Cloning on Michael’s Domain

Assembly of an OCAA collection Entry vector (pENTR221)

Fri, 30 Oct 2020 00:00:00 +0000

This article is for people, who do molecular cloning. More specifically for people who need to deal with Gateway vectors. Let’s assume you received a Gateway clone from somebody. You know the insert sequence and you know the backbone. One of the most common backbones is pENTR221. Let take as an example insert the human CTSL1 cDNA, more specifically the clone id 100010639 from the OCAA clone collection. You know the insert sequence from its Accession Number (BC012612).You want the full DNA sequence of this vector in order to be able to use smart cloning software like SnapGene to help you with your cloning design. But this software requires you to have the full sequence of the construct (or at least the full sequence of its important parts). So how do you figure out the full sequence of the pENTR221-CTSL1 clone?The insert sequence you can get from NCBI : Just type in the Accession number that you got for your clone. Download the sequence in Fasta or Genbank format.Very interestingly, the otherwise smart SnapGene software does not know the pENTR221 vector. So you need to google the vector backbone “pENTR221 DNA sequence”. You get many hits and here are just four of them:1. http://dnasu.org/DNASU/GetVectorDetail.do?vectorid=2792 . https://plasmid.med.harvard.edu/PLASMID/GetVectorDetail.do?vectorid=279 3. https://www.genomics-online.com/vector-backbone/48/pentr221/4 . http://yrgene.com/documents/vector/pentr221.pdfMatthias , the author of the 4th source gives the sequence in a PDF file, which is not advisable. If you copy the DNA sequence from this file, it will be all scrambled up, because PDF does not read the groupings of 10 nucleotides line-by-line. Dear Matthias, do not use a PDF for distributing or documenting DNA sequences! If you MUST do so, please attach a plain text file of the nucleotide sequence to the PDF! Of course, you can extract the DNA sequence with a smart PDF tool like PDF Studio Pro in the correct order. For some strange reason, the sequence of the 3rd URL deviates from the other four being the only one that has the full attachment sites (attL1 and attL2). However, it does not matter which one of the sequences you use for the assembly, because the differences are all in the area that is removed during the assembly process (I don’t know how the pENTR221 vector was prepared for the library cloning of my specific example, but it looks to me that the original vector was opened with a single DraI digest (which creates blunt ends) and then first the linker were added and thereafter the insert.I suggest you use the sequence from the 3rd URL (because it is in Fasta format) and import it into SnapGene and let SnapGene detect common features. Now you still need the linker. How do you know which linker have been used? We get most of our Gateway clones from an in-house replica of the OCAA clone collection and you can download the full list of clones as an Excel spreadsheet from here . The data includes for each clones the linker that have been used (there are 8 different 5’-linker and 16 different 3’-linker). Unfortunately, it seems to be that this Excel sheet contains some errors, because some linker contain a stop codon, but are nevertheless marked “without stop” and vice-versa.For our example clone the following linker have been used:5’-linker:GTACAAAAAAGCAGGCTCCACCATG3’-linker:TAGGACCCAGCTTTCTTGTACAlmost all of the 5’-linker contain the Kozak sequence (CACC) as the last nucleotides before the insert starts and a few contain in addition to the Kozak the ATG itself (like the one above). At the other end of the linker you can easily identify the homologous sequence with the end of the attL1 of the pENTR221 backbone (GTACAAAAAAG).The 3’-linker are more heterogenous but they all contain the CTTTCTTG sequence from the attL2. When they are used to make clones with a stop codon, then they all start with that very stop codon (TAG, TGA or TAA).Now you just need to copy the open reading frame from your insert sequence in between the linker sequences. If your 3’-linker contains the initiation-ATG, you need to skip it. Also do not copy the stop codon, because in the “with stop codon clones” it is always included in the linker and in the “without stop codon clones” you don’t want to have it. For our example this sequence comprises nucleotides 202-1197 of Accession Number BC012612 . That would be:AATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGNow we add the linker (first and last row):GTACAAAAAAGCAGGCTCCACCATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGTAGGACCCAGCTTTCTTGTACNow we have the first problem: There is a stop codon in the 3’-linker (immediately in the beginning of the last row) even though the clone is according to the information that we received “without stop codon”.We have sequenced the clone and determined that the only difference between the with and without stop codon clones is a mutation, that converts the TAG stop codon into a TTG (leucin) codon.So we change one A nucleotide in the sequence above into a T nucleotide:GTACAAAAAAGCAGGCTCCACCATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGTTGGACCCAGCTTTCTTGTACThe last operation is to insert this sequence into the empty pENTR221 sequence that we have opened in SnapGene. Practically you select the 32 nucleotides from 652 to 687 and replace them with the sequence above. Voila! Unfortunately, the fact that the linker are not always correctly indicated gives me a bad feeling. However, according to our own experience the library replicas of the Orfeome contain sufficient errors that it is anyway advisable to sequence the complete insert using T7 or M13 rev primers from the 3’-end and M13 fwd primer from the 5’-end. This way, you will figure out any linker mistakes that have been done in the annotation of the clones.

