new directory which I called old_dot_files. I might need some of these. Then I deleted my /home/jeltsch. Using Yast2, I deleted account “jeltsch” and changed the /home/mjeltsch into /home/jeltsch. Then, also in Yast2, I renamed the user mjeltsch into jeltsch and changed his home directory from /home/mjeltsch into /home/jeltsch. I also had to chown -R /tmp/mcop-jeltsch. Apparently everything works again, but all my desktop configuration is of course lost.

Recursive grep

Thu, 05 Apr 2007 00:00:00 +0000

grep (case-insensitive, recursive) grep doesn’t offer any possibility to recursively descent down the directory tree. The following command searches e.g. just thru all the files in the current directory:grep bacteria *To make the search case-insensitive, one can use the i flag:grep -i bacteria *But if you want to do a recursive search you have to use a quite complicated construction of UNIX commands to achieve this goal:find ~/Mail -type f -exec grep 'bacteria' {} \; -printThis command searches recursively thru the Mail directory of the current user and prints all the lines that contain the word bacteria.

Reference Sequences (Staden)

Thu, 05 Apr 2007 00:00:00 +0000

To make one sequence a reference sequence, just select its name from the gap4 Edit Contig window and right click and select as reference sequence. If the file is in embl format, the features will show up as Staden tags in the alignment.

Removing PDF password protection

Thu, 05 Apr 2007 00:00:00 +0000

I recently bought a pdf book. It was password-protected (40bit security). Unfortunately some of the PDF viewers on Linux cannot open password-protected pdf files. So I decided that I can remove the password protection for private use.A quick lock at the web showed two very easy methods of password removal:

Resetting the MySQL root password

Thu, 05 Apr 2007 00:00:00 +0000

If you have forgotten your MySQL root password, you can reset it if you have physical access to the machine mysql is running on: Find the .pid file of the mysql process. It is either called mysql.pid or machinename.pid. Kill the mysql process. On my MacOS X server e.g. kill cat /usr/local/mysql-standard-4.0.16-apple-darwin6.6-powerpc/data/localhost.pid`` Restart the mysql server /usr/local/mysql-standard-4.0.16-apple-darwin6.6-powerpc/bin/mysqld_safe --skip-grant-tables & Set the new root password (replace newpassword with the new password!) /usr/local/mysql-standard-4.0.16-apple-darwin6.6-powerpc/bin/mysqladmin -u root flush-privileges password "newpassword" Done!

scp (secure copy)

Thu, 05 Apr 2007 00:00:00 +0000

In order to copy the file index.html from the local machine to vesuri.helsinki.fi the following command is needed:scp -p /Volumes/Documents/michael/Sites/index.html jeltsch@vesuri.helsinki.fi:./public_html/index.htmlThe p flag preserves modification times, access times, and modes from the original file. The full path of the original file (/Volumes/Documents/michael/Sites/index.html) is of course not needed if the file is in the current directory.In order to copy the directory “/Multimedia/TV Shows/Kids & Family” from a remote server with the IP address 192.168.0.16 to the current directory of the local machine, use the following command:scp -r root@192.168.0.16:"/Multimedia/TV\\ Shows/Kids\\ \&\\ Family" .Note the double back slashes to escape the white spaces in the file path! The r flag is needed because you want the complete content of the directory (recursive).If you need to specifiy a port number, you need the capital P flag:scp -P 22222 -v TVSeriesXY_S01E* mnmplus@192.168.0.16:/Volumes/MultimediaSometimes, scp is inefficient (e.g. when transferring massive amounts of small, uncompressed files). In that case, one solution is to use tar (to concatenate and compress) and then pipe the output through ssh to the other machine and decompress/untar it there:tar cpf - server.helsinki.fi | ssh jeltsch@othermachine.helsinki.fi "tar xpf - -C /home/jeltsch/"

Sequence trace files in tar archives (Staden)

Thu, 05 Apr 2007 00:00:00 +0000

I want to store all sequence traces of a sequencing project (using Staden) in one file. You can do that if you simply tar all the *.ztr files: tar -cvf ./test.tar *.ztr Then you have to specify in gap4 Options -> Configure menus -> Expert And then you need to specify Options -> Trace file location -> TAR=./test.tar

Software development projects for Molecular Biology

Thu, 05 Apr 2007 00:00:00 +0000

GCK2.5-related

GCK2.5 debug under wine** There are still some bugs that make using gck2.5 sometimes a pain under wine. Especially the inability to annotate regions, to search for a sequence and to open a new file.
GCK2.5 export** GCK2.5 is not able to export in embl format with the regions converted into features. It can, however, export comments to text file and plain sequence to a text file. It should be trivial to write a perl script that takes these two files and converts them into one embl file, EMBOSS cirdna/lindna or pDRAW32 file.
GCK2.5/wine desktop integration** When clicking on files that are associated with Windows programs (using wine), the Linux file manager (e.g. Konqueror) passes the file as an argument to the associated Windows application and the file is opened under wine. However GCK2.5 refuses to accept the file as an argument. When clicking on a .gcc file, GCK2.5 starts up, but opens an empty window and I have to open the .gcc file from within GCK2.5. Unnecessary clicking, especially when I need to navigate over several folder hierachies. When GCK2.5 is running natively under Windows, is it possible to start GCK2.5 with a construct file as a command line argument? I should check that out.

pDRAW32-related

Specifying a default working directory (Path) for Acrobat via acroread.desktop file

Thu, 05 Apr 2007 00:00:00 +0000

Acrobat starts always with ~ as the working directory. Because I keep all my pdf files in a seperate directory, I have to do quite some navigation before I can save them. This is especially bad as the Acrobat save as window displays all files including hidden files.

Staden Help Function (no Netscepe, no help)

Thu, 05 Apr 2007 00:00:00 +0000

Because I don’t have Netscape installed on my computer, the help function of Staden doesn’t work automatically. During the staden course James told be to look into /usr/local/staden-linux-rel-1-4/lib/tk_utils/help_netscape.tcl I might do so, but as a quick fix I made a symbolic link to mozilla: sudo ln -s /usr/bin/mozilla /usr/bin/netscape And this really works. I also tried it succesfully with Konqueror: sudo ln -sf /opt/kde3/bin/konqueror /usr/bin/netscape

Staden on MacOS X (ebiotools)

Thu, 05 Apr 2007 00:00:00 +0000

Today I installed the Staden Package on Tanja’s Macintosh G4 computer (MacOS 10.3). I recommend using the ebiotools package made by Anders Nister. It includes other useful software such as EMBOSS, Blast, etc.). Installation instructions are available in the embnet news issues 9/1, 9/2, 9/3 and 10/1 or gathered into one pdf file from here .

Start netatalk as system service during bootup on Suse Linux 9

Thu, 05 Apr 2007 00:00:00 +0000

I am missing from Suse Linux 9 a nice GUI that collects ALL system services with the options “start”, “stop” and “start on every system boot”. RedHat 9 has something like that. There is Yast2, but under the services, netatalk is not even listed. To boot netatalk during system boot, I just create manually a link: cd /etc/init.d/rc5.d sudo ln -s ../atalk S22atalk After rebooting (and to my surprise) my computer froze. No Ctrl-Alt-F2, no access via ssh; the only rescue being the physical reboot button button (something I am only used to from my Macintosh times). After rebooting in safe mode and removing the link everything is fine again. When I manually start atalk, the system freezes in the same way after a couple of seconds…

Suse Linux 9.1

Thu, 05 Apr 2007 00:00:00 +0000

I bought the boxed version of Suse Linux 9.1. The update went quite smoothly. Although it reported about 1500 package conflicts, they were all just consequences of kopete 0.81 (my icq client) and vlc 0.71 (my video player). I resolved the conflicts by first unprotecting the non-Suse packages that I had installed and then risking system inconsistencies. However, after the update both kopete and vlc still functioned. On the other hand VMWare 4.0.5 broke but updating to 4.5.1 helped.

Suse Linux 9.1/9.2 and vmware

Thu, 05 Apr 2007 00:00:00 +0000

I downloaded again a VMware release to test (4.5.2). But it didn’t even wanted to be configured. Apparently Suse has screwed up the installation source directory tree structure. I found this fix: cd /usr/src/linux su make cloneconfig make prepare After this the vmware-config.pl should run ok. Before running the vmware-config.pl I also applied the vmware-any-any-update78 patch . BTW: You have to repeat this procedure everytime you update your kernel! After updating to 9.2 I had more problems. After every restart I had to execute vmware-config.pl again. This was fixed by adding for a in seq 0 9; do mknod /dev/vmnet$a c 119 $a; done to the beginning of the /etc/init.d/vmware file. After kernel updates the procedure before starting vmware-config.pl is cd /usr/src/linux make cloneconfig make modules_prepare

Syncronizing Psion3a address database with KDE's address book

Thu, 05 Apr 2007 00:00:00 +0000

I have an old Psion 3a which I use mainly as an alarm clock during vacation when I have to catch a train or plane. To make it more useful, I decided to put all my addresses to its database. The database format is some strange format (.dbf). The database application of the Psion 3a cannot import any other format and the only format it can export in is a text file where each field is seperated from the next by a delimiter character (by default linefeed) and each record is seperated from the next by an empty line (or an empty line if linefeed is the delimiter). The PsiWin application on a PC can open the dbf format and export in a variety of formats (hopefully). So the way to get all my addresses into the Psion would be (they are in MacOSX’s addressbook format at the moment) to get them first into KDE’s address book and then export from there in a format that PsiWin can read and use PsiWin to save in the dbf format that the Psion can read.

True Type fonts under Linux

Thu, 05 Apr 2007 00:00:00 +0000

True Type fonts under Linux Font handling under Linux is quite a chaos. Here is how I added true type fonts to my Suse Linux 9. In the Control Center -> System Administration -> Font Installer you have to change into Administration mode -> Advanced Mode (with embedded font selector). Then I just selected the fonts I wanted from the fonts directory of my Windows XP partition and clicked Add. By clicking Apply the fonts become available to the X Windows Server. You can do the same by manually copying the fonts into /usr/X11R6/lib/X11/fonts/truetype and then running xset fp rehash

Using multiple mouses/trackpads simultaneously (Suse Linux 9 Yast2/SaX)

Thu, 05 Apr 2007 00:00:00 +0000

I have a laptop and used Yast2 to configure an external USB mouse. However, the trackpad became inactive. When I now restart without USB mouse I am in trouble. I used for the configuration: Control Center -> Yast2 modules -> Hardware -> Select mouse model If you want to operate both external mouse and trackpad, you need to dig deeper: Control Center -> Yast2 modules -> Hardware -> Graphics Card and Monitor -> Graphical Desktop Environment -> Change -> Component: Input Devices Here you have the possibility to add an indefinte amount of mouses. You should probably test whether you new settings work (with the test button) before you restart. The settings become only active after a restart. Meaning if you want to deactivate your trackpad (because it disturbs you) you need again a restart…

What nfs and smb shares are available on a server (showmount, smbclient)?

Thu, 05 Apr 2007 00:00:00 +0000

The command to figure out what shares are available e.g. on the computer 192.168.0.2 type:For nfs: /usr/sbin/showmount -e 192.168.0.2For samba: smbclient -L 192.168.0.2

Windows NT, network browsing, mounting and disconnecting from network drives (command netuse)

Thu, 05 Apr 2007 00:00:00 +0000

Network browsing in Windows is a mystery. Sometimes some computers simply don’t show up when browsing a network. This seems to be especially true for Linux servers. Under newer versions of the Windows OS (2000, XP), you can connect to a server (if you know its IP adress) via the mount network drive command even though the network browser cannot see that server. Windows NT doesn’t have that option. The only possibility is to use the “net use” command from the command line. This is uncomfortable, although one can make .bat files for frequently used connections. The command is: net use * \\ip-adress\username The asterisk assings the share to the next available drive letter (of course you can assign manually to e.g. H:). To delete this specific network drive type: net use H: /delete Actually, even if you can browse and connect without needing the command line, you need the command line always when you want to disconnect a share from an NT server. Funnily Windows NT has no other way but to type netuse * /delete In some discussion threads it was mentioned, that one should switch on WINS support in the Linux server’s smb.conf file wins support = Yes. If you connect to Linux, make sure that Samba is running and that the user to whose home folder you want to connect to has an entry & password in the smb database (this is NOT preconfigured even in Suse 9.2): as root: smbpasswd -a username It didn’t help me, though. MacOS X computers (10.3) show up now without problems (older MacOS X versions also had problems). Maybe I should compare the smb.conf files or just copy it over to my Suse 9.1.

Windows XP guest from raw partition under VMWare 4, coLinux as rescue

Thu, 05 Apr 2007 00:00:00 +0000

So far I never was able to run a Windows XP guest OS from a raw disk partition using Linux VMWare. Here’s the discussion thread .

aMule on our server (what ports to open?)