SnapGene and partial restriction digests revisited

Thu, 23 Aug 2018 00:00:00 +0000

Snapgene is a software for the wet lab molecular biologist, who does lots of cloning work (construct design and annotation). Since I last wrote about the SnapGene software ( https://www.snapgene.com/ ), many good things have happened:

Cloning Club

Wed, 22 Jun 2016 00:00:00 +0000

Together with the Doctoral Programme in Biomedicine (DPBM) we are organizing in autumn 2016 a workshop and a practical course about cloning (course code 921244).Dates and venue (workshop): Weekly discussion workshop (8 events each 1 to 1.5 hours) starting Tuesday 30.8.2016; venue: meeting room 7 (Biomedicum Helsinki, 5th floor, except 27.09. and the last workshop on 25.10., which take place in BM B136A); 1 creditDates and venue (practical course): Decentralized lab course (at the participants schedule and venue or - for participants without own access to the necessary facilities - in the first two weeks of November in our lab); 1 creditCourse information page: http://www.helisci.fi/hbgs/cloning-club2016 Registration page: https://elomake.helsinki.fi/lomakkeet/71701/lomake.html Detailed course info: PDF Advertisement poster: PDF Course material: Material will be added after every meeting here . Cloning has the appeal of being boring. However, all starts with DNA. Genetic engineering is not only here to stay, but will become more and more important: we are just scratching the surface of its potential. Almost all biomedical research involves DNA constructs: expression vectors to transfect cells, shuttle plasmids to make viruses, constructs to generate transgenic animals.The skill to generate a DNA construct is needed until the arrival of that promised device, which will spit out any plasmid a few hours after you have fed it the plasmid’s sequence. Many new technologies are available and as a result, it is more difficult to choose than in the old days when restriction enzyme cloning was the only option. Today, demands and options are endless and you need to choose the right strategy to maximize success and speed.

SnapGene - Simply the best DNA manipulation software

Fri, 01 Jan 2016 00:00:00 +0000

Our lab has been using different software packages to plan, document and visualize DNA constructs. Among those that we liked a lot for a long time were Textco’s GeneConstructionKit (GCK) and Clone Manager (Professional) . The latter runs unfortunately only under Windows. However, since several of our computers run Ubuntu Linux , we did run GCK versions 2.5 and 3 using WINE (a compatibility layer that allows us to run native Windows programs under Linux). However, with the upgrade to version 4, GCK became unusably slow under WINE and we were looking for a replacement. We contacted the developers of GCK, but they apparently were either not willing or able to help us. I suppose that the codebase of GCK is probably more than 20 years old and for that reason nobody dares to touch it. Just around that time, SnapGene was released and it fulfilled almost all of our requirements:

2-week Lab Course

Tue, 30 Dec 2014 00:00:00 +0000

I had no idea how much work it is to organize a practical lab course. Had I known, Pirjo would have had a much harder time to convince me to give this course for the Doctoral Programme in Biomedicine (DPBM)l . Kari had warned me… The accompanying lecture course had been running from September to November. The practical course had been offered with 16 free slots, but that was totally unrealistic given that we were confined to my 23.7 square meters of lab space. Teaching lab space is available, but without equipment and all the other infrastructure that is needed for such an undertaking. 8 people registered to the practical course and - luckily - half of those pulled out in the last moment with insufficient possibility to commit to the heavy workload that the course required. Thus we ended up with four students and three projects. Under no circumstances would we have managed with more.The idea was to offer each participant the possibility to realize his own DNA cloning and protein expression project. Something that would be relevant for his own PhD studies. For that matter, I had meetings with the three groups one month in advance to plan the cloning and to order the necessary materials. We were working in parallel on the following three projects: