Science on Michael’s Domain

Courses I teach

Fri, 26 Jan 2024 00:00:00 +0000

IN RED - as (one of the) responsible teacher(s); * - as course developer

Current wet lab teaching
*DPDR-305 (1 ECTS) Purification of Recombinant Proteins and Protein Drugs by FPLC Introduction Methods Protein tags PROV-004 (5 ECTS) Introduction to cell and molecular biology methods Alternative assignment: Expression, purification and functional testing of Phusion polymerase Practical: PCR Work PROV-410* (4 ECTS)** Recombinant DNA technology in therapeutic protein engineering - laboratory work

Current wet lab teaching

DPDR-305* (1 ECTS) Purification of Recombinant Proteins and Protein Drugs by FPLC
PROV-004 (5 ECTS) Introduction to cell and molecular biology methods
- Alternative assignment: Expression, purification and functional testing of Phusion polymerase
- Practical: PCR Work
PROV-410* (4 ECTS) Recombinant DNA technology in therapeutic protein engineering - laboratory work

Current courses
FARM-310 (5 ECTS) Biopharmaceuticals, basic course Luento #3: Terapeuttiset proteiinit I: Insuliinit ja insuliinianalogit Lecture #3: Therapeutic proteins I: Insulin ja insulin analogs Luento #4: Terapeuttiset proteiinit II: Erytropoietiini, interferonit, & G-CSF Lecture #4: Therapeutic proteins II: Erythropoietin, interferons, & G-CSF Luennot #5+#6: Terapeuttiset proteiinit III: Vasta-aineet ja fuusioproteiinit Lectures #5+#6: Therapeutic proteins III: Antibodies and fusion proteins PROV-004 (5 ECTS) Introduction to cell and molecular biology methods Lecture #1: Alternative Assignment: Protein Production & Purification Lecture #2: Protein Purification Methods Lecture #3: Protein Purification Tags Lecture #4: PCR lecture *PROV-409 (1 ECTS) Recombinant DNA technology in therapeutic protein engineering - lecture & exercise course Session #1: Introduction to Recombinant DNA Technology: Restriction Enzymes, PCR, Plasmids, Transformation Session #2: Multifragment assembly (“Gibson” and similar), Golden Gate, mutagenesis methods, CRISPR/Cas systems Session #3: Databases, sequences, software, bioinformatics for your cloning Session #4: Vectors and systems for protein expression Session #5: How to make transgenic organisms and recombinant viruses PROV-216 (5 ECTS) Molecular Pharmacology VEGFs and VEGF receptors PROV-204 (5 ECTS) Biological Drugs II Antibodies, antibody fusions and antibody conjugates as drugs TMED-929* (1-2 ECTS) Drug discovery & development with a focus on biologics Introductory lecture Protein drugs group work kick-off Vaccines, vaccine development & biological warfare: The smallpox vaccine Challenges in formulation, production and quality control Evidence-based medicine, science-based medicine, and complementary and alternative medicine PROV-303 (5 ECTS) Advanced Biopharmaceutics Session #6: Biological barriers: The blood brain barrier Session #8: Recombinant DNA Technology (aka “cloning”) is the starting point for nearly every biological drug …and much more Session #9: Transgenic animals: For drug production, generating human antibodies and making animal models of human diseases Session #10: Protein Drugs: Engineering and Case Studies GMB-401 (5-10 ECTS) Integrative health biosciences Clinical Trials MPHARM-002A/PROV-105A (11 ECTS) Drug development and preclinical evaluation Discovery, Development and Optimization of Protein Drugs MPHARM-002B/PROV-105B (11 ECTS) Pharmaceutical product development and rational use of medicines Biophamaceuticals - Challenges in formulation, production and quality control MPHARM-009 (5 ECTS) Introduction to research methods in drug discovery and development – theory Plans for the future… Protein production and purification Stable cell line generation FARM-314 (5 ECTS)** Medicinal preparations I Basic Issues in the Formulation of Biophamaceuticals

Current courses

FARM-310 (5 ECTS) Biopharmaceuticals, basic course
- Luento #3: Terapeuttiset proteiinit I: Insuliinit ja insuliinianalogit Lecture #3: Therapeutic proteins I: Insulin ja insulin analogs
- Luento #4: Terapeuttiset proteiinit II: Erytropoietiini, interferonit, & G-CSF Lecture #4: Therapeutic proteins II: Erythropoietin, interferons, & G-CSF
- Luennot #5+#6: Terapeuttiset proteiinit III: Vasta-aineet ja fuusioproteiinit Lectures #5+#6: Therapeutic proteins III: Antibodies and fusion proteins
PROV-004 (5 ECTS) Introduction to cell and molecular biology methods
- Lecture #1: Alternative Assignment: Protein Production & Purification
- Lecture #2: Protein Purification Methods
- Lecture #3: Protein Purification Tags
- Lecture #4: PCR lecture
PROV-409* (1 ECTS) Recombinant DNA technology in therapeutic protein engineering - lecture & exercise course
- Session #1: Introduction to Recombinant DNA Technology: Restriction Enzymes, PCR, Plasmids, Transformation
- Session #2: Multifragment assembly (“Gibson” and similar), Golden Gate, mutagenesis methods, CRISPR/Cas systems
- Session #3: Databases, sequences, software, bioinformatics for your cloning
- Session #4: Vectors and systems for protein expression
- Session #5: How to make transgenic organisms and recombinant viruses
PROV-216 (5 ECTS) Molecular Pharmacology
- VEGFs and VEGF receptors
PROV-204 (5 ECTS) Biological Drugs II
- Antibodies, antibody fusions and antibody conjugates as drugs
TMED-929* (1-2 ECTS) Drug discovery & development with a focus on biologics
PROV-303 (5 ECTS) Advanced Biopharmaceutics
GMB-401 (5-10 ECTS) Integrative health biosciences
- Clinical Trials
MPHARM-002A/PROV-105A (11 ECTS) Drug development and preclinical evaluation
- Discovery, Development and Optimization of Protein Drugs
MPHARM-002B/PROV-105B (11 ECTS) Pharmaceutical product development and rational use of medicines
- Biophamaceuticals - Challenges in formulation, production and quality control
MPHARM-009 (5 ECTS) Introduction to research methods in drug discovery and development – theory
FARM-314 (5 ECTS) Medicinal preparations I
- Basic Issues in the Formulation of Biophamaceuticals

Teaching Videos
2025 Biologiset Lääkkeet (in Finnish) (Unitube) Biologiset lääkkeet: Intro ja historia Linkki Biologiset lääkkeet: Tuotanto, stabiilius, säilytys ja käsittely Linkki Biologiset lääkkeet - Biosimilaarit, biobetterit ja lainsäädäntö Linkki Esimerkkejä biologisista lääkkeistä Biologiset lääkkeet - Metaboliset sairaudet Linkki Biologiset lääkkeet - Syövän hoitoon tarkoitetut vasta-aineet Linkki Biologiset lääkkeet - Vasta-ainekonjugaatit Linkki Biologiset lääkkeet - Bispesifiset vasta-aineet Linkki Biologiset lääkkeet - Vasta-aineet Alzheimerin taudin hoitoon Linkki Biologiset lääkkeet - Tulevaisuus Linkki

Teaching Videos

2025 Biologiset Lääkkeet (in Finnish) (Unitube)
1. Biologiset lääkkeet: Intro ja historia Linkki
2. Biologiset lääkkeet: Tuotanto, stabiilius, säilytys ja käsittely Linkki
3. Biologiset lääkkeet - Biosimilaarit, biobetterit ja lainsäädäntö Linkki
Esimerkkejä biologisista lääkkeistä
1. Biologiset lääkkeet - Metaboliset sairaudet Linkki
2. Biologiset lääkkeet - Syövän hoitoon tarkoitetut vasta-aineet Linkki
3. Biologiset lääkkeet - Vasta-ainekonjugaatit Linkki
4. Biologiset lääkkeet - Bispesifiset vasta-aineet Linkki
5. Biologiset lääkkeet - Vasta-aineet Alzheimerin taudin hoitoon Linkki
1. Biologiset lääkkeet - Tulevaisuus Linkki

Previous wetlab teaching
2014 - 2019 DPBM-135 Purification and Characterization of Recombinant Proteins (organized yearly until Covid-19) 2015 2017 2015 - 2017 DPBM Cloning Club (wetlab part) 2014 DPBM Practical Molecular Biology and Genetic Engineering (wetlab part) 2010 HBGS Tags in protein expression, detection and purification

Previous courses
2018-2022 DPBM-119 Protein Interaction Biochemistry 2018 Cell-based assays for protein interaction detection & quantification 2022 Cell-based assays for protein interaction detection & quantification 2017 DBPM CancerBio Summer School A short histrory of antiangiogenic tumor treatment 2014 DPBM Practical Molecular Biology and Genetic Engineering (lecture part) 2011 Lymphatic Research lecture series (six lectures) Lecture #1: Introduction to Lymphatic Research

Previous courses

2018-2022 DPBM-119 Protein Interaction Biochemistry
- 2018 Cell-based assays for protein interaction detection & quantification
- 2022 Cell-based assays for protein interaction detection & quantification
2017 DBPM CancerBio Summer School
- A short histrory of antiangiogenic tumor treatment
2014 DPBM Practical Molecular Biology and Genetic Engineering (lecture part)
2011 Lymphatic Research lecture series (six lectures)
- Lecture #1: Introduction to Lymphatic Research

Workshops
2015 - 2017 DPBM Cloning Club (workshop part)

Angiogenic doping - doable and difficult to detect

Thu, 21 May 2026 00:00:00 +0000

Less than 1% of athletes test positive for doping in typical world-class events (World Championships, Olympics). However, we know that at least 70% of the athletes are doping . How do we explain this discrepancy? My lab does angiogenesis research, i.e., we study the growth of blood and lymphatic vessels. Ever since the discovery of VEGF-B by Birgitta Olofsson and Ulf Eriksson in 1996 , I suspected that VEGFs could make for good doping agents, sooner or later. Anti-doping research in endurance sports has focused on blood and red blood cells (RBCs). Erythropoietin (EPO) doping shows how important the RBCs are. But considering the basic mathematical equation “concentration = mass divided by volume” tells us immediately that you can increase the RBC mass without increasing the RBC concentration by increasing the blood volume. Unsurprisingly, blood volume is very important for endurance performance, perhaps even more so than RBC concentration. This can be seen in “sports (pseudo)anemia”, where some athletes have a relatively low hemoglobin concentration despite unimpaired performance. What is the upper limit of the blood volume? And would it be possible to increase the upper limit by growing more blood vessels? We discuss Angiogenic Doping in our latest publication in Sports Medicine . Our hypothesis is that angiogenic doping might already be in use without any good possibility for WADA to detect it. VEGF growth factors are likely not yet used because their application requires advanced medical technologies that only a few laboratories can provide. However, there are quite a few small molecules that can be slowly up- and microdosed to stimulate both angiogenesis and RBC production in sync, thus avoiding major impacts on the athlete’s biological passport. Thanks go to Sofie Lehto, who laid the groundwork for this study, and to doping researcher and sports physician Sergei Iljukov for continuing to work on this side project with me over the last two years.

JetPEI transfection of insect cells

Tue, 12 May 2026 00:00:00 +0000

Getting DNA into cells is one of the basic requirements of most of today’s life sciences. There are many ways to get DNA into cells: More exotic methods include shooting and electric shocks, but the most common methods deploy chemicals called transfection reagents. These somehow mingle with the DNA and help it to cross the plasma membrane. PEI (Polyethylenimine) is one of the “cheaper” transfection reagents. If you make it yourself, it probably costs about the same as calcium phosphate transfection (which is one of the oldest and cheapest methods). Even commercially available preparations, such as JetPEI and PEIMax, are budget-friendly compared to many other transfection reagents. However, they do not work very well for insect cells. When I asked - perhaps ten years ago - our provider (Polyplus Transfections), they provided me with a custom protocol for the transfection of insect cells with JetPEI. I have been using it successfully, but mostly only to generate stable cell lines. When making stable transfectants, a somewhat lower transfection efficiency is acceptable. However, I could not find that protocol anywhere online, and thus I have attached it to this post for everybody who needs this information. In a nutshell, the amounts of DNA and transfection reagent are increased to make up for the lower efficacy.

AI: Medically trained models, consciousness

Mon, 11 May 2026 00:00:00 +0000

Most people can perhaps name a handful of LLM models, maybe a dozen if they follow the tech news. However, meanwhile about 3 million different LLM models are freely available from Hugging Face . And not all of them are low-quality models. E.g. Google’s Open Source Gemma models are also hosted there; they share a common genesis with Google’s Gemini models, but have been optimized for local and research use. Importantly for biomedical researchers, there are also many open, freely available, and locally usable, medically trained LLMs. I have not tested them, but there is a curated list of specialty models on GitHub: https://github.com/FreedomIntelligence/Awesome-Specialized-Medical-LLMs . The list also contains several freely available general medical models like

I am focusing on the wrong things

Wed, 22 Apr 2026 00:00:00 +0000

This is a rant, but hear me out. Instead of working on how to utilize AI in my own field, I am:

Purifying Proteins with Äkta & Unicorn

Sun, 19 Apr 2026 00:00:00 +0000

Proteins (and other biomolecules) are mostly purified by chromatographic methods. There are a few vendors that have designed dedicated chromatography systems that are optimized for biomolecules such as proteins, nucleic acids, and viruses. The most well-known systems are BioRad’s NGC and Cytiva’s Äkta lines. Our faculty has recently acquired an Äkta Avant, and we are almost ready with setting it up. It’s already integrated into the reservation system. Only the automated backup system is still missing. I have been using Äkta devices since 1996, when Professor Jorma Keski-Oja bought one of the first Äkta Explorers for the Haartman Institute. The software was and still is Unicorn, but we are at version 7 now, which has a modern look when compared to the Unicorn versions from the last millennium: much less messy and cluttered. However, even after more than 10 years of development, Unicorn 7 is not yet at feature parity with the old versions. Hence, its Evaluation module offers you the option to switch back to Evaluation Classic. E.g., if you want to present personalized and stylish chromatograms in your talks, you still need Evaluation Classic! The new Evaluation module does have quick buttons to import curves into presentation software such as PowerPoint, but it is all pixel-based and therefore not easily editable after export. You want to export your curves into the industry-standard vector graphics file: SVG. You can edit it with any modern vector graphics editor, such as Canva, Adobe Illustrator, or Inkscape. When you right-click inside the chromatogram in Evaluation Classic, you have the option to save the chromatogram as a meta file. However, in the recent Unicorn version, this results in an error on Windows 11. But there is a workaround:

The Study Voucher

Sat, 04 Apr 2026 00:00:00 +0000

Since I am working at the University of Helsinki (UH), I should probably know a bit more about the upcoming Study Voucher pilot (Finnish: opintoseteli), as UH will offer a lot of courses within this program, including some of mine, e.g. the Recombinant DNA Technology (aka “Cloning”) course. I did some reading, and here is the gist of it:

Zotero with 15GB free file storage?

Thu, 12 Mar 2026 00:00:00 +0000

I have been using Zotero as my bibliography management software since 2013 (migrating from EndNote) and have generally been happy with it (and I blogged about it before). Although our university provides EndNote access, most students will lose “free” access after leaving the university. A yearly subscription to EndNote used to set you back about €100 (in Finland via a reseller), which is an unnecessary expense in a student’s budget. EndNote’s “one-time purchase” model is, imho, deceptive marketing, because you are not eligible to major upgrades, which are released approximately yearly. The “upgrade fee” is usually about the same as the yearly subscription used to be.

How to install the color-blind-safe Nature Color Palette in Inkscape

Wed, 28 Jan 2026 00:00:00 +0000

This one is short and easy on Linux. For instructions how to install this color palette on Windows or macOS, please visit https://github.com/atsuyaw/NatureColorPalette .

Still wondering what to study?

Sat, 20 Dec 2025 00:00:00 +0000

This is what I would do if I were 20 years old today: I would enter an interdisciplinary study program. My favorite among the programs offered in Finland is the International Master’s Programme in Pharmacy (officially “Master’s Programme in Pharmaceutical Research, Development and Safety”, abbreviated MPHARM) at the University of Helsinki. I give you 5 compelling reasons:

The Finnish Dream: A Pipe Dream?

Mon, 15 Dec 2025 00:00:00 +0000

A reality check for international students

Finland has been celebrated as the world’s happiest country for now eight years in a row . However, Finland is not only the happiest country, but also the country with one of the lowest fertility rates . In order to stabilize the pension system , Finland decided that it needs immigration, an idea very radical for a country that was 30 years ago almost as isolated from the rest of Europe as North Korea is nowadays from the rest of Asia. At that time, the international car sign for Finland was still SF for Soviet Finland (just kidding, the S obviously stands for Sweden). Finland wants to increase immigration by attracting foreign students to pursue degrees in Finland, hoping that some of them will stay in the country after graduation. Hence, Finland has become an increasingly popular destination for international students, particularly from Asia. Lured by promises of a high-quality life, excellent education, and abundant opportunities, many invest big time to pursue a degree in one of the Finnish universities . Ten years ago, university education was free for everybody (including all foreigners), but since since 2017, students from non-EU/EEA countries have needed to pay tuition fees . This was not the universities’ own decision, but mandated by the government.

Just another type of fish

Wed, 12 Nov 2025 00:00:00 +0000

I still dream of improving my Finnish language skills, and as a consequence, I occasionally do irrational things. Now, with much help from two amazingly patient editors, I have tried to write a popular science article in Finnish about our scientific excursion into fish biology territory. The article just appeared in the mene & tiedä online magazine of the Young Academy Finland ( Nourten Tiedeakatemia ).

Quiz results

Thu, 06 Nov 2025 00:00:00 +0000

ADAMTS18 regulates ECM turnover via fibronectin cleavage

Tue, 04 Nov 2025 00:00:00 +0000

The maintenance of the specialized blood vessels in intestinal villi had been the topic of a Nature Communications paper from the Petrova lab ( https://doi.org/10.1038/s41467-022-31571-2 ). Maintaining the polarity of the nutrient-absorbing vessels required a differential exposure to VEGFA, which was maintained by specialized cells producing the right amount of fibronectin. The previously orphan ADAMTS18 was the protease that appeared instrumental in the proteolytic maturation of fibronectin. Now, a publication from the University of Eastern Finland analyzed the ADAMTS18 fibronectin connection in more detail: https://doi.org/10.1016/j.jbc.2025.110844 . Fibronectin normally does not exist as a single molecule, but it forms fibrils that are essential building blocks of the extracellular matrix. ADAMTS18 removes a critical part of the fibronectin molecule, thus preventing it from forming fibrils. This establishes ADAMTS18 as an important player not only in endothelial cell biology, but potentially in many other contexts in which fibronectin-containing extracellular matrix is involved. Fibronectin, as a major component of the provisional matrix, is crucial during wound healing and in the ECM maintenance of organs like the lungs. Consequently, there are many interesting avenues opening up to look at additional specific functions for ADAMTS18. Congrats, Maria, for this important contribution to our understanding of another ADAMTS family member!

Thank you, Aalto-Helsinki iGEM team!

Sun, 02 Nov 2025 00:00:00 +0000

I am extremely proud of you, Aalto-Helsinki iGEM team ( https://www.aaltohelsinki.com )! Although being in survival mode all year long, the results are truly exceptional: Gold Medal achieved, nominated for Best Therapeutics Project (overgrad series, tightly beaten by the equally exceptional Toronto University’s Mystiphage project), and two special prizes for Best Measurement and Best Sustainable Development Impact! I would have loved to be in Paris for the Grand Jamboree, but teaching duties and grant application deadlines took priority. Judging from the videos, I was not required at all. An oral vitamin B12 supplement that also works for all patients currently requiring injections is one step closer. We will keep you informed about our progress, this is only the beginning!

The War on Cancer

Wed, 01 Oct 2025 00:00:00 +0000

Wednesday, October 1, 2025, is the European Day of Foundations and Donors. Since we receive close to zero basic research funding, my research is absolutely dependent on external funding. As much of our government’s R&D funding has shifted from academic to commercial research (“business funding”), foundations are keeping cancer research in Finland alive. In the past, a significant amount of money has also been coming from taxpayers’ money. Most people associate this with US President Richard Nixon, who declared War on Cancer in 1971. However, the politically supported “War on Cancer” was not, as often claimed, started by Nixon. The war against cancer had been a priority of politicians of a very different kind almost 40 years earlier.

t_coffee still fails on a standard Ubuntu 24.04 LTS install

Thu, 18 Sep 2025 00:00:00 +0000

The bug in t_coffee, reported on https://github.com/cbcrg/tcoffee/issues/27#issuecomment-1355339411, is still an issue after many years. I hardly dare to recommend t_coffee to my students, even though I would like to, because it is otherwise an excellent and very powerful program. Most of them fail to install it on our university’s default Ubuntu distribution (“Cubbli”), which is atm Ubuntu 24.04. I tried it out myself just recently (Ubuntu 24.04 LTS with both the version provided by the default Ubuntu repository via the package manager and the stable and beta versions from https://tcoffee.org/Projects/tcoffee/index.html (stable COFFEE_installer_Version_13.46.0.919e8c6b_linux_x64.tar.gz and beta T-COFFEE_installer_Version_13.46.1.b8b01e06_linux_x64.tar.gz). All of them still complain with –ERROR: MAX_N_PID exceeded. It gets stuck somewhere and takes approximately one minute before it throws the error, even with a simple task that normally takes a few seconds. With a more complex alignment, it can take minutes or hours before the error is thrown. The workaround is to set the environment variable before every run, i.e., you replace t_coffee with a shell script that calls the renamed t_coffee after setting the environment parameter MAX_N_PID_4_TCOFFEE to something big (like /proc/sys/kernel/pid_max). The issue is explained in the Github link above. See also https://github.com/cbcrg/tcoffee/issues/47 . Another workaround is to recompile with a different MAX_N_PID, which is rather straightforward; see also here https://github.com/cbcrg/tcoffee :

Delivery still limits VEGF therapy

Fri, 12 Sep 2025 00:00:00 +0000

Simply injecting a lab-made growth factor into the body isn’t enough to copy what the body does naturally. That’s because our own growth factors are released in the right place, at the right time, and in the right amount, and their levels are constantly adjusted using feedback loops.

Academic career

Sun, 03 Aug 2025 00:00:00 +0000

A tiny job market but the best European country to live in (considering global warming)

This month, I transitioned from Associate to Full Professor at my university. Trusting the opinion of my doctoral supervisor Kari Alitalo , my current supervisor , and mostly everybody else, I did not prepare a plan B, in case I would be denied tenure. As a Gen Xer on the Finnish job market, what could have been a realistic plan B? Looking at the international job market would make it easier to solve the problem by increasing opportunities by a factor of 100, even when considering only English- and German-speaking countries. Finland’s population is only about 5.6 million, and its job market is tiny. However, going abroad is not that easy if the rest of your family is opposed to a change of scenery. And why would I leave the only country in Europe whose summer temperatures are not health-threatening? Sure, global warming also hits the Nordic countries: We just had the longest uninterrupted heatwave in Finland since people are taking measurements (22 days of >30°C). But 30°C beats 40°C hands down. For my American friends & family: 30°C = 86°F, 40°C = 104°C.

An impossible overlap-extension PCR

Sat, 21 Jun 2025 00:00:00 +0000

A PhD student of mine asked me about plasmid maps for several DNA constructs that I had created some 20 years ago. Since SnapGene did not exist at the time, I had used the now obsolete GeneConstructionKit2. I performed many clonings at the time, but I did not continue generating maps for all of them. The GCK2 format does not allow for easy annotation. You needed a separate program for comprehensively annotating the plasmids, and this data was saved in a separate file, the so-called “illustration” file: what could possibly go wrong? Yesterday, I ended up digging out my old lab notebooks and retracing about 10 old clonings in SnapGene. However, I was unable to simulate one of the assemblies because SnapGene was too conservative in disallowing “bad” PCR primers to function. I had performed overlap-extension PCR to introduce a mutation into the mouse VEGF-D cDNA. The homologous mutation had been introduced into human VEGF-D before, and I therefore had the primers for the human sequences. Mouse and human VEGF-D are very similar. The primers designed to amplify the human PCR were not perfect when using mouse cDNA as a template, but none of the differences would result in amino acid changes. So I attempted the PCR with a primer that had a mismatch in the third nucleotide from the 3’-end. The PCR was successful, but even when I lowered the hybridisation parameters to the least stringent settings, SnapGene would not anneal this primer to my template. To simulate cloning in SnapGene and generate a map, I needed to introduce a mutation into my primer and then reverse the mutation after the overlap extension PCR. I guess I need to file a bug report (or would this be a feature request?). It seems appropriate that the program should be able to allow annealing of primers that do anneal in reality…

Learning and Teaching Materials about Biological Drugs

Sun, 08 Jun 2025 00:00:00 +0000

Lecture slides “Biologiset lääkkeet” (Finnish)

Learning Materials in Finnish Language

Basic introduction to biological drugs

Title: Biologiset lääkkeet (Biological Drugs) Year: 2016 Creator: Fimea (Finnish Medicines Agency) URL: https://fimea.fi/laaketurvallisuus_ja_tieto/biologiset-laakkeet
Title: Biologiset lääkkeet (Biological Drugs) Year: 2023 Creator: Terveyskylä (Public information service provided a.o. by Finnish university hospitals) URL: https://www.terveyskyla.fi/laaketalo/tietoa-laakkeista/biologiset-laakkeet

Basic introduction to biosimilars

A better Levodopa

Sat, 31 May 2025 00:00:00 +0000

Saku Renunanen’s manuscript about novel inhibitors of levodopa decarboxylases was published in the European Journal of Pharmaceutical Sciences . It is a textbook example of drawing from the expertise of many different people to make progress. We all know that levodopa provides only symptomatic treatment and that the real breakthrough in Parkinson’s Disease treatment probably has to come from a molecular understanding of the formation of the alpha synuclein and tau protein aggregates and how to interfere with or reverse it. However, disentangling the molecular aetiology of Parkinson’s disease and finding a way to interfere with it will still take us many years. Therefore, improving existing treatment strategies can have a bigger impact on patients’ lives in the short term, and exploring new approaches to improve dopamine deficiency-addressing strategies is thus worthwhile.Levodopa is still the go-to drug for Parkinson’s disease, but a lot of it gets broken down before it ever reaches the brain. While we already use drugs like carbidopa (Lodosyn) to help prevent this, recent research suggests that gut bacteria may also be contributing to the issue. Specifically, Enterococcus faecalis and similar bacteria can interfere with their tyrosine decarboxylase enzymes.To address this, in this paper, over 150,000 compounds were screened computationally looking for ones that could block this bacterial enzyme. After a series of in silico and lab tests, three promising compounds were selected that can inhibit both the bacterial TyrDC and human AADC (the enzyme is already targeted in patients).Why does this matter? These compounds could lead to more effective symptomatic treatments for Parkinson’s Disease. Due to differences in the gut microbiome, some patients might benefit more than others, notably those with high levels of levodopa-hungry gut bacteria. Check out the full study here: https://doi.org/10.1016/j.ejps.2025.107133 . I always learn a lot of new, super-interesting things in these types of collaborations. Which is one of the reasons why I chose to do science for a living in the first place.

Restriction Enzyme Calculator

Tue, 29 Apr 2025 00:00:00 +0000

Use our interactive tool to calculate the volume of restriction enzyme required for your digest.

Restriction Digest Calculator

Sometimes, you need to know how much restriction enzyme is required to cut a specific amount of a certain plasmid within a given time. Here is the calculation tool you have been looking for! All data that was used to write the code for this algorithm was obtained from New England Biolabs (NEB). The survival of the enzyme in the reaction was extrapolated from the experiments reported by NEB. Just plug in the numbers into the form and hit the submit button!

VEGFC-loaded Lignin Nanoparticles

Thu, 24 Apr 2025 00:00:00 +0000

Vascular Endothelial Growth Factor C (abbreviated either VEGFC or VEGF-C) has been used in several preclinical models in regenerative medicine. Its potential applications range from repairing damaged heart tissue to treating neurodegenerative disorders . While repairing damaged hearts and brains is not realistic at this moment, VEGFC does offer a glimmer of hope for patients with lymphedema — a chronic condition that presently can only be treated symptomatically. Yet, despite promising preclinical and even some clinical trial data, one key hurdle remains: effective delivery.The current frontrunner, adenoviral VEGFC (AdVEGFC) gene therapy, had progressed to phase II clinical trials, but the results were inconclusive . One possible explanation is that the amount or the duration of VEGFC production by AdVEGFC is insufficient. Its rapid inactivation by the immune system is a double-edged sword, making it a safe, but perhaps not very potent drug. This shortfall has sparked interest in novel delivery systems that bypass the immune system while providing controlled and sustained release.In our latest preprint , we explore the potential of lignin nanoparticles (LNPs) as carriers for VEGFC, from synthesis to stability. Why lignin? Lignin, a major component of plant cell walls, is the second most abundant biopolymer on planet Earth, and it can be extracted from many different sources and synthesized into nanoparticles.Our stability tests revealed that VEGFC is relatively stable on its own. It easily survives weeks of storage at elevated temperatures, and we have kept it at 4°C for a year without any significant loss of activity. It is also relatively stable against proteolytic attacks. It is not degraded by trypsin or thermolysin, and even withstands limited exposure to proteinase K. However, freezing and thawing cause it to lose activity (one cycle is acceptable, but after 32 cycles, it has lost most of its activity). Therefore, nanoparticle delivery might not be critical for protecting VEGFC from degradation, but sustained and delayed release would be its major advantage.We loaded VEGFC onto the particles and evaluated its release profile. Our findings indicate not only successful encapsulation but also a delayed release pattern, suggesting that LNPs could serve as a slow-release depot for VEGFC. We discovered that VEGFC can hang around for a long time even on its own, as the difference between naked VEGFC and LNP-delivered VEGFC was less than we had expected. In a modified Ba/F3-VEGFR3/EpoR bioassay, naked VEGFC sustained cell survival and proliferation for more than a week, even though at the later time points, not to the same levels as LNP-bound VEGFC. Based on previous studies, we attribute the innate ability of VEGF-C to “hang around for a long time” to its affinity for specific extracellular matrix components and cell surface molecules such as heparan sulfate proteoglycans. Even though most of these interactions are mediated by the silk-homology domain of VEGFC (which was absent in our study, which used mature VEGFC), some of these interaction capabilities also seem to remain in mature VEGFC.With this study, we dipped our toes for the first time into nanoparticle-based delivery of biologics. Our work supports the feasibility of LNPs as an alternative to viral vectors. However, there is room for improvement. One way to improve the delayed release is to modify VEGFC (as was done by Güç et al ). However, instead of modifying a cDNA that codes for mature VEGF-C (as Güç et al. did), it might make sense to try pro-VEGFC. After all, pro-VEGFC is the endogenous, inactive “latent form” of VEGFC. That’s what we’ll try next. Check out the full preprint for detailed methodology and data! Link to the preprint: https://doi.org/10.1101/2025.04.23.649697

Scholar-what?

Mon, 07 Apr 2025 00:00:00 +0000

This morning, an email from ScholarGPS dropped into my inbox informing me that Your prolific publication record, the high impact of your work, and the outstanding quality of your scholarly contributions have placed you in the top 0.05% of all scholars worldwide according to the most recent 2024 ScholarGPS rankings. Is this some scam to inflate my ego first and then make me buy into some subscription service? I was Googling around, but it seems to be a legitimate endeavor. I am not clear why somebody thinks that there should be still another company collecting this kind of research metrics, and why universities would be buying their ScholarGPS Pro subscription, which is aimed at academic institutions and apparently the way they monetize their service. ScholarGPS was founded in 2022 and evaluates individual scholars, institutions and publications. I briefly checked their rankings, and the institutional rankings are - with a few exceptions - pretty in line with other well-known ranking systems. E.g., the University of Helsinki ranks 82nd , behind the Karolinska Institute (67), ETH Zürich (56) and the University of Copenhagen (54). The three highest ranked publications are all about technical advances in protein analysis (Lowry, Bradford and Laemmli). Their numbers for these three (235778, 208682 and 195947 as of April 7th, 2025) do not match with Scopus (273686, 233419, 220553), Web of Science (356029, 242982, 259225), or Google Scholar numbers (234173, 261986, 307492). Do they really do their own counting? They claim to use AI. I don’t think counting counts as AI, and for all that counts, AI is really bad at counting and other simple math ( https://x.com/yuntiandeng/status/1836114401213989366 ). What does this “top 0.05% of all scholars” actually mean? Not much if you do not know how big the pond is from where you are fishing. There is no precise definition of what a “scholar” is. Scopus and Web Science contain profiles for about 10 million unique authors. And 0.05% of these is 5000, which is still a large number. ScholarPro claims it has data about 30 million scholars and 15000 academic institutions. For all that it’s worth, I checked the other experts on the VEGF list , and the vast majority checks out as legitimate (#1 Napoleone Ferrara, #2 Kari Alitalo). They have broken up science into many subspecialties, and you can look at the ranked experts in each of these (e.g. angiogenesis or TGF . Although the categories sometimes appear random. Why are there VEGFs and TGFs, but not Angiopoietins?

English or Finnish?

Wed, 26 Mar 2025 00:00:00 +0000

I am teaching to Bachelor, Master and PhD students at the University of Helsinki . While almost all Master’s and PhD theses in the life sciences are written in English, I am always discussing with BSc students the question of whether to write the thesis in Finnish or English. I am comfortable with both Finnish and English, but when you need to decide, you might want to consider a few things:

Space exploration

Tue, 25 Mar 2025 00:00:00 +0000

When I was 10 years old, I wanted to become an astronaut. Not anymore. I still think space exploration is exciting, but given our chances of survival in space, I very much prefer to stay on planet Earth. We don’t even know yet how to protect humans on the way to Mars…

Billion-dollar gamble

Fri, 28 Feb 2025 00:00:00 +0000

Last December, Forbes published a feature article about Megan Baldwin’s work to improve the antiangiogenic treatment of eye diseases. I hope she wins her billion-dollar gamble not only because the drug in question was invented here at the University of Helsinki. The drug is called OPT-302 or with its INN name sozinibercept. The patent lists Kari Alitalo and me as the inventors. The drug was initially designed (under the name VGX-300) for cancer treatment, but - perhaps luckily - never really took off as such because it inhibits not only VEGF-D but also VEGF-C, which is needed in the body’s immune response against the cancer. So far, nobody has been able to separate the prometastatic and the proimmunogenic propeties of VEGF-C.

The DTE protein asporin and gut regeneration

Thu, 13 Feb 2025 00:00:00 +0000

Aging and regeneration are two of the most fascinating areas of life science. The somewhat obscure protein (or rather proteoglycan) Asporin, previously known, e.g., to regulate TGF-beta activity in cartilage, has now been shown to play a key role in the regeneration of the intestine. An impressive demonstration of scientific grit, Sharif & Pekka! This paper has been in the making for many years, and there were multiple technical challenges to overcome. Sawan K. Jha started this collaboration in 2017 by creating several cell lines before he succeeded with the recombinant production of Asporin. There is no generally accepted definition for the term “difficult to express (DTE) protein”, but Asporin fits the description well. It has miserable yields, and its activity is easily lost during purification. Sawan also produced and purified the first batches, and after Sawan had moved on to Red-Horse Lab at Stanford University , Sharif (upstream) and I (downstream) shared the production and purification work. Here is the direct link to the publication, which should work until April 26, even if you do not have a subscription. After that, use https://doi.org/10.1016/j.stem.2025.02.009 . If you don’t have a subscription, I will happily send you the PDF by email…

Sartorius Midi Plus

Sun, 26 Jan 2025 00:00:00 +0000

When bigger competitors swallow innovative small companies or brands, the product quality can sometimes suffer due to attempts to increase productivity. I do not know whether this is the case for the BioHit Midi Plus pipetting controller, but we have had our fair share of trouble after the rebranding of the BioHit Midi Plus under the “Sartorius” name. It feels like a bad contact issueOur lab has probably about 20 of these. Among them are the (ancient) bright blue type, the dark blue, and the black models. We had and still have many problems with the black, i.e., the newest model . Although charged, these models sometimes suddenly stop functioning altogether. After pushing the aspirate and eject buttons several times, they start working again (as if there was some contact problem). But sometimes, we need to plug the charger cable for a short time into such a temporary dysfunctional pipette to render them again operational. Even though I have used the older (blue) models almost daily for two decades, this behavior is new to me. It is especially disturbing when working in the cell culture: you have just removed the medium from cells and want to add PBS for washing. Now, your cells are starting to dry out while you are frantically searching for a replacement pipetting aid. As the PI, I work less and less in the cell culture, but when I do, this happens to me nowadays every single time with the Sartorius Midi Plus. Product development should make products better, not worseI have also wondered why these pipettes have not developed much over the years. Why is there no up-to-date intelligent charging controller like every mobile phone has these days? I guess there must be some kind of controller, but apparently, it is not up to the task. Some things did change. For example, the oldest models used NiCd 2/3 AA cells, which were later replaced by NiMH 2/3 AA cells. I assume that the charging controller was also updated since these two battery types need different treatments during charging to optimize the battery life span.I feel that the oldest pipettes of this series have been the most reliable and that the lifetime of the newer models has been decreasing over the years. Since I live very close to the lab, I offered to split cells for everybody in my lab over the last Christmas holidays. However, due to the Midi Plus issues, I got very frustrated when I did the splitting. I needed to exit the cell culture to get another pipetting aid, which is always a big hassle. The MidiPlus that I found (also black) worked, but its LEDs started blinking, and there was some beeping, which I had not experienced before with any of the older models. Sloppy user manualLater, I tried to look up from the user manual what the LED messages and the beeping meant. Sadly, I could not find any information in the manual. Why would anybody include such features and then not document them in the user manual? I contacted Sartorius with this very question on December 31. I received an email reply on January 10th, in which the local service representative offered to visit our lab to sort out our problems. However, none of my questions were answered concerning the missing documentation on the blinking/beeping, and only a repeated request resulted in an answer: Red blinking = battery almost outGreen blinking = chargingSolid green = fully chargedBeeping = battery almost outContinuous beeping sound = battery voltage too low, maybe the batteries need to be replaced In the current version of the manual (01/2022), only the green LED messages are mentioned. It is strange that the user manual was distributed with incomplete information for something like 10 years. Did Sartorius not care? Maybe an intern wrote the manual who never used the BioHit Midi Plus for long enough to ever witness the blinking/beeping? However, Sartorius promised that they would add the missing information to the next edition of the user manual. **Should we switch to Integra? Any user experiences with other brands?**When I started my lab, the first Sartorius-branded black Midi Plus we bought was broken right from the start. It never was able to recharge its batteries and went straight for repair. Interestingly, all three of our (original) Integra Pipetteboys are still going strong. Yes, we needed to exchange the batteries, but the Integras have the advantage of running on rechargeable 9V cells, which you can buy almost everywhere where batteries are sold. This is in stark contrast to the Midi Plus’ 2/3 AA batteries, which you need to order from Sartorius for a premium price. I guess that Sartorius sells these batteries for about 10 times the price that they buy them for from the Chinese manufacturer. Unfortunately, Integra does not sell the original Pipetteboy anymore, and I have no experience with the Pipetteboy acu 2. **What is your favorite pipetting aid?**Are you using electronic pipetting aids in your work? I would like to know your experiences: Which brands are reliable, durable, and affordable? I have no problems with paying a premium price for a premium product, but it feels to me that, at this moment, Sartorius’ BioHit Midi Plus only earns the premium designation for the price, not for the performance.

Most dangerous disease of 2025?

Wed, 08 Jan 2025 00:00:00 +0000

Thanks to effective vaccines and evidence-based treatment, Covid-19 is not the most dangerous disease of 2025. Equally unsurprising for experts is the fact that HIV, tuberculosis, and malaria are still the top three diseases of concern this year. These cover three different types of pathogens: viruses, bacteria, and parasites. All three collectively kill about 2 million people every year. We in Europe and the US think of HIV, tuberculosis, and malaria as diseases of the past or as manageable chronic diseases. However, all three of these can come back. Malaria was, e.g., endemic in Finland before it slowly disappeared ( last indigenous case in 1954 ). As a consequence of climate change, it could not only return but also spread into countries that have never seen it before. However, in Europe and the US, we probably should be most afraid of the bird flu (avian influenza). Why? Because all pieces are in place for the end of the world as we know it. Influenza type A H5N1 is the type of bird flu currently writing headlines. It has recently caused many outbreaks in birds and cows. Also, humans have increasingly become infected by birds, cows, or drinking raw milk. The only thing that prevents the bird flu from becoming a pandemic is that the bird flu virus does not easily transmit from human to human. However, it only takes a single mutation to change this behavior ( https://doi.org/10.1126/science.adt0180 ). With every infected human, the chance that this mutation happens increases. Influenza is notably an RNA virus, which does mutate on average much easier than a DNA virus. Therefore, it makes much sense to vaccinate the people who are at the greatest risk of contracting the disease, like poultry workers, bird ringers, or vets. Finland has started to do exactly that , and also several other EU countries are following a similar strategy . However, unless the rest of the planet follows, these actions won’t make much of a dent in the global mountain of risk in front of us. The production of a bird flu vaccine is routine and could be done rather rapidly since the process is identical to the generation of the seasonal flu vaccine. But I doubt that it will be possible to vaccinate the population fast enough. Big countries like Germany apparently want to wait until the virus has mutated. How else can you interpret the statement of the German Federal Ministry of Health that Germany would only acquire bird flu vaccines ‘ in the case of an existing or imminent threatening communicable disease ’. What could possibly go wrong? It is scary that in the US, somebody advocating raw milk might soon be the secretary of Health and Human Services. Other countries take the threat more seriously. While most countries - including Finland - have dismantled their state-run vaccine development centers years or decades ago, the UK maintained a state-owned vaccine development and evaluation center (VDEC, UKHSA’s Vaccine Development and Evaluation Centre ). The UK government has just tasked its VDEC with making 5 million doses of a bird flu vaccine to prepare for a possible epidemic ( https://www.euronews.com/health/2024/12/03/uk-purchases-5-million-bird-flu-vaccine-doses-to-prepare-for-possible-pandemic ). With up to 30% mortality in humans , the bird flu makes Covid-19 (0.3% mortality for unvaccinated people my age) look like a bargain. While the 30% mortality rate is likely an overestimate, even a 3% mortality rate would still be about 10 times worse than COVID-19. Differently from COVID-19, we know the virus and could be well prepared. But with an incompetent government (and I am not only thinking of the coming US government), we are heading straight for the apocalypse. It is unlikely that any warp-speed operation or vaccination campaign will be fast enough to catch up with the flu wave that will be rolling around the globe faster than ever due to air travel having surpassed pre-COVID-19 levels and further on the rise. Happy New Year - and don’t forget to stockpile toilet paper! This piece is loosely based on the discussion about emerging diseases in episode #1017 of the The Skeptics’ Guide to the Universe podcast..

Our lab won't go bancrupt in 2025!

Fri, 29 Nov 2024 00:00:00 +0000

Our lab has been so unlucky with its recent grant applications that I was already seriously considering alternative career paths. Like becoming a tram driver. Helsinki and its surrounding cities are expanding their tram networks, and good drivers are rare. However, the Cancer Foundation Finland has now ended our unlucky streak! Although it is only a modest amount, I am hopeful for the future. Not all research is equally expensive: some methods need more money than others, and ours are at the budget end of that spectrum. What project got funded? Well, it’s not our novel protein expression system, but a project to answer a question that has been bugging many vascular biology researchers since 2001, when the Achen/Stacker lab published a paper showing that mouse and human VEGF-D do NOT share the same receptors, but that mouse VEGF-D does not bind mouse VEGFR-2 ( Baldwin et al., 2001 ). We showed in 2011 and 2019 , that the proteolytic activation of VEGF-D by cathepsin D leads to a loss of all VEGFR-3 binding in human VEGF-D. If this was true for mouse VEGF-D as well, it would be a growth factor without a receptor! This is not impossible, but it would be exceptional. It is important to get these molecular details right because we are testing our future cancer drugs always in mice. If there is a big difference in the angiogenic signaling between mice and men, this could render much mouse data very difficult to interpret and perhaps even explain why drugs that work well in mice fail in humans. Notably, among all drugs, oncology drugs have the worst success rates in clinical trials. There is reasonable evidence to believe that VEGF-D is the “bad boy” in the VEGF family, i.e., the one that is responsible for cancers developing resistance against antiangiogenic cancer therapies, that are based on blocking VEGF-A. In any case, a big shout-out to the Cancer Foundation Finland! Read here about the award.

JuFo ranking: A Worse Impact Factor?

Sat, 02 Nov 2024 00:00:00 +0000

Changes to the Finnish PhD educationAll Finnish universities are lowering the requirements for a doctoral thesis. Instead of 3 to 4 publications, you can now defend your thesis with 2 to 3. One argument favoring this change was to create a level playing field with other countries. None of the big European countries requires any publications to get a PhD: Neither Great Britain, Germany, France, or Italy do. The other Scandinavian countries are the only other European countries that have (or have had) similar requirements with respect to the number of required publications, with Sweden being almost on par with the Finnish system.If international harmonization was the goal, the change should have been more radical, i.e., get rid of any requirement for publications. However, the new rules just ensure that we lose in quality what we gain in quantity. I prefer fewer but better-educated PhDs, but our current government apparently just wants to bump up the number of PhDs that Finland produces. Publish of perishI fear that the push towards a shorter PhD might decrease the quality of the publications. PhD students are now under pressure to get three papers out in 3 to 4 years. As soon as the “smallest publishable unit” has been produced, it is pushed out into the world. Few research groups have the luxury of postponing publishing research results for a long time because the publish-or-perish culture is still flourishing. While Finland has abandoned the impact factor (good), we have replaced it with a less transparent system (bad). The currently used metric in Finland is the JuFo system, where journals get ranked into classes 0-3 based on “expert consensus opinion.” JuFo is the abbreviation of Julkaisufoorumi (“Publication forum”).Since everybody (including experts) has their preferred go-to journals, this opens the door to bias and even manipulation. There are plentiful examples of highly respected, 10+ impact factor journals with astronomically high rejection rates that were for a long time classified as JuFo 1, until - after a rotation of members in the respective JuFo panel - they were finally bumped to level 2. Why is there such a thing as JuFo rankings in the first place? One argument is that the Journal Impact Factor (JIF) does not account for the individual differences in the publication and citation cultures between different research fields. These differences are huge, but after classifying all journals into individual categories (e.g., clinical medicine versus languages versus agriculture, etc.), one could develop a compensation formula (perhaps even including manually assigned compensation factors) to adjust the JIF for such inter-discipline differences. A software script could do all the work of the JuFo panels automatically and transparently. Bibliometrics researchers have proposed such better alternatives to the JIF. Please drop me an email if you think that I am missing something here! Anecdotes versus dataHaving a system that allows for “manual” downgrading of journals is certainly a good thing. I also endorse JuFo’s attempt to solicit individual researchers’ feedback. However, when you count the number of journals JUFO needs to evaluate, you will see that gathering feedback from 180 individual scientists’ experiences and then downgrading 60 journals based on this feedback has issues. That’s what happened a few years back. If we assume that ALL feedback has been negative and ALL negative feedback has resulted in a downgrade, there will be a tiny number of cases for each journal. In the parlor of evidence-based medicine, some of these cases might be anecdotes. Don’t get me wrong: These decisions are probably not wrong, and neither is it wrong to gather feedback from researchers. In fact, my own experience with one of the downgraded journals (International Journal of Molecular Sciences) is pretty much indicative of predatory publishing. However, the data underlying these decisions is not the best, and it would be surprising if every single one of these decisions would hold up to scrutiny. It is difficult to imagine how such feedback could avoid bias. It’s self-reporting, and researchers might be incentivized to report negative experiences. Grading on the curveAnother little-known fact is that JuFo is a zero-sum game. Journals cannot be freely distributed over the four categories, but JuFo uses a variation of “grading on a curve”: No more than 10% of the articles published in journals for a specific JuFo panel (e.g., for Chemical sciences) are allowed to fall into JuFo category 3. This accounts for differences in publication volume between fields. However, if we - the scientific community - improve the quality of our publication output generally, this will not be reflected in the JuFo ranking. That is, in my opinion, wrong (for the same pedagogical reasons that schools are discouraged from grading pupils on a curve). **Decisions behind closed doors?**The second big issue is transparency. The fact that I have to speculate in the paragraph above about the numbers that have led to the downgrades is worrisome:

Teaching ”Biological Drugs” in Finnish

Fri, 01 Nov 2024 00:00:00 +0000

In 2022, the steering group of the International Master’s Programme in Pharmaceutical Research, Development and Safety (MPHARM) collectively received the Innoopeli prize 2022 for developing teaching at the Faculty of Pharmacy . As a member of the steering group, I was a bit surprised as none of our students had graduated yet. However, the preliminary laurels received approval earlier this year, when the first batch of the students graduated .

Producing proteins better than the pros

Thu, 31 Oct 2024 00:00:00 +0000

Congratulations, Laura & Akseli! Your article in Scientific Reports ( https://doi.org/10.1038/s41598-024-77104-3 ) is a solid piece of work that has not only relevance for cardiovascular diseases but also for the work that we are doing on lipedema/lipoedema (and therefore, potentially even for lymphedema, which has been the main focus of our research in the past). There are astonishing similarities between coronary artery disease and lipedema, because both can be regarded as lipid storage disorders.And thanks to Khushbu and Betül for helping Laura produce and purify such a high-quality LCAT protein that worked better than the protein preps that are commercially available! Perhaps much of the secret was the high expression levels that we could reach compared to other systems. For the first time, we tried out HEK293T cells with a custom CHO vector ( pCHOKE-B-LCAT-H6 ), and it worked surprisingly well. pCHOKE-B was assembled from scratch and we incorporated several advancements made over the years compared to regular CHO expression vectors. The vector contains

Images for talks and illustrations

Mon, 09 Sep 2024 00:00:00 +0000

I promised in January to list websites where you can find free images ( free as in beer and free as in speech ). And then I forgot about the promise. Since I mostly use Inkscape to draw illustrations, I normally search for SVG images. Inkscape is an open-source software that generates vector graphics. SVG is not only the web standard for vector graphics but also the native file format for Inkscape. Sometimes, PNG or JPEG images are also acceptable if they can be easily converted into SVG images (e.g., silhouettes). Occasionally, I look for 3D images (“models”), and then I prefer them in Blender format (the only 3D software that I have used more than just a few times).There are two different types of free images on the web: Public Domain and Creative Commons . Public Domain images can be used without restrictions, while Creative Commons images typically come with some restrictions. The most common restriction for CC-licensed images is that you need to credit the creator. Sometimes, there are additional restrictions, such as prohibiting commercial use or modifications.When you do an image search with Google or DuckDuckGo , you can restrict the view to images that conform to a specific license. However, Google and DuckDuckGo cover only a fraction of the internet, and there are search sites that have specialized in searching for specific images.You may also ask AI to generate the perfect image. It typically requires several iterations to get something useful, and you will never be able to get copyrights for the image, even though you spent hours engineering the perfect prompt. You can try e.g., DALL·E 3 , or you can even run some AI image generators on your own computer like Stable Diffusion . The image above was generated with DALL·E 3, using the following prompt: “A person surrounded by images, symbolizing the search for the perfect image.”

What do we really know about lipedema?

Mon, 09 Sep 2024 00:00:00 +0000

Lipedema is an accumulation of subcutaneous fat, mainly in the lower body, which is resistant to weight loss and occurs almost exclusively in women. It is often painful, prone to bruising and is thought to have a genetic component, which is likely triggered by hormonal changes. Although lipoedema was recognised as a condition more than 80 years ago, our understanding of the condition and its aetiology remains incomplete. This is due in no small part to the fact that lipoedema has only recently been included in the official classification of diseases. Virtually all aspects of the condition are controversial, starting with its classification. The symptoms of lipoedema overlap with those of obesity, lipodystrophy, lymphoedema and connective tissue disorders. There are as yet no specific tests, and due to the uncertainty surrounding diagnosis, there is also considerable uncertainty regarding the prevalence of lipoedema, with estimates varying widely from 1 in 75,000 to 39 per cent of all women. Many hypotheses have been put forward regarding the cause of lipoedema, including that it is a lipid metabolism disorder, a connective tissue disorder, or an inflammatory or immune-mediated disease. A definitive cause has not yet been identified, and the search for ‘lipoedema genes’ has so far yielded no conclusive results, with the exception of individual genes that play a role in only a small proportion of all patients.

6. Swiss Lymphsymposium

Sat, 07 Sep 2024 00:00:00 +0000

The 6. Swiss Lymphsymposium has just completed. This symposium seems to gain popularity with every iteration, and I heard that there was a waiting list this year. The Juzo AG had invited experts to discuss topics at the intersection of Edema and Adipositas. The meeting was interesting and did not shy away from controversies. For a bench scientist like me, it is always stimulating to get the healthcare practitioners’ perspective into the diseases whose molecular basis I research. I had been at the 3. Swiss Lymphsymposium in 2021 , and there have been many developments that I have chosen not to pay attention to in my ivory tower of basic biomedical research. Specifically, the new S2k lipedema guidelines which are in effect since the beginning of 2024 received lots of attention.The new lipedema guidelines consider questions and goals related to diagnostic criteria, differential diagnostics, how diagnosis and therapy are influenced by co-morbidities, what therapeutic possibilities exist, and how patients can actively contribute to managing the disease. Given how little we understand about the etiology of lymphedema, these goals are ambitious. Dr. Tobias Bertsch from the Földi Clinic gave a very passionate and persuasive talk about the progress these guidelines represent in his talk “The New Guidelines Concerning the Lipedema Syndrome - More Light Than Shadow”. The presentation loosely followed the position paper he published with many other European experts. The one item where the position paper deviates most from the guidelines is the evaluation of liposuction as a treatment option. The position paper clearly states that liposuction does not produce long-lasting results, whereas the guidelines are surprisingly sparse-worded about this topic, and the reached consensus received the lowest support from the authors among all recommendations.For a bench scientist, making decisions absent high-grade evidence remains unsatisfying. However, guidelines for healthcare professionals cannot speak the same language as scientific articles because that would counteract their usefulness. “Whoever heals is right”, and if the new guidelines result in better medical outcomes, they serve their purpose. Guidelines - as scientific knowledge - are always provisional and subject to adjustment once better evidence becomes available. At the same time, we have to be careful not to block progress by taking them as gospel. After all, the saying “Whoever heals is right” is attributed to Samuel Hahnemann, the German physician who founded homeopathy (which is essentially witchcraft; do I need to mention this?). Nevertheless, when Samuel Hahnemann lived, using homeopathy likely resulted in better medical outcomes than the mainstream treatments of the time, such as bloodletting or patent mercury potions, which were frequently not only useless but dangerous or toxic.How I view lipedemaAfter following the lipedema field for a few years, my hypothesis is that lipedema is one endpoint in the wide spectrum of human fat storage physiology. Fat storage has been such a big asset during 99.999997% of evolution that nature was willing to accept the many risks inherent to complex and difficult systems. The more complex a machine, the more frequently it will fail, and many hereditary lipid-related diseases are failures of this machinery. The essential problem that this complex machinery has evolved to overcome is the insolubility of fat in water. Any transport of fat inside and outside the cell requires rendering fat water-soluble. In the blood, this is achieved by packaging fat molecules into lipoprotein particles.Lipids that are not burned get stored somewhere. They can be stored subcutaneously or viscerally. There are more ways to store fat, but this is the simplified version: Everybody will have a slightly different distribution between visceral and subcutaneous fat storage based on a complex interplay of many genes and the environment. In some people, this interplay results in extreme imbalances between these two compartments with pathological consequences. For example, in coronary heart disease, for most people, the genetic burden results from many genes (polygenic), whereas in a minority of patients, one or a few genes might explain the condition (monogenic or oligogenic). Hunting genes likely won’t result in any actionable findings for most lipedema patients. However, similar to coronary artery disease, it might be possible to identify risk factors. We already know three risk factors for lipedema: being female, undergoing hormonal changes, and having a family history of the disease. It would be helpful to identify additional risk factors that are easier to modify than the three we know of. We need for lipedema something similar to what the blood lipid panel is for coronary heart disease. Here is the link to my presentation (which I will keep updating over time with better information): What do we really know about lipedema? . You can also download the German version Was wissen wir eigentlich sicher über Lipödeme? - Eine Bestandsaufnahme" .

Do fish have difficulty breathing?

Fri, 28 Jun 2024 00:00:00 +0000

Fish are breathing with their gills, but this is literally, for many of them, only half of the story. The difficulty of extracting oxygen from water is the single most defining force that shapes fish evolution. Land animals are mostly exposed to the same oxygen concentration, but fish need to operate in waters of vastly different and rapidly changing oxygen content. Moreover, water contains much less oxygen than air, and the diffusion of oxygen in water is magnitudes slower than the diffusion of oxygen in air. Therefore, fish evolution was forced to come up with creative ways to

Who does still restriction enzyme cloning?

Thu, 27 Jun 2024 00:00:00 +0000

Restriction enzymes cleave DNA at specific sites and thus enable — together with DNA-ligating enzymes — the molecular cut-and-paste operations that still underlie most of today’s recombinant DNA constructs. There were always some alternative assembly methods, but about 10 years ago, restriction enzyme cloning got serious competition from the single-tube homology-based assembly strategies (foremost from “Gibson Assembly” and its derivatives). Despite this, restriction enzymes still occupy an important position in any recombinant DNA workshop.There are not many commercial providers with a large portfolio of restriction enzymes. New England Biolabs and ThermoFisher are the two big elephants and are the only providers with more than 200 different enzymes. All other players (Roche, TaKaRa, Promega) have a much less comprehensive offering. About 10 years ago, I argued that nobody should use FastDigest enzymes from ThermoFisher. You can read that blog post , but it comes down to the following take-home message:ThermoFisher does not provide enough information about its enzymes to use them as equals in a mixed environment with enzymes from vendors that have full transparency, such as New England Biolabs (NEB).This close-mindedness has led ThermoFisher to invent their own definition of restriction enzyme activity based on a 5-minute window, which makes straightforward comparisons with competitors’ enzymes impossible since they use the standard 1-hour window. Since enzymes survive for different amounts of time in a reaction, and since ThermoFisher — unlike NEB — does not provide any data about their enzymes’ survival times, no meaningful comparison is possible. One wonders whether the only purpose of the new unit definition was to prevent any comparisons. That alone should be sufficient reason to avoid ThermoFisher like the plague, but there is more. In 2014 I pointed out that after acquisition of Fermentas by ThermoFisher, not a single new FastDigest enzyme had been added to their product line. This statement is still true a decade later (and it is equally true for conventional restriction enzymes). Innovation concerning restriction enzymes has also slowed at NEB, but since 2015, NEB added some five HighFidelity enzymes (ApoI, BbsI, BclI, BsiWI, BstZ17I) as well as a few conventional restriction enzymes to their portfolio.The biggest issue I see with ThermoFisher’s policy of silence. hardly anyone knows that they sell isoschizomers under the prototype enzyme’s name. While they are upfront about the use of isoschizomers in their non-FastDigest lineup, they do not disclose the identity of their FastDigest enzymes. Many of the FastDigest enzymes are isoschizomers according to Arvydas Janulaitis , the former CSO of Fermentas , the company that developed the FastDigest system before they were swallowed by ThermoFisher in 2010.In a recently updated flyer , Thermo Scientific tries to paint a picture of superiority over NEB but only manages to fool cloning novices. In their infographic, they try to emphasize the simplicity of the buffer choice within ThermoFisher’s restriction enzyme portfolio and compare it to NEB’s portfolio.However, they ignore their 190 conventional enzymes that are not FastDigest buffer-compatible (and this group includes important enzymes, e.g. the “GoldenGate” type IIS enzyme BsmBI). To correct the record, I have made a better graphical comparison between ThermoFisher and NEB, which is the main image of this blog post.Even my comparison is optically misleading since it does not account for redundant enzymes, which ThermoFisher features a lot due to its aggressive acquisition strategy. In this comparison, it looks as if ThermoFisher offers more different enzymes, but this is not the case at all. Accounting for redundancies, NEB has 257 different commercially available restriction enzymes, while Thermo Fisher has only 209. I did not count myself but relied on the newest enzyme description file from the best cloning planning and documentation software SnapGene .In 2014, I complained that their Fast Digest buffer has a proprietary composition, and when I checked today, that was still the case. There has been zero progress at Thermo Fisher’s restriction enzyme front: no innovation, no increased transparency.

Ouriginal fails more often than not to detect plagiarism

Thu, 23 May 2024 00:00:00 +0000

Ouriginal , the plagiarism detection service formerly known as Urkund, has been in use at the University of Helsinki for a very long time. Because of Ouriginal’s inability to process some of our students’ Master’s thesis, I spent a little bit of time investigating Ouriginal and its problems. Here’s what I found out. From Swedisch to European to US-AmericanIt is unclear to me which software we are really using since Ouriginal is a merger of the Swedish Urkund and the German PlagScan, and in 2021 Ouriginal was acquired by the American Turnitin . I don’t need any of such software, but our university mandates that theses must be scanned by the software. Since I read and evaluate an increasing number of theses every year, I also increasingly use Ouriginal. Ouriginal supports many document formats, but support is buggy Looking at the history of submissions, I realized that until about mid-May 2024, all submitted PDFs had been dutifully analyzed. But last week, something changed since about half of the submitted documents were not processed. The usual tricks (submitting in another format such as .docx, .odt, .ps, .rtf) did work for some, but not all of the theses. One thesis was especially stubborn, and neither our “experts” nor the Original helpdesk staff had any clue why their software could not process it (which makes me again wonder what software their backend is actually using). Ouriginal is investigating already for a month without getting back to me with answers… Our university receives funding from the Ministry of Education based on graduating students, and we lose thousands of Euros for each student who fails to graduate on time. Fee-liable students also have a strong incentive to graduate on time in order to avoid additional costs. Therefore, every delay in the graduation schedule is unacceptable. Ouriginal’s performance disappoints with a shocking detection rate Since there are dozens of ways how to turn a Word document into a PDF, I tried to isolate the problem by submitting test documents to the Ouriginal service. I used manuscripts that we had published over the last few years. I was shocked when I realized that Ouriginal failed to detect plagiarism in more than half of all cases. Paywalls are not to blame since almost all our publications are freely available. Neither the novelty of the publication nor the quality of the journal made a perceivable difference. However, it seems evident that Ouriginal has more problems with non-English documents. It is very difficult to explain why so many freely available scientific texts from reputable journals ( Scientific Reports , Angiogenesis , Annals of Anatomy ) are not indexed by Ouriginal. Failure to detect plagiarism from Helsinki University’s own thesis repository Original does not even index our own university’s freely available PhD theses ( https://ethesis.helsinki.fi ). None of the PhD thesis written in my own lab was recognized. I also checked my own PhD thesis , and it was the only one that was recognized (Ouriginal found it on docslib.org , not our own university’s official thesis repository). Does it make any sense to pay for such an imperfect service? I don’t think so. The omission of freely available texts from important journals seems inexcusable since a simple Google search does a better job. I did Google searches for sentences from the unrecognized texts, and in most cases, Google identified the original source without problems. A Python script to split texts into sentences for individual Google searches and to aggregate the results can be written by any programmer in an afternoon. Why would you maintain your own database if Google does a better job than you can? Plagiarism to the following published manuscripts/theses/proceedings was NOT detected:*

Admission interview

Thu, 09 May 2024 00:00:00 +0000

An increasing number of MSc study programs at our university are incorporating an interview into the admission procedure. Tiina Immonen from the TRANSMED program was the pioneer at the University of Helsinki who ventured first into this territory. If you are invited to an interview at the University of Helsinki, you have already taken the biggest hurdle, which is the evaluation of your application. To be accepted, you have to make sure not to screw up the interview. You don’t need to be stellar, but you need to meet expectations. The reason is that interviews are notoriously tricky to evaluate, and therefore, many programs use them primarily to screen for red flags.

MPHARM milestone

Fri, 26 Apr 2024 00:00:00 +0000

Helsinki University’s International Master’s Programme in Pharmaceutical Research, Development and Safety (MPHARM) is close to another milestone: Our first graduates are soon to submit their theses. On Thursday, we were celebrating after the MSc Theses seminar, where the first batch of students presented the results of their thesis work. At the center is Leena , our benevolent director. Not in the picture is Tomi , who deserves much of the credit for making the Drug Design and Pharmacology track such a success!

Mia Sivén, the world's first professor of sustainable pharmacy

Fri, 05 Apr 2024 00:00:00 +0000

When we were asking our foreign students what made them join the University of Helsinki, several of them mentioned sustainability aspects. Many of the research groups at the Faculty of Pharmacy study topics that are highly relevant to a sustainable future. For example, tackling the increasing threat of antibiotic resistance is a high priority for our faculty. And my group works on the planet’s most environmentally friendly protein production system. There is no part of a drug’s life cycle that could not be approached from a sustainability angle. Therefore, it was high time that this over-arching theme was finally acknowledged by establishing a dedicated professor position. To our knowledge, next month Mia Sivén will start her job as the world’s first professor of sustainable pharmacy . You are probably not surprised that I am very happy about this appointment.

Finished with Finnish?

Sat, 30 Mar 2024 00:00:00 +0000

In her opinion piece in Helsingin Sanomat , Annikka Mutanen picked up on the predicted population decline in the numbers of Finnish people : At the end of this century, the number of people in Finland with Finnish roots will have fallen below 2 million. I won’t be around anymore to experience this, but my children have a good chance to.

Essential elements for life science

Sun, 24 Mar 2024 00:00:00 +0000

Here is my version of a simplified periodic table for life scientists. A few years back, my son learned the complete periodic table by heart up to element 118 (Oganesson). He found it funny that I only knew the first two rows. I am not embarrassed, even though I don’t even remember the first two rows entirely. There are elements that I almost never encounter during my work, such as aluminium. Yes, I know that aluminium is used as an adjuvant for immunization. But then, we can’t even agree on whether to spell this element “aluminium” or “aluminum”! And I would even forget Beryllium if it wasn’t for the fact that I once have been gemstone hunting for Beryll (which you can find in Finland ). At work I come across no more than perhaps 11 elements (which make up more than 99.5% of the human body). The question of how many elements are essential for human life is not easy to answer. It’s somewhere between 19 and 29. Why are there so many elements with an unknown status? Some of the “controversial” elements might not be strictly essential for life, but still necessary for good health. Where to draw the border? And then there is the problem of how to experimentally prove essentiality. Many of the controversial elements are so-called ultra-trace minerals, and it is very difficult to rear experimental animals in an environment that is completely devoid of even the smallest trace of these elements ( https://en.wikipedia.org/wiki/Biological_roles_of_the_elements ).

Overstretched IT support

Fri, 23 Feb 2024 00:00:00 +0000

The problem: Crash during boot

More than a year ago, a few weeks after receiving my new work computer, it failed to reboot after a system update and got stuck early in the boot process. I soon realised I could still start the computer using “safe mode”. Strangely, nothing seems to be wrong because when I manually exit safe mode at the end of the boot process, the computer works fine. Our IT department has tried to fix the problem many times without success. I even had to work without a computer for about 3 weeks while it was “under repair”. You probably know how much work you can get done without a computer: close to zero.My computer runs Cubbli 20.04.06LTS, an unofficial Ubuntu spin maintained by the University of Helsinki for internal use. Although you can do bioinformatics on a Windows or macOS computer, Linux is hands-down the first choice. Many bioinformatics developers don’t even bother to release their software for Windows. MacOS works mostly fine (since it is also UNIX-compliant OS), but I would have to pay twice the price for the same calculating power.The computer is a Lenovo P350 with an NVIDIA T1000 graphics card, which I use to address two screens. I mainly need the graphics card for 3D modelling, phylogenetics analysis and similar tasks. This graphics card may have caused the trouble. I initially did not want to buy this model, but since there was a shortage of graphic cards at the time, IT convinced me to swap out my original choice against the T1000.

Back to the monograph?

Thu, 01 Feb 2024 00:00:00 +0000

Finland had become internationally known for producing highly qualified PhD graduates in the STEM fields. This was a result of the requirement to publish 4 to 5 scientific manuscripts in renowned scientific journals. Not surprisingly, it took, on average, about seven years to accomplish that feat. Today, Finnish PhD graduates are perhaps internationally more known for being relatively old once they graduate. I myself was 34 years old when I received my doctoral hat . It took me a bit less than six years.On the other hand, my supervisor was so smart to let me do what I wanted, and I spent quite a bit of time with side projects that did not really advance me on my trajectory towards the degree certificate. However, it also meant that I acquired skills, knowledge, and connections that I otherwise would not have. If you take the 10000-hours-rule literally, 10000 hours equal pretty much a six-year PhD education.At the moment, the Finnish Ministry of Education wants to lower the time required for achieving the PhD goal down to 3 years. This article in World University News is to date the most extensive English information piece that has surfaced about this project.My questions are: Why? and How? The why is pretty obvious: Finland has fallen behind in the OECD statistics of highly educated professionals. To polish these numbers, Finland needs more PhD graduates. And since attention-span-reduced politicians cannot be expected to wait six years, it is only logical that they would agree to spend money to increase the degree numbers, provided this would happen fast.But what about the how? How can PhD students learn in 3 years what they normally used to learn in 6 years? If that were possible, it would mean our current PhD education is massively inefficient. Can we squeeze it down to three years without compromising quality? There is clearly an opportunity for optimization. Especially when it comes to the funding of the studies. There has been a constant lack of university-salaried PhD positions. As a consequence, many PhD students spend a significant chunk of their time applying for grants or - even worse - working part-time in order to make ends meet. However, while absolutely a step in the right direction, paying a salary will not cut down the required time by 50%.There is something annoying about science that politicians might not fully understand: It is impossible to predict the outcome of scientific experiments. This very fact is the only reason you do them in the first place! However, if you cannot predict the outcome of experiments, you cannot predict how long it’ll take to get the work done and publish the results. In order to straight-jacket the process of obtaining a PhD degree into a three-year predictable journey, we need to dig deeply into our academic bag of tricks and resurrect the “monograph”. The monograph is an alternative way to attain a PhD degree. Although alive on paper, it had practically died in the STEM fields decades ago, with more than 99% of all STEM PhD theses being publication-based. In some fields and faculties, the monograph has held on to a higher share, but its popularity has been diminishing everywhere for very good reasons. But now it is back!With the monograph, you don’t open up your scientific output to the scientific community for peer review, improvement, and appreciation (in the form of citations). Instead, you write up your research results in a hundreds of pages thick manuscript that is only scrutinized by your supervisors and two external experts appointed by the faculty council. What could possibly go wrong? I hope that I am wrong, but a three-year PhD education will likely not be able to offer the same as a six-year PhD education. Besides, there are other factors that unnecessarily slow down PhD education, which are not addressed in the current pilot. The most notably ignored factor is the supervisor-to-student ratio. Due to the sustained relative decrease in the funding of the basic university functions, teachers and supervisors at Finnish universities are already very thinly stretched, and the current “suboptimal” supervisor-to-student ratio will deteriorate with 1000 additional PhD students who will enter Finish universities over the next year. I fully understand the desire to harmonize the PhD degree at the European level (something that we have done more-or-less successfully with the BSc and MSc degrees starting with the Bologna process in 1999). We don’t know many of the implementation details for this pilot yet. But very clearly, most of the real stakeholders were never asked when this pilot had been cooked up.UPDATEThere have been two articles in the Finnish daily newspaper “Helsingin Sanomat” about this pilot that talk about the two most important points of criticism that have been targeted at the 1000-PhD-students project, namely the decrease in PhD education quality that seems to be inevitable and the very unequal distribution of the funding between different disciplines: https://www.hs.fi/politiikka/art-2000010217525.html https://www.hs.fi/kaupunki/art-2000010242698.html UPDATEThe University of Helsinki has finally posted some information about the upcoming call. The page is not available from the news feed, but you have to know what you are looking for in order to find it. This his is counterproductive given the fact that the application period is only two weeks: https://www.helsinki.fi/en/research/doctoral-school/doctoral-education-pilot

Do fish have lymphatics?

Sat, 27 Jan 2024 00:00:00 +0000

Read the whole back story in our preprint: https://doi.org/10.20944/preprints202312.2119.v1 . It isn’t easy to believe that the scientific community cannot agree on whether zebrafish have a lymphatic vascular system. Zebrafish is one of the most successful model organisms in biology, and one would assume that we know its overall vascular setup. However, starting with W. Vogel in 1981 ( https://doi.org/10.1515/znc-1981-5-627 ), many fish physiologists subscribe to the notion that there are no lymphatics in fish, and most contemporary fish physiology textbooks have appropriated this point of view. At the same time, solid publications from multiple labs show that lymphatic vessels exist in fish ( https://doi.org/10.1038/nm1427 , https://doi.org/10.1016/j.cub.2006.05.026 ). What is going on? When the Yaniv lab published in 2022 that embryonic lymphatics in zebrafish can transdifferentiate into blood vessels ( https://doi.org/10.1038/s41586-022-04766-2 ), it suddenly appeared possible to unite the two contradictory views. In a nutshell: In most fish, an embryonic lymphatic system transdifferentiates during development into blood vessels that form a specialized subcompartment of the cardiovascular system (the so-called secondary vascular system). The degree of transdifferentiation seems quite variable between fish species, and some vessels - notably the thoracic duct - might retain a hybrid phenotype.As so often is the case in top journals, the original article by Das et al. neither discussed the 100-year-old controversy nor the ramifications of its landmark findings. Even though Kari Alitalo and I did so in a short commentary ( https://rdcu.be/cOjJ0 ), more space is needed to do justice to the topic. Although the controversy about piscine lymphatics is far from settled, it appears important to record the current status of the discussion in the scientific literature. Moreover, we wanted to describe a high-likelihood consensus model against which to plan future experiments. The result is an extended review; we hope you’ll enjoy reading it. If you find something that you don’t like, by all means, let us know! Especially if you can back up your critique with data or sound arguments. We sent the manuscript for review and are happy to improve it based on your input.

Why you should not use BioRender

Wed, 17 Jan 2024 00:00:00 +0000

About two years ago, our university started subscribing to an institutional plan for BioRender . BioRender is a browser-based scientific illustration software with a large library of pre-made items, including complex illustrations. It allows you to illustrate scientific concepts quickly or to make flow charts for your experimental setups. And given how easy it is to use, the results look rather slick. It’s like the McDonald’s of scientific illustration. It’s fast and gets the job done. Sure, the food in a 3-star Michelin restaurant tastes much better, but most of us rarely can afford that luxury.Why should you not use it despite all of the advantages mentioned above?

It’s difficult to grade student’s assignments

Sat, 16 Dec 2023 00:00:00 +0000

I have been reading hundreds of student assignments this autumn. In many of these assignments, the students are expected to answer questions. Grading these assignments means deciding whether the answer is “right” or “wrong”. This is sometimes difficult. Most answers are somewhere between “right” and “wrong”. Therefore, the need for grading exposes a deeper problem: Before I can decide where on the spectrum from “right” to “wrong” the students’ answers fall, there needs to be an objective “right” and “wrong”. Otherwise, objective grades are an illusion to begin with (not even considering the problem of how to determine them reliably).However, all our scientific knowledge is preliminary. It is subject to modification or even reversal when new, better data becomes available. So, how can one grade any assignment with any certainty? Luckily, not all of our knowledge is equal. One important hallmark of a scientific statement is falsifiability , a concept that was perhaps first popularised by the science philosopher Karl Popper in his book The Logic of Scientific Discovery . What are examples of scientifically falsifiable theories?

The Finnish 1000 PhDs pilot

Tue, 28 Nov 2023 00:00:00 +0000

The Finnish government is going to finance 1000 additional new fully funded doctoral positions, which would start in the academic year 2024/2025.The money (85000€/year for each PhD student) will be competitively distributed between Finnish universities, and some of that money will be used to pay for the salary of the PhD students for three years. Perhaps one of the triggers for this initiative is that Finland has been falling behind in the OECD statistics in the number of highly educated workers. The question is whether this one-time expense will really increase the level of education or only boost the numbers.The average duration of a PhD education is around seven years in Finland. In order to pull off a 3-year PhD education at such a large scale, it is expected that the requirements for the PhD will be lowered. As a matter of fact, the requirements have already been lowered, but further “easings” might still come. Together with these, universities are aiming to streamline the kafkaesque absurd and medieval administration process, which can easily take half a year from the time of completing the last manuscript to receiving the actual PhD certificate.Many other outlets have reported about this pilot; here’s one that is available also in English: https://acatiimi.fi/2023/11/28/for-once/Although most people are happy about the additional money, almost everybody is sceptical to some degree. Good intentions are not enough, and there are many serious issues with this pilot:

Bio-Rad fixes our NGC

Wed, 20 Sep 2023 00:00:00 +0000

UPDATE (situation Dec. 21st, 2024)

We just survived our protein purification course (DPDR-305, see also my other blog posts related to teaching . After having done about 25 runs with the “repaired” Bio-Rad NGC, I sadly have to conclude that the most significant issue remains: that the FPLC becomes unresponsive to commands issued manually. Also, the randomness of these disconnects persisted. Only one student group had problems, but we had several incidents during that single day. That, sadly, concludes our short stint into Bio-Rad territory for protein purification. All of this indicates that any further investments into this device will be wasted time and money. We have neither too much time nor too much money. If Bio-Rad wants to do anything from their own initiative, I am happy to let them do whatever it takes to get the machine into a usable state, but we won’t actively pursue any further actions.The best way to keep your FPLC device in good shape is to have a maintenance contract. Although we have been able to get money from our university to buy a top-of-the-line FPLC twice in the last 30 years, getting money for a service contract is much more difficult. One of the many reasons is that most grant periods are shorter than service contracts, which only make sense if you make them over several years.

Did we publish in a predatory journal?

Thu, 03 Aug 2023 00:00:00 +0000

When I get a manuscript review request, I first look at the journal where the request comes from. More often than not, I do not know the journal’s name. After all, perhaps 25000 scientific journals are published on our planet. If the request comes from a predatory journal, I mostly reject it. Sometimes I accept to expose myself to the nonsense deliberately (it’s at the same time funny and frustrating). But how do you know whether a journal is predatory or not?The question has been asked a lot over the last few years, e.g. in this Nature commentary . In the article, leading experts have come up with a definition. Predatory publishers:

Congratulations, Dr. Khushbu Rauniyar!

Sat, 10 Jun 2023 00:00:00 +0000

Defending a PhD thesis is a BIG thing in Finland, and you just did it. Unlike the rest of the world (perhaps except for Sweden), no other country requires as much demonstration of perseverance from PhD candidates as Finland does. On average, it takes four publications and 7 years. The long duration and the lack of well-defined requirements are two problems the Finnish Ministry of Education wants to address over the next few years to level the playing field for Finnish PhD graduates in the international job market. Completing a PhD in Finland takes a lot of Sisu. Sisu is a Finnish word which cannot be translated into any other language, but the recent movie with the same title can give you an idea. Wikipedia defines Sisu as extraordinary determination in the face of extreme adversity .In the “old times”, drugs were discovered based on their effects while not knowing their mechanism of action. This paradigm is more and more turned on its head. Researchers try to understand the mechanism that leads to disease before they start developing or finding a drug. Much of Khushbu’s thesis is about better understanding the mechanisms that govern the action of the primary lymphangiogenic growth factor VEGF-C: The evolutionary origin, activation, and potential as a drug target . Prof. Eckhard Lammert did a great job as the opponent, and Prof. Kari Keinänen did the same as the custos. Dear Khushbu , we wish you all the best for your next big project!

The human genome was just completed (again)

Mon, 15 May 2023 00:00:00 +0000

More than 20 years ago, the human genome was

completed

(Lander et al., 2001) by the Genome Reference Consortium (GRC). This assembly is known as the GRCh38 reference sequence. Although it is based on DNA from an anonymous group of donors, ⅔ of its sequence is derived from one single male donor of African-European ancestry (Genome Reference Consortium, 2023).*

Cutting-edge vascular biology continues at the Wihuri Research Institute

Wed, 10 May 2023 00:00:00 +0000

Taija Mäkinen has been appointed to become the Wihuri Research Institute (WRI) Director starting in 2024. Like the current director Kari Alitalo , Taija has outstanding expertise in lymphatic vascular biology. Taija is currently doing research in Sweden at Uppsala University . With her contributions, she has revolutionized our understanding of how lymphatic vessels form and grow ( 10.1016/j.celrep.2015.02.026 , 10.1161/CIRCRESAHA.116.306170 ).The Wihuri Research Institute , located at Biomedicum Helsinki, was founded and is funded by the Jenny and Antti Wihuri Foundation . It focuses on cardiovascular and vascular biology. This research is essential for the development of new treatments for heart disease. However, blood and lymphatic vessels penetrate nearly all body organs and play a role in almost all diseases, including inflammatory and infectious diseases, neurodegenerative diseases, cancer, and vascular malformations or hypoplasia. Therefore, the research done at the WRI opens avenues for treating many diseases beyond heart disease. The Board of Trustees of the Jenny and Antti Wihuri Foundation has made an excellent choice, even though I am biased for many reasons. I do similar research, and I worked in the same lab as Taija during our Ph.D. education. Unnecessary to mention that Taija graduated faster than I did …

OMG: T. rex did not have VEGF-B!

Wed, 05 Apr 2023 00:00:00 +0000

Our work on the evolutionary origin of the PDGF and VEGF growth factors has just been published in Angiogenesis: https://doi.org/10.1007/s10456-023-09874-9 . We analyzed both PDGFs and VEGFs, but our focus was naturally on the VEGF side of things. It’s just a coincidence that the PDGFs happened to be a subgroup of the VEGFs and not vice versa, but that’s of course just our biased point of view :-)Since we do lymphatic research, we can proudly announce that the phylogenetic oldest VEGF likely resembled VEGF-C and featured the enigmatic silk homology domain. It makes intuitive sense (and had been proposed before by Jörg Wilting), because the most simple vascular systems that we know of are the so-called hemolymph systems (e.g., in insects), which share many features with the lymphatic system.With this publication, we did not do something exceptional that only a few can do. We did something everybody could do but nobody had done so far: looking systematically at which animals have which PDGFs and VEGFs. Actually, we did something new: we developed a crowdsourcing method for classifying PDGFs and VEGFs. Instead of asking people, we asked databases. There are many PDGF-like and VEGF-like sequences in databases, which are only recognizable as such by the homology of their amino acid sequence. In order to know whether we are dealing, e.g., with a VEGF-C or a VEGF-D, we are running many (PSI)BLAST searches, and then we tally up the majority opinion (as determined by the top hits).Many surprises waited for us after the bioinformatics script had finished its job after two weeks of finding and comparing PDGF- and VEGF-like sequences:

Bad vibes from the new tram

Sat, 01 Apr 2023 00:00:00 +0000

Our showers were banned from use due to the new tram line running in front of my workplace, the Helsinki University Viikki campus. During the trial runs of the tram, I noticed cracks in the changing room’s wall and the showers. I reported these cracks sometime in February to our janitors. Apparently, the structural damage includes the wastewater pipes, and that’s why we can’t have showers anymore. That is a bummer, especially in the summer. To my understanding, the condition of the university buildings had been documented before the construction of the tram line started. Now the investigation is underway to determine whether the additional damage was caused by the construction or the trial runs (and who has to pay for the damage repair).Since I either cycle or run to work, I need to take a shower every morning. My morning routine has become more difficult since the replacement showers have no place where I can hang my wet clothes and towel for drying. While this causes some inconvenience, there will be more serious consequences if there is a causal connection to the tram operation: The university has expensive research equipment, which is sensitive to vibrations. It is incomprehensible how the top university administration could have agreed with the city of Helsinki to run the tram line directly in front of the University building. In fact, the tram now makes a detour to go along Viikinkaari. The more natural and shorter route would have been about 200 meters South of the current track (along Viikintie), avoiding all this trouble. In order to build the tracks directly in front of Biocenter 1 and 2, millions of additional Euros were wasted on vibration-dampening elements to protect our high-end equipment from vibrations. And perhaps all that money was wasted if it should appear that the efforts were insufficient.

GPT-3 is hallucinating again

Tue, 07 Mar 2023 00:00:00 +0000

On the weekend, I needed to finalize my report for UP (University Pedagogy) 3.1 course. Since we had talked much about the usefulness of formal supervision agreements, I wanted to see whether some empirical research supported our ideas. Since our University had discontinued its subscription to Iris AI (an AI-driven literature research tool), I decided to ask GPT-3. I headed over to the GPT-3 playground and asked:"Can you find me five literature references that show the usefulness of a supervision agreement in an academic environment?"It quickly returned five references (see picture). I then asked for the DOIs (I am using Zotero for reference management, and Zotero can easily pull down full-text references if you give it a DOI provided the paper is not behind a paywall).When I tried to download the references, Zotero complained “Zotero could not find a record for the specified identifier. Please verify the identifier and try again.“So I VPNed into the university network to access the article directly from the paywalled publisher’s (Taylor & Francis) website. However, when I browsed the correct issue of “Studies in Higher Education” (2005, volume 30, issue 5), there was no such article. No such author. Nothing remotely looked like the reference it had promised.GPT-3 made up these superficially sound-looking references out of thin air. However, on close inspection, the articles are weird: each has only one author (rare, but not impossible), all authors are doctors (IRL most authors are Ph.D. candidates), and all authors list exactly one middle name (possible, but unlikely). When confronted with the fact that the DOIs are bogus and that they do not resolve to any published article, GPT-3 first claimed that I was not able to access the articles because they were behind a paywall. When I repeated this experiment for the sake of taking screenshots, GPT-3 apologized and promised to fix the mistake. When pointing out that the mistake cannot be fixed since the articles were fictitious, GPT-3 crashed.This behavior makes sense: Similar to how it finds information on any topic and nicely merges it into an answer, it found many references and merged them into a “new” answer. But since the algorithm doesn’t “understand” anything, it doesn’t realize that literature references must not be modified in any way. I am expecting this to be fixed soon as it is an easy thing to fix. GPT-3 is just a clever amalgamator and regurgitator, and this seems to be just a special case of hallucination.Take-home message for students: Do never trust GPT-3 to give you accurate information. Others have also reported that GPT-3 hallucinates often and quite badly .

Showdown: GE Healthcare's Äkta versus Bio-Rad's NGC

Tue, 07 Feb 2023 00:00:00 +0000

I have been purifying proteins since 1996. I worked on an Äkta Explorer until 2015, when we upgraded to the Äkta Avant . In 2020, my lab moved, and we inherited a Bio-Rad NGC , which we have been using now for 2 years.We encountered many problems with the Bio-Rad NGC. At first, I thought that this might be normal when switching systems. I expected the problems to disappear one by one. After all, we also had problems when we switched from the Explorer to the Avant.However, even after two years and dozens of purification runs, the problems with the NGC don’t seem to stop. Whenever ẃe solve a problem, a new, previously unknown problem appears. And differently to GE Healthcare, Bio-Rad’s customer service is not even close to what we have experienced with GE Healthcare. When our IT could not connect the Äkta to our university’s network, GE Healthcare sent an engineer from their Munich crew to Helsinki to fix the problem. Appreciating the learning curve, GE Healthcare also offered free participation in one of their courses for somebody from our team. And their support was not limited to the warranty period! They really wanted us to be happy with their device. We don’t experience the same amount of support from Bio-Rad. It always feels like we have to coerce them into solving the problems we have with the NGC, and their response time is well below any customer expectations.This is the first of several blog posts about Äkta versus NGC. I hope will find the time to write in more detail about all our issues over the next few months.We decided in 2015 that we finally needed a new FPLC. Our Äkta Explorer was reaching end-of-life, and we had received about 100k funding to renew the FPLC of our core facility . The device was expensive enough that we needed to go through the official tendering process (at the time, the limit was 30,000 €, but it has been increased to 60,000 € by now). There were only two contenders: The Bio-Rad Discover NGC and the GE Healthcare Äkta Avant. The Bio-Rad was cheaper (82,810 € versus 95,470 €), but we decided to purchase the GE Healthcare device. One important reason was that all our users had been using the Äkta Explorer and its Unicorn software. Switching would simply be disruptive and require lots of support and time from our side. However, there were also technical reasons that made us prefer the Äkta over the NGC:Äkta Avant’s advantages

Why are most scientists coffee addicts?

Wed, 04 Jan 2023 00:00:00 +0000

Last week I went electric after perhaps 25 years of making coffee without a coffee maker directly powered by electricity. I have made my coffee with the iconic Italian-style stovetop espresso maker I bought in 1990 in Debrecen, Hungary. Or with the Aeropress . Or, perhaps mostly, with a $2 coffee funnel. My espresso maker is a knockoff, but it still works perfectly today; I just had to replace the seal once. The espresso maker, the Aeropress, and the$ 2 coffee funnel make excellent coffee, and the OBH Nordica has therefore serious competition.The first thing that I learned was that the Swedish/Danish OBH Nordica is not anymore Nordic, but a part of Tefal , which in turn is part of Group SEB . Now that is not in itself a bad thing. But whenever you buy a European brand kitchen appliance, you will mostly buy from the same company independent of the brand name: Krups, Moulinex, Rowenta, Tefal, OBH Nordica, and WMF: they are nowadays all part of the French Groupe SEB.Of course, you should buy European instead of buying from a low-priced Chinese competitor. But I still wanted to know which of these Group SEB products are manufactured “in Europe” versus “for Europe in China”. At least on this machine - the Blooming Coffe Maker - I could not find any “Made in” marking. When I went to obhnordica.com/blooming , I was greeted with a “Read more about the Blooming Coffee Maker - Choose your country” and when I clicked the Finnish flag (since I live in Helsinki), I end up in . So I decided to contact OBH Nordica via their web form to ask where exactly my coffee machine was assembled, and they very promptly answered that the device is made in China. So much for buying European, and I am feeling guilty now.

Mastodon

Fri, 30 Dec 2022 00:00:00 +0000

**You can ignore the following if you read this on Mastodon.**I have not been leaving Twitter yet. If it’s well-engineered, Elon Musk won’t be able to break Twitter, but it can still die a slow death (like Skype has been slowly dying ever since Microsoft bought it). But as a precaution, I have started an account on Mastodon. More specifically, on mastodo.fi . And it has been so far a pleasant experience. Most of the people I follow on Twitter are not on Mastodon (yet), but I am working on that! The science community has embraced Twitter ever since , and I get a big chunk of my science news via Twitter. It will take some effort to replace it.The one thing that might be putting off some users is that you actively have to find content. Nobody and no algorithm pushes content to you. And there is no single place to open an account. You can open an account on hundreds of different Mastodon servers ( https://www.pcmag.com/how-to/how-to-pick-a-mastodon-server ). I briefly contemplated running my own Mastodon server, but then I joined mastodo.fi because it is - like me - located in Finland. I am still learning how stuff works. Seriously: if you are not yet on Mastodon, please consider joining! And after joining, follow me @mjeltsch@mastodo.fi !

Turing test with exam answers: Can I sniff out the AI?

Thu, 29 Dec 2022 00:00:00 +0000

In the Finnish daily newspaper Helsingin Sanomat, GPT-3 and Laura Ketonen from the University of Jyväskylä discuss how AI will affect student assessment ( Tekoäly ravistelee opiskelijoiden arviointia , English: Artificial intelligence shakes up student assessment). One of the obvious “applications” of AI would be exam cheating.Laura’s opinion piece provoked quite a few reactions. Some answered that AI produces hollow text . Others mentioned that AI does not have courage and initiative . It feels like we, as a human species, will soon be struggling with a generalized inferiority complex.In a natural science exam situation at the BSc or MSc level, the initiative is with the teacher, and the students are, by definition, reactive. How do you define hollow text when asking to explain glycoengineering? In life science, courage and initiative are essential features for any aspiring scientist. But without a solid body of knowledge as the foundation, courage and initiative rarely will lead to impactful new developments. At this moment, we cannot yet outsource this foundation to AI. Hence, we require from students a solid body of knowledge from which courage and initiative can draw to flourish. Perhaps, low-hanging fruits can be picked with courage and initiative alone. But solving today’s problems requires, in addition, a solid body of knowledge (“standing on the shoulders of giants”).When judging AI, we likely make the same mistakes as humans do with all new technologies: We overestimate its impact in the short run but underestimate its impact in the long run. Over and again, (narrow) AI has managed to break into fields that were previously reserved for humans. There is no reason to assume that this development will not continue. It may well be that the presently dominant approaches to AI (deep learning, machine learning, neural networks, statistical approaches) will not lead to major future breakthroughs toward human-like general AI, perhaps even self-aware AI. We don’t even know how human consciousness comes about. On the other hand, I agree with Daniel Dennett’s idea that there might be no hard problem of consciousness: Consciousness is what you get when you have solved all the easy problems. In any case, if a non-self-aware AI becomes indistinguishable from a self-aware AI, what’s the difference, and how would we be able to know? I am sure that at one point, we will also be able to outsource our knowledge completely. With Google, we have even started to make baby steps in this direction, but we need a better computer-brain interface to fully embrace the concept of knowledge outsourcing. Deep Blue beat international grandmaster Garry Kasparov in 1997. I did not want to accept this human defeat and declared the game unfair: Deep Blue crashed and needed to be rebooted once during the 6-game tournament, which - in my opinion - was equivalent to the human dying during the game (or at least being reanimated by CPR). In 2016, computers surpassed humans in the game Go, and today, they beat humans even at games like poker, requiring sophisticated psychological trickery like bluffing. To test how AI compares to students in an exam situation, Patrick added one AI-generated answer to the students’ responses in a recently written exam. This idea gave the grading an exciting spin! I think I knew what the AI answer was. However, I had played with GPT-3 before and knew that - untweaked - AI is overly correct and systematic in addressing questions.E.g., in a 3-part question, the AI normally systematically answers all three parts. Also, the AI did not know the exact content of my lectures, which made identifying the AI answer relatively easy. Patrick still needs to reveal whether I identified the AI correctly…The AI (or what I identified as the AI) performed worse than the best student, but overall it did really well. Clearly, our future exam questions need to focus even more on critical thinking and fictional examples, which the AI cannot know from its vast pool of training material.But given the increasing amount of information that AI will access in the future, AI can rely on other people’s critical thinking. The next generation of AI (ChatGPT-4 and Google’s LaMDA) is already waiting for public release… With some tweaking, Patrick could have easily fooled me. Maybe he did already… If he instructed the AI to break the answering pattern intentionally and if he did train GPT-3 with my lecture slides as reference material, all my bets are off.I’ll let you know whether I succeeded in identifying the AI correctly when Patrick reveals which answers were AI-generated. UPDATE: I (as well as the other teachers) did correctly identify the AI answers. The general opinion among us was that if we had not been alerted to the fact that one of the answers was AI-generated, we would not have noticed. The quality of the AI answers depended on the type of question. It appeared that (at this moment) a relatively easy way to throw off the AI is to give information needed to answer the question in a graphical format. But I am sure AI will learn to integrate images with text very soon.

Innoopeli Prize 2022

Wed, 21 Dec 2022 00:00:00 +0000

We - the steering group of the International Master’s Programme in Pharmaceutical Research, Development and Safety - received the Innoopeli Prize 2022 !The Innoopeli Prize is given for a significant contribution to teaching in our Faculty. Although biased, I think the award is well justified since we offer many new courses, update existing courses, and translate courses from Finnish into English. It’s been heavy lifting, but we can already see some results in the form of really smart and engaged students, which we managed to recruit!From our programme director Leena Hanski: “In January 2021, we started the work as a steering group, with no learning objectives, curriculum, admission criteria, or even website, not to mention a single decision on practical arrangements for running the programme. We still have plenty of work in front of us, but I am convinced we can keep up the pace and make this programme a great place to polish the future stars of pharmaceutical research, development and safety. Our first set of students has been a great source of inspiration and motivation for many of us, and I also want to specifically thank them for their openness and willingness to share their stories, thoughts and expectations.”

Bioactive VEGF-C from E. coli without in-vitro folding!

Fri, 28 Oct 2022 00:00:00 +0000

Our article Bioactive VEGF-C from E. coli has been published in Scientific Reports. Read here: https://doi.org/10.1038/s41598-022-22960-0.As a matter of fact, I did the first experiments expressing VEGF-C in E. coli in 1999, but never got active protein. In the following 15+ years, we exclusively used eukaryotic cells (yeast, S2/Sf9/Hi5 insect cells, CHO) to produce VEGF-C. We reactivated the “VEGF-C in E. coli” project a few years back and we finally reached our goal last year. However, it was much more work than we originally anticipated. In the beginning, all attempts went South, and to rescue the project, we developed an in-vitro folding protocol. It was perhaps more luck than ability that we stumbled upon a combination of solubility tag and redox-modified E. coli strain that can pull off the trick to produce directly bioactive VEGF-C without the need for an in-vitro folding step. We decided to include also our unsuccessful attempts (CyDisCo and periplasmic expression) in the results section to avoid the file drawer effect.

Making the cut: Why VEGF-C != VEGF-C

Wed, 28 Sep 2022 00:00:00 +0000

Yesterday, I talked about VEGF-C in the Zoom Lymphatic Seminar series, which is organized by Young Kwon Hong . Since there was not much time to ask questions, I am happy to answer them via email. If you have missed the link to the presentation slides, here it is: https://mjlab.fi/c . The take-home message: Many different mature forms of VEGF-C can be generated from pro-VEGF-C by proteolytic processing (and the same is true for VEGF-D). These forms behave VERY differently from each other. The extreme case is activation by Cathepsin D (CTSD): When activated by CTSD, VEGF-C becomes almost exclusively lymphangiogenic, while after activation by the same protease, VEGF-D becomes exclusively angiogenic. The detection of CTSD-activated VEGF-C is difficult because all well-functioning antibodies recognize epitopes N-terminal to the cleavage site (or they straddle the cleavage site). The second talk was by Barbara Garmy-Susini , and her topic was a nice fit since she talked about using VEGF-C in the therapy of lymphedema. But as we know already from VEGF-A, vascular growth factors alone might be not sufficient to generate a functional vasculature…

The evolution of PDGF/VEGF growth factors

Thu, 22 Sep 2022 00:00:00 +0000

We have uploaded a preprint of our most recent manuscript about the evolution of PDGF/VEGF growth factors to bioRxiv. We comprehensively analyzed the PDGF/VEGF part of the proteome in all animal species for which data is available. We have had some of this data already for a while, but now we enhance it with a detailed look at fishes. The vascular biology of fishes has become even more facinating after the publication of Das et al. earlier this year ( read more about this exceptional piece of work ).The remarkable heterogeneity of vascular systems in fishes seems to be supported by a similar extensive heterogeneity at the molecular level. Often, but not always can this genetic heterogeneity be traced back to whole genome duplications. Fishes tolerate full genome duplications better than mammals. At least there have been quite a few such duplications in various branches of the fish phylogenetic tree resulting in polyploid or even tetraploid species. That has resulted in some fish species featuring 4 times as many PDGF/VEGF genes compared to humans, and much more opportunities to diversify the functions of these molecules.The very first PDGF/VEGF-like molecule appeared likely more than 800 Million years ago during the Precambrian period when marine organisms started to show signs of tissue organization. If we set out to reconstruct this molecule, it would look remarkably similar to a modern VEGF-C. Specifically the C-terminal “silk homology domain” seems to have been invented early on in evolution. In fact, a large number of extant morphologically simple organisms feature such VEGF-C-like molecules still today (e.g. the nematode C. elegans). Beyond these insights into the evolution of PDGFs and VEGFs, there are some useful take-home messages for vascular biologists: For example, we did not find any functional VEGF-B genes in birds. Similarly, there seem to be no PlGFs in amphibians. Then, on the other hand, the VEGF-Fs - identified from snake venoms - appear to exist more broadly also in non-venomous lizards. This poses some limitations on some animal models (Xenopus, CAM assay), but it would be nice to know what VEGF-F is doing in geckos…Have a look at the manuscript and please comment or criticize, if you have any thoughts! The idea is to make this manuscript still a bit better before submitting it to a journal for the traditional peer-review.

Doing research without deep knowledge

Mon, 12 Sep 2022 00:00:00 +0000

Dear Professor Jeltsch,My name is Shahid, and I am studying Medicine. I am interested in molecular biology and biochemistry. Sadly, my curriculum does not include many modern molecular biology research techniques. Still, I want to learn about this area to the extent that makes me comfortable putting forward a hypothesis and a possible treatment for a disease. My goal would be to test this hypothesis with the help of a research team of molecular biologists and other experts. Therefore, I don’t need deep knowledge. With this letter, I am asking a professional researcher like you to point me to resources that would allow me to acquire the necessary expertise for such an endeavor. What would be suitable books or materials to study? I should also mention that I have access to all the significant scientific publishers via our university library.Thanks for our assistance,ShahidI received the above request via email a few months back. I always encourage students to go beyond what the curriculum offers. That is not to say that a good “run-of-the-mill” education does not enable you to be part of a productive team. But without going beyond the curriculum, it isn’t easy these days to have any lasting impact on anything. So far, so good. The red flag in the above email is this sentence: “Therefore, I don’t need deep knowledge.“When treating most diseases, low-hanging fruits have been picked. There are two approaches when trying to reach the high-hanging fruits:

The 12-month embargo falls

Wed, 07 Sep 2022 00:00:00 +0000

Under Barack Obama, the 12-months-rule was instituted, which demands that any research that is using US-federal funding must become freely accessible to the public at the latest 12 months after its publication ( https://www.science.org/content/article/white-house-unveils-long-awaited-public-access-policy ). A new executive order by Joe Biden is now getting rid of the 12-month-rule requiring immediate availability starting at the latest on December 2025. Other notable improvements of this executive order concern the requirement for machine readability, metadata annotation, and raw data availability. Furthermore, these new rules do not only affect journal articles but include from now on also book chapters and conference proceedings ( https://www.theverge.com/2022/8/26/23322194/white-house-ostp-open-access-federal-research-policy-update ).Many for-profit publishers object because their license to print money is slowly eroding. What they do not mention is, that the highest-skill work done in the whole publishing business - namely article writing and peer review - is still done entirely for free by academics around the world. If publishers would need to pay market prices for authors’ and reviewers’ working time, they would - without exception - all go bankrupt within a year. Every academic spends a significant amount of working time on writing and reviewing other academics’ manuscripts WITHOUT ANY REIMBURSEMENT. In fact, many of us do this job in the evenings and on weekends, because we are fully booked with grant application writing, administration and teaching during our regular working time. Many of these manuscripts are then published by for-profit publishers, which go on to monetize the results of research write-ups and the peer review process, which has been paid by taxpayers’ money.Some for-profit publishers do a valuable and fantastic job to improve the accessibility and quality of their authors’ works. Others seem to be in it mostly for the money. Among the latter are unfortunately also many Open Access journals . The elephant in the room is SciHub. Even though my university pays for access to most journals I need, the access is so obfuscated and temporarily dysfunctional, that I frequently have to resort to Sci-Hub in order to get a PDF article from a journal, to which my university subscribes. Alternatively I have used ResearchGate and #icanhazpdf to get electronic reprints, but SciHub is by far the fastest and most reliable option. More about Sci-Hub: https://www.zmescience.com/other/feature-post/sci-hub-effects-academic-publishing/ .

"Bioactive VEGF-C from E. coli cytoplasm" preprint online

Fri, 01 Jul 2022 00:00:00 +0000

The preprint of our manuscript is online. We show how to produce bioactive mature VEGF-C in the cytoplasm of E. coli bacteria without the need for a folding step. It took us quite a while to get there, and we tried many things that did not work before we found a way how to do it. We describe also the methods that failed. It looks as if VEGF-C has simply too many cysteine residues that all have to pair up in the correct configuration. In the same manuscript, we also report a workable refolding method. Please have a look and give us some feedback: https://www.researchsquare.com/article/rs-1776636/v1 .

The eLabFTW electronic lab journal: ready for prime time?

Fri, 03 Jun 2022 00:00:00 +0000

Some love it and some hate it: the electronic lab journal (ELN). Already a decade ago, the prediction was that in 10 years the paper lab notebook would be a thing of the past. In reality, the majority of academic labs are still using paper in 2022. The transition has not been helped by literally hundreds of commercial offerings that are all mutually incompatible. We started to experiment with ELNs in 2013, testing a few commercial and open source solutions. The worst of the pack did not even allow us to test drive them before buying (e.g. LabVantage seems to think you won’t buy once you have tried it, and they are spot-on!). We settled on eLabFTW , an open-source project with the main development happening at the Institute Curie in Paris, France. It’s a web application built with PHP and MySQL. There is also a peer-reviewed publication describing it: https://doi.org/10.21105/joss.00146 and a general Nature Protocols review article, that discusses ELN implementation: https://doi.org/10.1038/s41596-021-00645-8 .Deployment for teaching at University of HelsinkiWith the recent update to version 4.3 , the final hurdle for large scale deployment has been taken. Everybody with a helsinki.fi account can now log into the system with university account credentials. This makes the onboarding of many new users much easier. I am planning to use the system for our new course “Recombinant DNA technology and genetic engineering”. At the moment, the server is only reachable from inside the university network. If you want to use it from home, you need to use a VPN. Over the years we have been accruing about 25 users, and it will be interesting to see how the system performs when the user numbers will double or quadruple. The system runs in a docker container on an Ubuntu 20.04 LTS virtual server, which we, unfortunately, cannot upgrade or extend without additional financial support. So if you are interested to use an ELN, secure your spot today by logging into https://elab.ltdk.helsinki.fi , using the “Login through your institution” option on the bottom. You will have the option to choose a team. The team administrator needs to approve you before you can use the system. If you cannot find your lab among the teams, it means that you are the first user from your lab using this system. In that case, you should choose the team “Helsinki University” and contact me via email ( michael@jeltsch.org ), because I will need to register a new team for your lab, and you will be the administrator of this new team.Access for visitorsIf you do not have a University of Helsinki account, you can still use the system if you are inside the Helsinki University Eduroam network, but you will need to use the “Register now” link, and your account needs to be approved by a system administrator.Running it on your local machineThe system requirements of eLabFTW are fairly low, and your laptop is likely to have no problems running a local copy of the docker container. While installing eLabFTW on a recent Windows or macOS computer is possible, it is somehow counter-productive as it does not provide network accessiblity and team functionality. Even if you don’t need any of that, I would suggest that you repurpose an old desktop computer for this task and run it on a regular Linux server installation. I am happy to answer all possible questions that you might have (from a system administrator’s and end-user’s perspective).

Lymphatics as the origin of the fish secondary vascular system

Thu, 26 May 2022 00:00:00 +0000

In zebrafish, the blood vessels of the anal fin develop from lymphatics by transdifferentiation. Karina Yaniv presented unorthodox, but very compelling data supporting this conclusion last September at the Kloster Seeon Angiogenesis meeting .Now her paper has been published in Nature .

PhD thesis defense about hepsin's role in breast cancer

Sun, 24 Apr 2022 00:00:00 +0000

Last Saturday, Denis Belitškin defended his Ph.D. thesis. The topic was The role of type II serine protease hepsin in breast cancer signaling . I thoroughly enjoyed the discussion with the opponent Karin List , which happened over Zoom with only a small real-life audience. Proteases have slowly become one of my favorite protein classes. In the old days, they mostly were appreciated for their degradation function, but it is meanwhile clear that they are much more complex. My own interest is their role in the activation of signaling molecules. In this context, proteases are signaling molecules, playing at the same level as hormones, cytokines, and growth factors. Thanks, Denis for a convincing performance and the karonkka!

Best poster award for Khushbu (annual GeneCellNano flagship meeting)

Fri, 22 Apr 2022 00:00:00 +0000

Last week, with a delay of 2.5 years, the GeneCellNano flagship partners finally met for the first time in real life. This meeting was overdue, and there were many very interesting talks among others from the Finnish Red Cross (about cancer immunotherapy) and UPM Biomedicals (about their biocompatible cellulose products). Lots of new ideas and some concrete plans for further collaboration. We participated with two posters, and - a bit unexpectedly since the project is still in its infancy - Khushbu Rauniyar from our lab won the best poster prize. Congratulations!

Northern lights everywhere

Sun, 13 Feb 2022 00:00:00 +0000

Northern lights seem to be normal these days in Helsinki, Finland. The frequency and visibility of the Northern lights are directly correlated with the 11-year solar cycle. It has been known for many hundreds of year that the number of sunspots waxes and wanes in a cyclic fashion with an average time of about 11 years.Even though we are far from the maximum of the solar cycle (which is predicted to be sometime between 2023 and 2026), the number of observable Northern lights in Helsinki seems to be increasing. Maybe the Solar Cycle 25 Prediction Panel was not entirely correct in predicting that cycle 25 would be similar to cycle 24. So far, the number of sunspots is well above the predictions . Cycle 24 was by the way the weakest cycle since cycle 14 (which peaked in 1906).An unpleasant and dangerous side effect of a strong solar activity is a coronal mass ejection (CMEs). A CME happens when the sun spits out large amounts of sun plasma (hundreds to thousands of billion tons). Such ejections happen during the peak of the solar cycle a couple of times per day, but during the solar minimum once every couple of days. Because these CMEs are directional, most of them more or less miss our earth. The magnitude of coronal mass ejections (CME) and thus the intensity and visibility of the Northern lights at lower latitudes is not dependent on the solar cycle, but the frequency of such events is.A big CME can become problematic because it can interfere with our electric grid. A couple of smaller grid outages have already occurred over recent years (e.g. in Denmark and in Canada) as a consequence of smaller CMEs. It is assumed that a big enough CME might be able to take down the electric grid of most of the planet. During the period 2010-2020 (encompassing much of the weak solar cycle 24) the probability of a large CME had been estimated by scientists to be around 12% ( https://agupubs.onlinelibrary.wiley.com/doi/full/10.1029/2011SW000734 ). The last big CME happened in 1859, and it is known as the Carrington event after the astronomer who first detected it. During the Carrington Event, the “Northern lights” could be seen as far south as Colombia (8° North of the equator; https://arxiv.org/abs/1508.06365).Our problem is not that all electronic devices will stop working when a Carrington-size solar storm hits the earth. Rather a few important but difficult to replace pieces of infrastructure will be knocked out. This might initiate the falling of dominoes eventually reaching every aspect of our life. If the CME is big enough, Covid-19 will appear to have been a walk in the park. Even small solar storms can sometimes cause trouble: The same solar storm that caused the Northern lights seen in the image (from Thursday 10th of February) knocked out 40 of the 49 most recently launched SpaceX satellites for good.

Why would anybody get vaccinated?

Sat, 22 Jan 2022 00:00:00 +0000

As you can clearly see from these statistics, the smallpox vaccination did not work: It did not end the frequent epidemics that swept through Sweden (and all other countries for that matter). The epidemics continued for more than 100 years despite the vaccination!* The vaccination was introduced more than 200 years ago in England. The figures are from Sweden because they were one of the few countries that early on kept relatively good statistics. In typical smallpox epidemics, 10-20% of the infected people died. In populations that had not been selected for resistance by frequent epidemic waves, the death rates could rise up to 70%. So why would anybody get vaccinated? With the last smallpox-infected human dying or recovering, the virus would go extinct, and humankind managed to eradicate smallpox this fashion. We got close to the same goal with polio but did not reach it (yet). Despite the differences between polio, smallpox, and SARS-CoV2, the graph seem to indicate that we are in for the long haul.*Note added for those living in an alternative reality: These sentences contain irony!

Finally boostered

Fri, 14 Jan 2022 00:00:00 +0000

Hooray, I am finally boostered! I did not mind what I would get, but ended up for the 3rd time getting the BioNTech/Pfizer mRNA vaccine.UPDATE (23.01.2022):I received some feedback concerning this 2-sentence blog post. I never really think much about the vaccination anymore. To me, the situation appears very clear from a science-based medical perspective. Below, I will keep adding answers to some questions and statements.

Opening old plasmid map files

Sat, 01 Jan 2022 00:00:00 +0000

For a new cloning project, we needed to access the plasmid maps of an old construct of mine (pSecTagN2, which was a precursor of pMosaic , aka pSecTagI) which I had composed from many different sources in 1999. In 1999, I was working in Kari Alitalo’s laboratory as a Ph.D. student. We were at the “cutting edge” of technology because we used a software program called Gene Construction Kit (GCK) to keep track of our clonings. Last Wednesday, I spent 4 hours of my working time opening one file created with GCK version 2.5 in 1999.

Meet the teacher!

Fri, 31 Dec 2021 00:00:00 +0000

Almost 30 years after starting my academic career, I started to teach at the Faculty of Pharmacy (without much pedagogic experience and education). Mostly, I teach stuff that I have real-life research experience and expertise with: Recombinant DNA technology, genetic engineering, protein production and purification, and - most notably - protein drugs. Following the University of Helsinki motto Researchers teach, teachers research . Despite my lack of experience, I was part of the Helsinki University “Meet the teacher!” feature, which is aiming at the prospective International Master’s students: https://www.facebook.com/HelsinkiUniversity/posts/10160122296028083

KLK3: tumorigenic or not?

Wed, 22 Dec 2021 00:00:00 +0000

We have just published our latest review about the role of KLK3 as an activator of VEGF-C and VEGF-D in prostate cancer . Prostate cancer is one of the most common cancers in males. It is not a question of whether you will get it but only when. Once you reach your 80s, the likelihood of you having prostate cancer is bigger than not having it. In a 2013 autopsy study of Japanese males , who died of other causes, 59% of those older than 80 had prostate cancer. It is likely that many of these cases were indolent and would never have caused any problems. Only a few of them might have become symptomatic had these men lived longer. So, there is a significant interest in distinguishing those cancers that are going to cause problems. Many prognostic markers have been proposed to do exactly that: to predict which cancers would become problematic.From the vascular biology point of view, angiogenesis and lymphangiogenesis are two hallmarks of cancers that have been previously proposed to have prognostic value. When we stumbled upon the fact that prostate-specific antigen (PSA, also known as KLK3) is able to activate VEGF-C and VEGF-D , we thought that this might have significance for prostate cancer. Meanwhile, further research has clarified some questions, and it really seems to be that both VEGF-C and VEGF-D are involved in cancer progression. it is not clear yet which proteases are responsible for the activation of VEGF-C and VEGF-D in real human cancers. KLK3- or Cathepsin D (CTSD)-activated VEGF-D might be a possible cause of the resistance of tumors to bevacizumab (Avastin) treatment. The consequences of VEGF-C activation, on the other hand, are more difficult to predict because activated VEGF-C does simultaneously both good and bad: On the one hand, it facilitates metastasis. On the other hand, it enables an enhanced immune response against the tumour. Interesting research lies ahead. Read more in our review: https://doi.org/10.3390/ijms222413545

3. Swiss Lymphsymposium

Fri, 17 Sep 2021 00:00:00 +0000

The English translation of the German talk (slides and abstract) is available from here: https://doi.org/10.5281/zenodo.6034307 . The 3. Swiss Lymphsymposium took place on September 4th in Zürich. It is sponsored by Juzo , a producer of garments for complex physical decongestive therapy (CPDT), which is the main therapeutic option for lymphedema therapy. CDT cannot heal but it keeps the symptoms under control. I really liked the talk by Prof. Erich Brenner, since it nicely addressed the issue of blind-ended “lymphatic capillaries”, which, with some exceptions, do probably rarely exist in the steady-state adult human anatomy. I had discussed this previously with others such as Johannes Grünzig ( https://doi.org/10.1016/j.aanat.2018.08.004 ), who specifically looked at the shape of the initial lymphatics in the eye. I was asking Erich where the concept of blind-ended capillaries originates from and it seems to have its origins in early drawings from German physiologists. As a matter of fact, I myself have been perpetuating the blind-ended initial lymphatics in my schematic drawings, e.g. here , without paying much attention to the issue. As a defense, I can argue that the low magnification shows only the larger collectors and the high magnification suffers from the narrow depth of field. In fact, the depth of field can indeed give sometimes the impression of blind endings, while in reality, the vessel might simply make a turn. However, I have also seen convincing images with blind-ended initial lymphatics. From a functional perspective, which geometry would be the better choice? I guess nature is good at optimizing structures…Of course many of us molecular scientists have seen real blind-ended lymphatics. Obviously, during development and other situations of lymphatic expansion (wound healing, VEGF-C application), such lymphatic blind-ended sprouts do exist. We often also look at lymphatics in places where such finger-like structures do de-facto persist throughout adulthood (i.e. in the villi of the digestive tract). However, here the constant high supply of VEGF-C is likely involved in maintaining these unusual structures ( https://doi.org/10.15252/emmm.201505731 ).In my talk, I was addressing the current status of therapeutic lymphangiogenesis. Using VEGF-C, we can induce the growth of new lymphatic structures, but the current gene therapy (Lymfactin) is only able to deliver a short burst of VEGF-C because the delivery vector (an adenovirus) is rapidly inactivated by the immune system. Hence, the clinical studies were well chosen: to jump-start the integration of lymph node transplants into the local lymphatic network. But given this relatively narrow indication, the business decision by Herantis Pharma to focus on its neurodegenerative pipeline and to discontinue the Lymfactin development is even understandable. IMHO, we would need molecular nudging in order to make an impact in most human lymphedema conditions, which are - for the most part - chronic. A low-level, distributed stimulation of lymphatic collector contraction would need to be combined with a higher capacity network. VEGF-C could do the trick, but at this moment, we do not have any technology that could reliably deliver such a molecular nudge for a long time, although there are many ideas on how one could pull this off.The Ketoprofen/Bestatin trials have shown, that there is a big difference between acute and chronic lymphedema. The mouse lymphedema, which was treated surprisingly effectively with ketoprofen, is very different from human chronic lymphedema. One thing we certainly need is better animal models for chronic lymphedema. Interestingly, chronic lymphedema is a common problem in horses.This seems to be an old hat for those familiar with horses, but for me this was new: The same conservative standard treatment is used for horse and human lymphedema: complex physical decongestion therapy. I was just surprised that there are enough equine patients in order for some researchers and practitioners to specialize in the lymphedema treatment for horses: https://www.equicrown.de or https://horsephysio.at/uber-uns.htmlFrom a scientific point of view, this type of edema is likely much more similar to human lymphedema than all the mouse models that we have: it’s a big animal with high hydrostatic pressure in the legs and it’s a chronic condition. I am wondering what are the molecular causes for horse lymphedema, and whether this problem was caused by domestication/breeding, i.e. whether wild horses/zebras have also lymphedema? I would love to talk to somebody who knows something about this!Thanks to Sonja Eham & Dr. Michael Oberlin for the additional info concerning horse lymphedema, and Sonja Eham & Dace Zanker for an impeccable organization. I guess I should immediately start to clone horse VEGF-C…

How attractive is Finland for international students?

Sun, 29 Aug 2021 00:00:00 +0000

One apology upfront: All the links in this post are to Finnish sites, demonstrating one of the problems that foreign students face in Finland: a language that doesn’t resemble any other European language (apart from Estonian and Hungarian, which also belong to Finno-Ugric language family ).Foreign students are generally having a good time in Finland. Although not everything is perfect, the University of Helsinki (and Finland in general) is worth considering when you want to study abroad. This is the bottom line from a feedback survey among more than 800 international students from the years 2020 and 2021. Especially the high quality of the teaching was appreciated. Other points in which Helsinki University excelled were the safe environment and the handling of the Covid-19 pandemic.However, the latter has also a downside, as more encounters and discussions with the academic staff were on the wish list of the students as well as more social support. This is hardly surprising given that international students cannot fall back on the same networks as the locals when they arrive in the country. The worst single issue appeared to be the reception of the students. Arriving and dealing with an unknown and incomprehensible bureaucracy is often too much for newcomers. Discrimination was only experienced by 4% of the respondents and among them, language discrimination and loneliness were the most common.I always warn students who tell me that they plan to apply to the University of Helsinki. You want an honest opinion on whether to start your studies in Finland? Ok: It can get pretty cold and it will get REALLY dark in the winter. However, Helsinki is still one of the more livable places when it comes to the cold and dark season. It rarely gets below 0°F (-17.8°C), and being on the South coast it’s also one of the least dark places. And global warming is doing its best to increase the temperatures. Finland is already the insider’s bet for long-term real estate investments: still cheap enough, but with extreme growth potential once climate change converts Southern Europe into a smelting furnace. However, these scenarios will fully realize only the current political decision-makers have already kicked the bucket. But if you are in for the long haul, Finland might be THE place to be. But again, if the gulf stream collapses, you’ll be thrown back to square one. Thank your parents for the mess they have left you ( https://www.theguardian.com/environment/2021/aug/05/climate-crisis-scientists-spot-warning-signs-of-gulf-stream-collapse ).Unfortunately, as good as Finland might be for studying, staying in Finland for good is a different story. Even though Finland needs to boost immigration to make up for its declining and aging population, there are still unfortunately too many hurdles to overcome before settling down becomes a realistic option for most foreigners. The language is only one of them, others being mentioned in a recent article in the largest Finnish daily newspaper (Helsingin Sanomat) are the difficulty to become integrated into the Finnish society, the for foreigners incomprehensible bureaucracy, and the low salary levels. But also growing resentments towards foreigners within the Finnish population, manifested in the success of the “Finns Party” (formerly known as “True Finns”), are not helping. Most other European countries also fight with right-wing political currents. In my home country Germany, the AfD (roughly equivalent to the Finns Party) is not considered by any of the democratic parties as a possible coalition partner (wishful thinking on my part?). But here in Finland, the Finns Party has been already in a coalition government, and only the social democrats and the leftist coalition have a clear “no” position in this matter.Just recently, the newly elected major of Helsinki Juhana Vartiainen commented on the attractivity of the Finnish labor market for foreigners:“A miserable failure on Finland’s part. The political consciousness has been very slow to even grasp that we need labor immigration at all.” ( Helsingin Sanomat, 28.08.2021 ).But all that aside, academic teaching is at a very high level. And it is free for EU/EFTA residents (and holders of qualifying degrees from those countries). For paying students, the tuition fees are a bargain compared to many other universities that play in the same league (between 13000 and 18000 Euros per year, depending on the study program). However, the university staff will have to pay a high price to maintain this quality. For the current decade (2020-2030), the ministry of education has the goal to increase the number of completed university degrees by 100000 ( https://www.acatiimi.fi/4_2021/15.php ). At the same time, the university budget has been cut. The government will probably compensate for the cuts in a media-attraction gathering “rescue the university” move to distract from the fact, that we need dozens of millions on top of this to provide the same high level of teaching for those 100000 additional degrees over the coming years. At the research level, academic staff has been fighting an uphill battle since 2005, when the inflation-adjusted budget for R&D decreased for the first time. But meanwhile, students start to feel the lack of sufficient funding e.g. when their teachers simply do not have anymore the same amount of time for them as they used to.I have no other choice than to advise students against an academic career in general. Most other European countries have similar problems, but perhaps not at the same level as Finland. And the students know that academic funding is especially bad in Finland .

Searching for a lymphedema drug

Wed, 11 Aug 2021 00:00:00 +0000

More than 20 years ago, I cloned the VEGF-C cDNA into an adenovirus shuttle vector. Even though we had the vectors for the AdEasy system from Bert Vogelstein’s lab to make adenoviruses in-house, we preferred to team up with gene therapy expert Seppo Ylä-Herttuala to make the first adenovirus with VEGF-C cargo (AdVEGF-C). This and other VEGF-C-expressing adenoviruses have been used by Seppo and us in several preclinical studies to show that VEGF-C can be successfully used to treat the underlying cause of certain types of lymphedema.In 2018, Herantis Pharma started Phase 1 clinical trials with AdVEGF-C, which was branded under the name Lymfactin. After Eiger Biopharmaceuticals ’ Phase-2-trials with bestatin failed to show any effect on lymphedema, Lymfactin was the only drug in clinical trials that was aimed at lymphedema. This spring, Herantis announced that it is discontinuing the clinical trials with Lymfactin in order to focus on their neurodegenerative ( CDNF ) drug pipeline. On top of this bummer came the news that the assignment of patients for the phase-2 trial had been non-random and that the Phase-2 results are therefore inconclusive . This is bad news for lymphedema patients just when gene therapy, on the whole, is making a comeback after an almost two-decade-long hiatus.What is the way forward? Even though the small molecule drug bestatin was shown to increase VEGFR-3 expression and activation , it was never a pro-lymphangiogenic therapy. The mouse experiments had shown clearly that it merely supports the endogenous lymphatic repair that is naturally kicking in after acute lymphatic damage. It specifically counteracts too high leukotriene B4 levels, which inhibit lymphangiogenesis, but it does not carry any own lymphangiogenic signal.The strategy to inhibit an inhibitor was also used in mouse studies that were published today in Science Signaling by Kataru et al.: Kataru et al. Kataru et al. used genetic modification of lymphatic endothelial cells to block PTEN, an intracellular inhibitor of VEGFR-3 signalling. The results are convincing: Lymphangiogenesis without any of the drawbacks that are inevitably associated with growth factor therapy, such as having too high growth factor concentrations at the site of delivery, which can lead to vessel leakiness and other unwanted responses. Small molecule PTEN inhibitors do exist, but they are pretty toxic. If a reasonably non-toxic PTEN-inhibitory compound could be found, all that is left is to specifically target it to lymphatic endothelial cells. However, neither finding nor targeting are easy tasks, although there are enough ideas that could be followed if funding was available. Read more about this topic in our opinion piece about searching for a lymphedema drug in Science Signaling: doi-link , e-print link for those who have no access to the full text.

50 cucumbers and counting

Sat, 03 Jul 2021 00:00:00 +0000

Pandemic + staycation = balcony gardening. While our tomatoes are all still green, the cucumber harvest has started about 2 weeks ago. So far, we have harvested 50 cucumbers, 25 of them today. There is at least the same amount still hanging on the plants. Last year, the cucumbers got infested early in the season with spider mites and we harvested only very few. The only thing I did differently from last year is that I included fertilizer with every watering. I tried two different biological fertilizers, but they did not fly for two reasons: the nettle-based (fermented) fertilizer was so stinky that we could not use the balcony for three days after I had applied it. The second fertilizer I tried was worm tea, a byproduct of our worm farm . It is essentially odor-neutral, but our worm farm is too small to produce enough fertilizer for the cucumbers and tomatoes, which both have high nutrient demands. So I used essentially only the Biolan liquid fertilizer and I am happy with it. It contains apart from the usual NPK (nitrogen, phosphorus, potassium) also a lot of microminerals.

Where to move to from RefWorks?

Thu, 10 Jun 2021 00:00:00 +0000

I never understood why our university pays for proprietary reference management software. Perhaps some old people in the administration still live in the 90s of the last millennium when EndNote was de-facto the only decent reference management software for WYSYWIG text processors. But those times are long gone. Finally, our university is at least dumping one of its proprietary reference managers:

TuKoKe success for our TET interns!

Wed, 09 Jun 2021 00:00:00 +0000

Here in Finland, 8- or 9-graders make a one- or two-week “Introduction to working life” internship at a workplace of their choice ( TET, työelämään tutustumisjakso ). The Covid-19 pandemic has also screwed this one thoroughly up, but our lab did manage to host a few interns when the Covid-19 numbers were pretty low in the autumn.One group, consisting of Pessi Bask, Rasmus Pouta and Okko Siljander from the Käpylä Primary School did study the suitability of run-of-the-mill plastics used for 3D printing for the culture of mammalian cells . Under the supervison of Niklas Koppatz, they entered with this project the TuKoKe nation-wide science- and technology fair and not only won the third price , but also additionally the Aalto University’s Design Factory Award and a stipend from the Finnish Invention Foundation (Keksintösäätiö) for the inventive nature of their work. Congratulations!

Covid-19 vaccination

Sun, 23 May 2021 00:00:00 +0000

UPDATE (August 6th, 2021) I am now fully vaccinated according to the CDC’s definition !

Master's Programme in Pharmaceutical Research, Development and Safety

Mon, 12 Apr 2021 00:00:00 +0000

The University of Helsinki is expanding its repertoire by offering a new International Master’s Programme in Pharmaceutical Research, Development and Safety . The year 2020 has shown how immensely important pharmaceutical science is for human societies. And this importance will only grow in the future! Besides emerging novel viruses, there are many challenges in front of us. The list below is just a start…* *

Scholarly Community Encyclopedia

Tue, 30 Mar 2021 00:00:00 +0000

We have added an entry for VEGFs to the Scholarly Community Encyclopedia . I do not know more about the project than is available from their About page . The service is backed by the MDPI publisher, the entries are mostly created in association with and based on articles published in MDPI journals. You can create different types of entries: Topic reviews, biographies and “others”, but all entries I have seen are topic reviews derived from articles in MDPI journals.I do not see which niche this encyclopedia is aiming to fill. Even though many entries are based on peer-reviewed articles, there is no peer-review of the entries themselves, and - not surprisingly - the encyclopedia contains quite a few questionable entries. However, unlike e.g. in Wikipedia, there is no established community of crowd-sourced quality control. However, when modifications are done to an entry, the original authors are notified. However, I do not know how editing wars (which have been e.g. quite common for controversial Wikipedia entries) would get resolved in this system. MDPI states that all authors are highly qualified experts, but in reality, everybody can create an account and edit existing entries. MDPI tries to incentivise the creation of entries with discounts on their article processing charges (APCs) via a point system . However, the ephemeral character of the point system does arguably not create sufficient incentive for high profile researchers or for researchers from developed countries that have mostly sufficient financial resources to pay for APCs.MDPI has also an associated service for scientists called “SciProfiles”, which - similar to Mendeley, ResearchGate, ORCID, Publons, Google Scholar, Loop, and many others - hosts researcher profiles. However, unlike most of the other services, SciProfiles is only visible to members, which makes it pretty useless imho.

Martin Jeltsch (1933-2021)

Wed, 03 Mar 2021 00:00:00 +0000

This morning, my father, Martin Jeltsch, died from Covid-19 at age 88. He had the opportunity to get vaccinated already starting from January 25th, but he decided not to. If he had taken the first opportunity to get vaccinated, he would have most likely been already partially protected, when he contracted the disease. However, it is no secret that he opposed vaccinations, and his professional affiliation with complementary and alternative medicine was just one of the many things that have made our relationship very complicated. Herd immunity through vaccination will also protect the unreasonable. Hopefully, we will get there soon.UPDATE: According to our mother, my father did actually plan to get vaccinated. However, vaccine roll-out in his county started in the end of January only and he had not even received the first shot yet. That first shot would have given him already partial immunity and most likely would have prevented a serious disease course.

MDPI peer review reviewed

Wed, 24 Feb 2021 00:00:00 +0000

Finally, our most recent review got published in the journal Biology. For my taste, its title is too long: Proteolytic Cleavages in the VEGF Family: Generating Diversity Among Angiogenic VEGFs, Essential for the Activation of Lymphangiogenic VEGFs . On top of this, the title contains an abbreviation: VEGF.Most publishers are in for the moneyThis is the first time we published with MDPI . Although the criticism of MDPI has not entirely gone away after its 2015 vindication from Beall’s List , the critique is now mostly centered around the accusation that MDPI is after the money and not the quality. That said, most publishers are in it for the money. Especially the stock-market listed publishers are by law forced to be in it for the money: Elsevier, John Wiley & Sons, etc. And many others such as Springer Nature are desperately trying to become also a member of the stock-market listed club. We as scientists could probably use a little bit of this attitude because we are naturally bad at making money (we can generate knowledge, but not revenues).Concerns over review qualityAdditionally, MDPI’s review process has been criticized as being not very rigorous. What was our experience? Our paper was apparently scrutinized by four reviewers and you can read the reviewers’ comments here: https://www.mdpi.com/2079-7737/10/2/167/review_report .**How did we experience the reviewers’ quality of feedback?**Three out of the four reviewers gave real feedback. Reviewer 3 could be - for all what matters - replaced by Grammarly.com or the Microsoft Word spell checker. Reviewer 2 focuses also almost entirely on style and presentation. Don’t get me wrong: Good style and presentation are very important! But, first of all, let’s get the science right! The remaining two reviewers were apparently not extremely familiar with the research topic vascular biology. This agrees with my own experience, that I often get requests from MPDI journals to review papers outside or only tangential to my area of expertise (which I immediately reject since I anyway have too many papers to review).You could argue in favor of MDPI, that our manuscript was already quite good when we first submitted it. But please: we cobbled this together in a hurry during the month of December and I know that there are still quite a few errors (which we realized a few minutes after the paper was published).We wanted to try an Open Review, but failedIt strikes me that we had opted for open review (i.e. only to use reviewers that were agreeing to publish their identity together with their reviews). However, none of our reviewers revealed their identity. There is probably some fine print somewhere that says that the editor can override this choice when no reviewers are found that agree to give up their anonymity. To a certain extent, I can feel the editor’s pain. It is difficult enough to find good peer reviewers in the first place, because - despite many attempts for a change - reviewing manuscripts is not rewarded in the current scientific system. Is it fast? Imho, some of it was too fastThe review process was fast. The revisions were even faster. And the publishing was much too fast. I was terrified when I saw that we might not get a second set of proofs. The first proofs had to be modified extensively because the layout had changed the image placement. As a consequence, almost all the references needed renumbering. Moreover, during the proof generation, some parts of the figure legends got mistaken as body text. Therefore we had to shift large portions of text around during the proofing. And if you ever have used Word, you know that this is nothing to be excited about. At least, MS Word doesn’t crash anymore as it used to do in the old days. Back then, pushing the Crtl-S key combo after every minute of editing was outsourced from the brain to the spinal cord. But also this time, Word did not disappoint us by introducing unwanted formatting changes that were impossible to undo.None of us managed to have even a look at the second proofs this Monday before the paper went online, after which the link to the second proofs expired. We have lots of other things to do: prepare lectures, participate in faculty meetings, take care of students, and - last but not least - we occasionally also like to do some research. Fast publishing is not a virtue in itself. But it certainly helps to keep the expenses in check.**After the game is before the game.**And this time it’s not a review, but original research and we will choose another publisher. The experience was definitely not a catastrophe, but I can clearly see that such an over-streamlined process can go wrong once in while with less scrupulous authors. And there are many examples (see the Wikipedia entry ).For those interested, here is the link to the translation of the Norwegian article discussing the MDPI quality issue.**UPDATE (15.01.2022)*After this experience, a scientific analysis of MDPI journals was performed, looking at self-citations, citation cartels, special issues, APC charges, and review- and acceptance times: https://doi.org/10.1093/reseval/rvab020 . I only became aware of this article more than half a year after its publication. The take-home message of it is that MDPI , as well as the publisher OMICS Interntional , engage in editorial behaviours that fall under the umbrella of predatory practices. At the same time, their operation “has reached such a level of sophistication that they totally or partially comply with the formal criteria that serve to differentiate between predatory and legitimate journals”. The authors of this analysis use the term “non-evident/hidden predatory publisher”.At the same time, many legitimate and respected scientists are working on the Editorial Boards of MDPI journals. I personally know quite a few. As always, the truth is not black or white but some shade of grey. Besides, this article was published by the reputable publisher Oxford University Press , which could be interpreted as a conflict of interest. *

Our first OER (Open Educational Resource)

Wed, 03 Feb 2021 00:00:00 +0000

When I started my new position at the Faculty of Pharmacy, it was clear that I would be going to do more formal teaching than before. Even though I have lectured before, I typically was only modifying a conference presentation in which I presented the research work from our laboratory. However, that does not fly for undergraduate students, and hence I am assembling lectures from scratch. Although there is much hype about Open Science, there are few or no open educational resources for the topics that I know to teach: genetic and protein engineering, protein drugs, biologics. Because I think, that there should be more openly available teaching material, I decided to make my lectures openly available. However, I soon realized that it is very difficult to replace copyrighted material with free alternatives such as public domain or Creative Commons -licensed material. 80% of the images and illustrations are easy to replace, the next 15% take you as much time as the first 80%, and for the last few images it seems impossible to find copyright-unencumbered alternatives. In the end, I generated the lion share of material myself. For this specific lecture, I have not found any usable image of Judah Folkman . Needless to say that if money was not an issue, I could just buy one for a few hundred bucks, but it still would not be possible for others to reuse it. As a temporary solution, I drew an image myself. I am not good at drawing, help me out it if you can!Today, I have finally uploaded my first lecture to the Library of Open Educational Resources : https://aoe.fi/#/materiaali/1212 . It was an introductory lecture to Protein Drug Discovery & Development for BSc students of Pharmacy (course PROV-105), which dates back to September 9th, 2020. The Library of Open educational Resources is maintained by the Finnish Ministry of Education. I also made an entry to Merlot collection (which is perhaps the biggest OER catalog): https://www.merlot.org/merlot/viewMaterial.htm?id=773405613.However , I am not entirely satisfied with the situation, since I prepared the lecture using Google Slides. Why Google slides? Sadly, it is the only functioning real-time collaborative presentation software. Due to this, the original version of the lecture slides is not available from aoe.fi. However, there is a link to the Google Slides. I have obviously included the same presentation in PDF and ODF format after converting it and all the editable source files (mostly in SVG format). And if the collaborative online editing of LibreOffice should finally become usable, we will probably switch to using that instead of Google Slides. The live online version is the more useful resource. In addition to the fact that this is the original version of the slide show, it will be also updated regularly (since I will give this lecture repeatedly), while the uploaded PDF/ODF file will become more and more obsolete over time.UPDATEI have meanwhile managed to upload another lecture to https://aoe.fi . All of my future contributions will be available from my collection page .* *

Preprint and Open Review

Mon, 18 Jan 2021 00:00:00 +0000

In February 2020, Henry Kwok from the University of Macau asked me whether I want to contribute to an upcoming special issue in the journal Biology*. He was guest editing this special issue on the topic of Proteases — From Basic Structure to Function to Drug Design as Targeted Therapy. The topic is exactly what we are researching at the moment: whether we can target the lymphangiogenic growth factor VEGF-C via its activating proteases. So I tentatively agreed to contribute a review on the activation of VEGFs. We decided for the first time to simultaneously make the manuscript available as a preprint AND to ask for open review. Open review means that the reviewers’ comments and our rebuttal will be published together with the article if the article is accepted.

Low-budget PCR-based mutagenesis kit

Thu, 26 Nov 2020 00:00:00 +0000

If you need to modify your DNA construct, one frequently used method is the PCR-based mutagenesis, where you incorporate the mutation into the middle of two complementary primers. Alternatively, you can use a primer tag for longer insertions. Then you simply amplify the whole construct by PCR.This works reasonable well for constructs smaller than ~10kb. There are several commercial kits available for this purpose that differ in the details. Among them are the QuickChange kit from Agilent and the Q5 SDM kit from NEB and the Phusion Site-Directed Mutagenesis kit from ThermoFisher. The QuikChange kit is the most expensive (also because you always buy it together with competent cells) and the NEB kit is rather on the budget side (168€ for me here in Finland). Most of the kits are sized for 10 reactions. But what do you do if you want to do only one or two mutagenesis reaction. Do you buy the whole kit? I faced this question two weeks back. I went to our enzyme freezer and realized that we have T4 DNA ligase, Polynucleotide kinase (PNK) and Phusion polymerase. That is all what you need to make your own site-directed mutagenesis kit!

Editing Zoom recordings of teaching sessions with FFmpeg

Wed, 25 Nov 2020 00:00:00 +0000

Based on student feedback, we have been organizing a new course for the TRANSMED MSc program about drug discovery and development. It is what you call in German a “Schupperkurs”. I never have found a satisfactory translation of this word in English. It means that we just want to raise the students’ interest in this course. If they like it, they can take any of the many in-depth courses that are offered e.g. at the Faculty of Pharmacy , where there will be more teaching in English in the coming years due to the planned International MSc program in Pharmacy.

GeneCellNano Flagship

Wed, 18 Nov 2020 00:00:00 +0000

The GeneCellNano program was selected as an Academy of Finland Flagship. The idea behind the flagship is to make progress in the treatment of important diseases using advanced biologic technologies. Target diseases include ischemic heart disease, selected cancers, and retinopathy. The application was spearheaded by Seppo Ylä-Herttuala from the University of Eastern Finland and Seppo Vainio from the University of Oulu. In addition to groups from these two universities, the consortium features also groups from Aalto University (Olli Ikkala) and the University of Helsinki (groups Marjo Yliperttula, Timo Laaksonen, Hélder A. Santos, Tatu Lajunen, and my own).Link to the Academy of Finland press release: https://www.aka.fi/en/about-us/whats-new/press-releases/20202/academy-of-finland-selects-four-new-finnish-flagships/

Exponential growth

Wed, 11 Nov 2020 00:00:00 +0000

Talking to people that are genuinely concerned about the survival of mankind, I frequently have heard the sentiment “It’s politically not correct to say so, but the Covid-19 pandemic is the best thing that ever happened to the green agenda”. If SARS-CoV-2 had turned out to be as infectious as measles and as deadly as Ebola, it would have been an inhumane solution to the problem of global warming.I predict that in the near future, a militant environmental activist with an excellent synthetic biology education will develop such a virus to rescue planet Earth. If this person does a good job, (s)he will replace Hitler as the incarnation of evil for all generations to come. SARS-CoV-2 was an accident, but perhaps already the next pandemic will truly be man-made, intentionally by a mad man. With PCR, Gibson Assembly, and CRISPR/Cas, all the tools are available to everybody on this planet.Exponential growth is understood by everybody, who has not been living under a stone for the last 9 months. Strangely enough, the only exponential functions that seem to be of interest at the moment are those of viral spread.Everybody with basic mathematical understanding knows that the description “% growth per year” denotes an exponential function. And every scientist knows that any exponential growth in the real world must level off at some point because everything is a limited resource. Therefore any economic model that requires constant economic growth to keep the system going is doomed in the long run. The question is not WHETHER, but only WHEN the collapse will happen and HOW it will happen.Exponential growth in nature levels off in different ways: It can gradually slow down approximating linear growth before coming to a standstill. But it can also almost instantaneously stop and fall back to the baseline. The first is true e.g. when bacteria grow in a test tube. The latter is true e.g. for the growth of cancer cells in an organism.Read more: http://www.igbp.net/globalchange/greatacceleration.4.1b8ae20512db692f2a680001630.html

Assembly of an OCAA collection Entry vector (pENTR221)

Fri, 30 Oct 2020 00:00:00 +0000

This article is for people, who do molecular cloning. More specifically for people who need to deal with Gateway vectors. Let’s assume you received a Gateway clone from somebody. You know the insert sequence and you know the backbone. One of the most common backbones is pENTR221. Let take as an example insert the human CTSL1 cDNA, more specifically the clone id 100010639 from the OCAA clone collection. You know the insert sequence from its Accession Number (BC012612).You want the full DNA sequence of this vector in order to be able to use smart cloning software like SnapGene to help you with your cloning design. But this software requires you to have the full sequence of the construct (or at least the full sequence of its important parts). So how do you figure out the full sequence of the pENTR221-CTSL1 clone?The insert sequence you can get from NCBI : Just type in the Accession number that you got for your clone. Download the sequence in Fasta or Genbank format.Very interestingly, the otherwise smart SnapGene software does not know the pENTR221 vector. So you need to google the vector backbone “pENTR221 DNA sequence”. You get many hits and here are just four of them:1. http://dnasu.org/DNASU/GetVectorDetail.do?vectorid=2792 . https://plasmid.med.harvard.edu/PLASMID/GetVectorDetail.do?vectorid=279 3. https://www.genomics-online.com/vector-backbone/48/pentr221/4 . http://yrgene.com/documents/vector/pentr221.pdfMatthias , the author of the 4th source gives the sequence in a PDF file, which is not advisable. If you copy the DNA sequence from this file, it will be all scrambled up, because PDF does not read the groupings of 10 nucleotides line-by-line. Dear Matthias, do not use a PDF for distributing or documenting DNA sequences! If you MUST do so, please attach a plain text file of the nucleotide sequence to the PDF! Of course, you can extract the DNA sequence with a smart PDF tool like PDF Studio Pro in the correct order. For some strange reason, the sequence of the 3rd URL deviates from the other four being the only one that has the full attachment sites (attL1 and attL2). However, it does not matter which one of the sequences you use for the assembly, because the differences are all in the area that is removed during the assembly process (I don’t know how the pENTR221 vector was prepared for the library cloning of my specific example, but it looks to me that the original vector was opened with a single DraI digest (which creates blunt ends) and then first the linker were added and thereafter the insert.I suggest you use the sequence from the 3rd URL (because it is in Fasta format) and import it into SnapGene and let SnapGene detect common features. Now you still need the linker. How do you know which linker have been used? We get most of our Gateway clones from an in-house replica of the OCAA clone collection and you can download the full list of clones as an Excel spreadsheet from here . The data includes for each clones the linker that have been used (there are 8 different 5’-linker and 16 different 3’-linker). Unfortunately, it seems to be that this Excel sheet contains some errors, because some linker contain a stop codon, but are nevertheless marked “without stop” and vice-versa.For our example clone the following linker have been used:5’-linker:GTACAAAAAAGCAGGCTCCACCATG3’-linker:TAGGACCCAGCTTTCTTGTACAlmost all of the 5’-linker contain the Kozak sequence (CACC) as the last nucleotides before the insert starts and a few contain in addition to the Kozak the ATG itself (like the one above). At the other end of the linker you can easily identify the homologous sequence with the end of the attL1 of the pENTR221 backbone (GTACAAAAAAG).The 3’-linker are more heterogenous but they all contain the CTTTCTTG sequence from the attL2. When they are used to make clones with a stop codon, then they all start with that very stop codon (TAG, TGA or TAA).Now you just need to copy the open reading frame from your insert sequence in between the linker sequences. If your 3’-linker contains the initiation-ATG, you need to skip it. Also do not copy the stop codon, because in the “with stop codon clones” it is always included in the linker and in the “without stop codon clones” you don’t want to have it. For our example this sequence comprises nucleotides 202-1197 of Accession Number BC012612 . That would be:AATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGNow we add the linker (first and last row):GTACAAAAAAGCAGGCTCCACCATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGTAGGACCCAGCTTTCTTGTACNow we have the first problem: There is a stop codon in the 3’-linker (immediately in the beginning of the last row) even though the clone is according to the information that we received “without stop codon”.We have sequenced the clone and determined that the only difference between the with and without stop codon clones is a mutation, that converts the TAG stop codon into a TTG (leucin) codon.So we change one A nucleotide in the sequence above into a T nucleotide:GTACAAAAAAGCAGGCTCCACCATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGTTGGACCCAGCTTTCTTGTACThe last operation is to insert this sequence into the empty pENTR221 sequence that we have opened in SnapGene. Practically you select the 32 nucleotides from 652 to 687 and replace them with the sequence above. Voila! Unfortunately, the fact that the linker are not always correctly indicated gives me a bad feeling. However, according to our own experience the library replicas of the Orfeome contain sufficient errors that it is anyway advisable to sequence the complete insert using T7 or M13 rev primers from the 3’-end and M13 fwd primer from the 5’-end. This way, you will figure out any linker mistakes that have been done in the annotation of the clones.

For Science to Finland

Mon, 26 Oct 2020 00:00:00 +0000

When you think about going abroad to learn or do science, you mostly think of Anglo-American countries. Although still very attractive, the US and England have been losing some of their appeal. Staying in Europe is not anymore a dead-end for your scientific career. Finland is certainly not on the top of the list when looking at potential European destinations. However, especially among students, Finland gained a reputation as an insider’s tip for exchange periods abroad. Among these, German students form the biggest group, followed by French, Spanish, Dutch, and Italian students. Most of these come via the European Union-sponsored Erasmus exchange program. I recently wrote a guest blog on Claudia’s Helsinki about coming to Finland as a scientist. The blog post is in German, but its bottom line can be summarized in one sentence: there are several scientific areas, where Finland does world-class research. And Finnish universities are increasingly offering international study programs (mostly M.Sc. and Ph.D. programs). These study programs have a tuition fee, but if you come from an EU country (or the degree you apply with is from an EU country) you are exempt from the tuition fee. See what M.Sc. and Ph.D. programs are offered at the University of Helsinki: https://www.helsinki.fi/en/admissions/explore-our-international-masters-programmeshttps://www.helsinki.fi/en/research/doctoral-education/doctoral-schools-and-programmes

Medical research in Finland

Sun, 11 Oct 2020 00:00:00 +0000

Want to become a researcher in Finland? Why not? At the University of Helsinki , there are quite a few professors from German-speaking countries. Increasing the proportion of foreign researchers is an explicit goal of all Finnish universities. As far as the quality of academic research is concerned, Finland ranks in the middle of the pack in Europe. Only one of Finland’s 10 universities ranks among the world’s top 100: the University of Helsinki (74th in the 2020 Shanghai Ranking ). In contrast, four German universities make it onto the list, which is otherwise dominated by Anglo-American institutions (Ludwig Maximilian University of Munich, Technical University of Munich, Heidelberg University, and the University of Bonn, ranked 51st, 54th, 57th, and 87th, respectively). It should be noted, however, that these rankings represent an average across all of a university’s research fields.

University Pedagogy (UP2.2, 2019): Assessment of Learning and Giving Feedback

Fri, 02 Oct 2020 00:00:00 +0000

Becoming a qualified teacher in FinlandThe degree requirements for the 60-credit module in University Pedagogy (UP) consist of 25 credits of basic studies and 35 credits of intermediate studies. Although UP focuses on teaching at the university, the completed module qualifies you also for teaching at schools. The Pedagogy Center of the University of Helsinki organizes the courses of the basic study modules (25 ECTS credits) in English. However, if you want to complete the whole module, you will need to take courses which are only offered in Finnish or Swedish. That means you cannot become a qualified (“pätevä”) teacher without knowing Finnish or Swedish. I do not know whether my Finnish is meanwhile good enough to be able to do that. For the time being I stick to the courses taught in English.**University Pedagogy 2.2 (2019)**In the 2019 autumn term, I took the UP2.2 course (without taking UP2.1 first). We had a very nice teacher (Jokke Häsä), but I still don’t understand why he switched from doing Mathematics to teaching Pedagogy. Certainly a gain for pedagogy since he understands the statistics and we had some interesting forth-and-back about the statistics of the Johnston & Miles paper that we were reading. They paper is also attached to this post and the reporting about their statistical methods leaves much room for interpretation. I actually sent an email to the first author, but she had just retired a few months ago. Although I did not get an failure-of-delivery error, she perhaps did not anymore feel the need to respond.Blind flyingFor me, one of the biggest issues was, that I had nothing to compare too when I was preparing my assignments. When I am writing manuscripts for journals, I have thousands of examples which I can study and to which I can compare. So I decided during the course that I would make all my assignments public. Embarrassment included. But maybe some future participants of UP2.2 will have something to compare to. Sort of an exemplar. Not perfect, but passable. I only post my own assignments.**All my assignments available under CC0 (= no strings attached)**All this stuff is shared under the CC0 : Use it as you wish, no need to acknowledge me. The group assignment is the only thing missing here since I would need to get everybody’s green light, which is not going to happen. I should have done this 9 months ago, but I simply forgot. There was just too much other stuff happening.I did ok in the course, but I still don’t know anythingWhat grade did I get? Our group assignment got a 5 (on the scale of 1 to 5, where 5 is the best grade) and my own stuff a 4. Thanks to all the great members of team Carbonara! That averaged out as a 5 for the whole course. For some strange reason, the Moodle course page still shows that I only completed 66% of the course assignments, but WebOodi shows that I received the credits. So much for the wonders of our IT systems…

Michael Jeltsch: Wikimedia, Wikipedia and ResearchGate contributions

Tue, 29 Sep 2020 00:00:00 +0000

By contributing to Wikimedia and Wikipedia , I, as a researcher, can make reliable knowledge more accessible to society and strengthen the connection between science and the public. But why would I contribute to ResearchGate , aka “Facebook for Researchers”? Since its inception, scientists have been speculating about the ulterior motives behind starting the ResearchGate project, especially since it is a venture-capital-backed, for-profit company that has raised tens of millions of dollars from investors such as Bill Gates, Goldman Sachs, Peter Thiel’s Founders Fund, and Benchmark. Investors do not invest that kind of money without expecting a future return. For sure, ResearchGate is a convenient place to share, find and request papers that are not Open Access. That’s how I mostly interact with it.

Protein Drug Discovery & Development

Wed, 09 Sep 2020 00:00:00 +0000

Yesterday, I had my first Zoom lecture about protein drug discovery and development. I hope that the students did get at least something out of it. My goal is to cc-license the complete presentation but there are still a few images that I need to replace. A first attempt is rarely a great performance, and we had our fair share of technical problems. My headset failed for the first time since I bought it at the beginning of the Covid-19 pandemic. And the Zoom polling functionality disappeared before the students had any chance to use it and we did not manage to bring it up again.Here is the link to the live Google Slides: https://mjlab.fi/pddd . These will keep changing (= improving). Below you find the PDF snapshot of the presentation from the actual lecture day. The whole presentation is CC-licensed. So feel free to reuse it. All source files (mostly in Inkscape SVG format) are also available from here: https://mjlab.fi/pddd-files . I have done all the SVG files in Inkscape , but you can also open them in any browser or edit them in Adobe Illustrator. If you want to edit or extract images, the easiest is perhaps to download the presentation in Microsoft PowerPoint, LibreOffice Impress, or PDF format. I still have not figured out how to share the Google Slides presentation without making the original editable for everyone (after all, I need some control over the content of my lectures).Be aware, that at this moment, the presentation still contains eight images on Fair Use or with unknown licensing terms (even though the legal concept of fair use does not really exist outside the USA). All image sources (excluding my own images) are listed in the file README.txt with their respective licenses and source URLs. Some images are so old that I was not anymore able to locate their original URLs. Hence I am not sure about their licensing terms. I will replace these over the next few weeks when I manage to get hold of CC-licensed or public domain equivalents.

Review published in Duodecim: Lymphatics and the eye

Fri, 28 Aug 2020 00:00:00 +0000

English is overwhelmingly the number one language in science. Nevertheless, sometimes there is a need to target audiences different from academic researchers. In Finland, the bi-weekly Duodecim is arguably the medical journal with the biggest reach among domestic medical professionals. Hence, the idea for a Finnish language review was born. Viewed from three different angles (from the laboratories of Sirpa Loukovaara, Kaisa Lehti, and Michael Jeltsch), we are looking at proliferative diabetic retinopathy (PDR), which is an eye complication that develops slowly over decades in diabetic patients and which is still a major cause of blindness. The treatment of PDR is often less successful than it potentially could be. Importantly, we present also advances in PDR research, from which new ideas might emerge of how to improve current treatment regimens.The original Finnish language version of the review just went online: https://www.duodecimlehti.fi/lehti/2020/16/duo15739 . An English translation is available from Zenodo: https://doi.org/10.5281/zenodo.4005517 .

VEGF-C protects blood cell production

Fri, 28 Aug 2020 00:00:00 +0000

Vascular endothelial growth factor-C (VEGF-C) has been originally described as the primary growth factor for the lymphatic system. And not surprisingly, a constitutive inactivation of both VEGF-C gene alleles in mice is lethal.However, over the years, researchers have uncovered additional functions of VEGF-C. In 2016, it was shown that VEGF-C is necessary for the production of red blood cells (erythropoiesis) in the fetal liver. During embryonic development, the production site of red blood cells shifts twice: First from the yolk sac to the liver (in humans between the 3. and 4. month) and then, three months later, from the liver to the bone marrow, where it stays for the rest of the life. Vegfc appeared essential for the mobilization, maturation, and enucleation of primitive erythroblasts. When Vegfc was deleted on embryonic day 7.5 (E7.5), the liver colonization by erythro-myeloid progenitors and the macrophage/erythroid expansion was defective ( https://doi.org/10.1182/blood-2015-12-687970 ).Some, but not all of the effect was due to the VEGF-C that was produced by the hematopoietic cells themselves, which is not surprising since several blood cells are known to produce or contain VEGF-C (e.g. macrophages, platelets). In the 2016 paper, adult hematopoiesis appeared unaffected when VEGF-C was deleted in 8 week old mice. Also when erythropoiesis was upregulated by phenylhydrazine (PHZ)-stimulated anemia or when the bone marrow hematopoiesis was abrogated with fluorouracil (5-FU), no major changes had been seen. However, in the new paper, we show that VEGF-C does play an important role in the bone marrow recovery from radiation damage, and that it also is able to pro-actively protect the bone marrow when administered before the radiation damage occurs. The effect was partly due to bone marrow endothelial cells and LepR+ stromal cells, which, when stimulated with VEGF-C, produced factors favorable for the regeneration of hematopoietic stem cells ( https://doi.org/10.1182/blood.2020005699 ). However, the effect on LepR+ cells was likely indirect as they do not express receptors of VEGF-C. Considering that previous data show expression of VEGFR-2 on hematopoietic stem cells ( https://doi.org/10.1038/nature00821 ), and avian VEGFR-2 and-3 during in developmental endothelial/hematopoietic differentiation ( https://www.pnas.org/content/94/10/5141 and http://dev.biologists.org/content/125/4/743 ), also a direct effect of VEGF-C cannot imho be excluded although it was not analyzed.

Fat can make your arteries clog, but also the drainage of your kitchen sink

Sun, 19 Jul 2020 00:00:00 +0000

Professionally, I am dealing with the drainage system of the human body: the lymphatics . Last week, I needed to deal with the drainage system of our kitchen sink. And lo and behold, similar to the blood vessels of the human body , fat seemed to have also played a role in creating the blockage of our kitchen sink drainage pipe. The flow had become more and more sluggish over the last weeks and it was finally completely stuck. First, I cleaned - as usual - the U-bend, but it was surprisingly clean. Then I thought that the overflow drain might be the culprit. It was indeed completely stuck. It is easy to remove it completely for cleaning: you only need to loosen the screw where it’s attached to the sink, at the other end it’s not even connected to the main drain with a hose clamp, you can just pull it off. The clot that caused the blockage was gross, but cleaning it did not improve the situation at all.Then I opened the pipes at the very bottom where they leave the apartment and cleaned them with a 2 meter long drain cleaning brush, but I could not sense any blockage and that did not help either. However, it was clear that the blockage was downstream because when I poured water into the pipes, it quickly filled up the pipe to the top and only very slowly, the water level was falling. Then I remembered the 130 ton fat clump that was blocking a major sewer in London a few years back ( https://www.theguardian.com/environment/2017/sep/12/total-monster-concrete-fatberg-blocks-london-sewage-system ), and perhaps, a fat clump was as well to blame. To dissolve the fat, I decided to pour quickly lots of hot water (not boiling but the hottest that our hot-water system could provide, which is 54°C) down the drain (perhaps around 100 liters). With this treatment the blockage disappeared instantly and completely.

Human versus bovine methane production

Sun, 19 Jul 2020 00:00:00 +0000

A while ago, a friend of mine argued that, for him, changing to a meat-free diet wouldn’t make a big difference for global warming. When some humans replace animal protein sources with plant protein sources humans, they’d start farting much more thus offsetting the benefits of reduced greenhouse gas emissions by life stock.I had no clue whether there was any merit to that argument, but finally, I made a rough calculation. Even under the most generous settings, this argument falls flat because the numbers for greenhouse gas emissions are vastly different for humans and cows. For the sake of simplicity, I only looked at methane as it is much more important in this context compared to carbon dioxide.It appears that on a fiber-rich diet, humans produce about 10 mg of methane per day ( http://dx.doi.org/10.1136/gut.32.6.665) , while grass-fed cows produce about 250 g ( http://www.fao.org/3/a0701e/a0701e00.htm , https://blogs.agu.org/geospace/2019/01/09/scientists-breathalyze-cows-to-measure-methane-emissions/) . A cow produces 25 thousand times more methane than a human. Even if we assume, that a meat-eater does not produce any methane and that he eats only the equivalent of a single cow in his lifetime the argument falls short by the factor of almost 1000 (cow’s lifetime: 2 years, human’s lifetime: 80 years).However, the assumption that a meat-eater eats only the equivalent of one cow during his lifetime is very generous. In reality, this is highly unlikely as there are only e.g. 5 sirloin steaks in one cow but 85 pounds of ground beef.A cow weighs about 450 kg when slaughtered, out of which barely 200 kg is usable meat. If that is used to fulfill the meat hunger of the average person (80 years of 70 kg meat consumption/year, https://en.wikipedia.org/wiki/List_of_countries_by_meat_consumption ) this translates into 30 cows during the lifetime if all the meat comes from cows. Therefore, the assumption of needing one cow over one lifetime is overly optimistic even for people with minimal meat consumption.Another interesting fact that I did not know was that freely grazing cows produce 3 times the amount of methane compared to cows in meat factories that are fed with maize/corn. So much for “organic meat”.

The evolution of garbage

Wed, 08 Jul 2020 00:00:00 +0000

Disposable coffee cups have taken over beverage cans and bottles in the thoughtless littering competition a long time ago. That is true at least for Finland and those few other EU countries that managed to establish a somewhat sensible return system for cans and bottles. However, used face masks are becoming a strong competitor for coffee cups thanks to COVID-19.

Dr. Sawan K. Jha: Mechanism of VEGF-C Activation […]

Mon, 01 Jun 2020 00:00:00 +0000

My first Ph.D. mentee successfully defended his thesis on the topic Mechanism of VEGF-C Activation and Effect on Lymphatic Growth and Regeneration . Due to the COVID-19 situation, we organized the event remotely and used the Zoom virtual meeting software. The opponent was Prof. Jonathan Sleeman from the University of Heidelberg. Both the defendant and the opponent did a fantastic job, and the discussion brought to light several new directions for future research, which I had not been thinking about before. VEGF-C is a tricky protein and I am sure it still holds some surprises for the diligent researcher. Unfortunately, there was no reception, no dinner, and no karonkka (after-dinner graduation party), but we are planning to have a party later this year when the COVID-19 situation permits!

Future-proofing

Mon, 13 Apr 2020 00:00:00 +0000

Will the Covid-19 outbreak result in more than just temporary changes to the way our societies prepare for the future? Will we future-proof the way we organize our economies, our industry’s supply chains, our public health care, the way we travel, the way we consume? If history is of any guidance, I fear that not much will be learned from this crisis. Likely, our governments will make sure we have enough face masks and a better infrastructure to set up new virus tests for coming viral epidemics. Virologists and epidemiologists have been asking to prepare for a pandemic with less success than we wish now. Since the Spanish flu, it was clear that in a globally connected world viral pandemics are inevitable. The question was never if, but only when the next would happen. We had enough warning shots: SARS, MERS, ebola, and swine flue, just to mention a few.Other experts have been and are still warning to prepare for global crises of other types. Similar to a viral pandemic, the question is not if, but only when the next major asteroid impact or CME ( coronal mass ejection ) will happen. Similar to Covid-19, we got an ample amount of warning shots for both: The Tunguska event , the Chelyabinsk meteorite , the Carrington event , the 2012 solar storm just to name the more known ones. Despite this, we are not prepared for such disasters and I fear that governments don’t see the similarities between the Covid-19 outbreak and a CME. Unfortunately, astronomic events can be orders of mangitude worse than any pandemic.

Lymphatics and the eye

Wed, 12 Feb 2020 00:00:00 +0000

Our shared review about the eye lymphatics has been accepted for publication by Duodecim . In addition to review our current understanding about the eye lymphatics, it focuses on proliferative diabetic retinopathy (PDR). PDR is the advanced stage of diabetic retinopathy, which is one of the slowly developing complications of diabetes and which can result in blindness.It has been known for a long time that damage to the blood vessels in the retina is a central event in the disease development. Antiangiogenic therapy, targeting the major angiogenic growth factor VEGF-A, is a cornerstone of the therapy. However, the recent discovery of lymphatic-type vessels in the disease indicates, that it might be helpful to target also the lymphatic growth factors VEGF-C and VEGF-D. This is my first contribution to an article that is written in Finnish. While I even wrote some of the sentences in Finnish myself, big thanks go to Ani and Timo for weeding out the mistakes. However, my take-home message for similar future endeavors (i.e. writing with a team where key members are not very proficient in the target language) is that one should write everything first in English and then have it translated into the target language. If common languages are concerned, the best tool for the automated translation of scientific articles is DeepL . However, DeepL does not know Finnish, and adding Finnish is certainly not high on the developer’s priority list…

Suojaus UV-valolta

Thu, 12 Dec 2019 00:00:00 +0000

** UV valot luokittellan seuravasti UV-C (100 / 200-280 / 290 nm, lyhytaalto, kova UV)UV-B (290-315 nm, keskiaalto, keskimääräinen UV)UV-A (315-400 nm, pitkäaallon UV, pehmeä UV, “musta valo”)Erityisesti UVC:n suhteen käytetään usein erilaisia aallonpituusrajoja eri UV-tyyppien välisten rajojen määrittelemiseen. Alle 200 nm:n UVC:n aallonpituudet kutsutaan myös “vakuumi-UV (VUV)”. Toiset erottavat UVC-spektrin ja viittaavat aallonpituuksiin välillä 10 - 200 nm “UVC-VUV”. “Extreeminen (äärimmäinen) UV (EUV)” tarkoittaa aallonpituuksia välillä 10-121 nm, ja tämän alueen lyhyessä päässä säteilyä pidetään ionisoivana (niin kuin röntgensäteilyä). En kuitenkaan tiedä mitään selkeää aallonpituusrajaa, jota käytetään ionisoivan ja ei-ionisoivan säteilyn erottelun määrittämiseen. Molekyylibiologia Useimpia molekyylibiologian UV-pöytiå käytetään etidiumbromidilla värjätyn DNA:n kuvantamiseen agaroosigeeleissä. Nämä UV-pöydät käyttävät noin 300-nm aallonpituutta (enimmäkseen 302 nm), mutta joillakin on myös pidempi aallonpituusvaihtoehto. Esim. Alpha Innotech/UVP, Inc/Ultra-Violet Products Ltd./Analytik Jena LM-26E UV-pöytää voidaan käyttää aallonpituudella 302 tai 365 nm). Nyrkkisääntö on, että mitä pidempi aallonpituus, sitä vähemmän se vaurioittaa DNA:ta (samalla myös DNA-interkaloidun etidiumbromidin signaali heikkenee). On myös 254-nm UV-lamppuja, mutta ne eivät sovellu DNA-töihin, koska ne aiheuttavat DNA:ssa mutaatiot jo muutamassa sekunnissa. Tämä ei ole yllättävää, koska DNA:n oma absorptiomaksimi on 260 nm ja se tarkoittaa, että DNA absorboi suurimman säteilymäärän. Siis 302 nm on kompromissi herkkyyden ja DNA-vaurioiden välillä.Työskenteleminen UV-pöydän kanssa ei ole vaaratonta, ja olettaisin, että UV-vaara on suurempi kuin etidiumbromiidivärjäyksen vaara. Jotkut tutkijat irrationaalisesta syystä pelkäävät etidiumbromiidia liikaa (https: //bitesizebio.com/95/ethidium-bromide-a-reality-check/, http://rrresearch.fieldofscience.com/2006/10/heresy-about-ethidium-bromide.html , https://blogs.sciencemag.org/pipeline/archives/2016/04/18/the-myth-of-ethidium-bromide) . Olen nähnyt “auringonpolttaman” yhdessä kollegassani liian pitkältä altistumiselta UV-pöytien UV-valolle. Kasvonaamari suojaa kasvojasi, mutta voit silti polttaa käsiäsi tai dekolteeasi. UV-läpäisevät ja UV-läpinäkymättömät materiaalit Materiaalin (näkyvästä) valon läpinäkyvyydestä ei voida tietää, kuinka tehokkaasti materiaali absorboi UV-valoa. Tavallinen akryylilasi (“Plexiglas”) on läpinäkyvä suuremman aallonpituuden UV-säteilylle (kutsutaan myös UV-A, 315-400 nm) eikä siksi sovellu silmien suojaamiseen ( https://www.gsoptics.com/transmission-curves / ). Akryylilasi voidaan tehdä UV-läpinäkymättömäksi lisäämällä UV-säteilyä absorboivia lisäaineita. UV-suodattavalla akryylilasilla (“museolaadullinen akryyli”) on erilaisia ominaisuuksia. Jos UV-aallonpituus on alle ~ 375 nm, mikä tahansa UV-suodattavaa akryylia käytetään. UF-4-akryylilasi suojaa vähiten: 80% 400 nm: n UV-säteestä johdetaan 2 mm: n levyn läpi. UF-3 suojaa paremmin ja UF-5 absorboi melkein kaiken hyvin näkyvän ultraviolettivalon (> 390 nm). Polykarbonaatti (PC) on ystäväsi Kun tarvitset suojaa UV-säteiltä, polykarbonaatti on kuitenkin ystäväsi. 3 mm paksu polykarbonaatti on käytännöllisesti katsoen täysin läpinäkymätön UV: lle useimmista UV-lähteistä, joita käytetään molekyylibiologiassa 400 nm asti. Siksi UV-suojaavat kasvonaamarit ja aurinkolasit valmistetaan pääasiassa polykarbonaatista.2 mm, joka on hiukan paksumpi kuin polykarbonaattisten aurinkolasien tyypillinen paksuus, on enimmäkseen riittävä, mutta vähemmän tehokas absorptio paksumpiin polykarbonaattiaineisiin verrattuna vain UV: n ollessa yli ~ 385 nm (siis hyvät aurinkolasit suojaavat silmiäsi molekyylibiologian UV-lampuilta , mutta kasvosi iho altistuu silti). Itse asiassa 2 mm paksuissa polykarbonaattisissa aurinkolaseissa on vähemmän kuin 2 mm polykarbonaattia, koska polykarbonaatin molemmilla puolilla on naarmuuntumaton, UV-säteilyä vaimentava pinnoite, koska polykarbonaatti on erittäin pehmeää ja naarmuuntuu helposti. Valitettavasti polykarbonaattimuoveja on vaikea tunnistaa, koska niiden lukumäärä on “7” hartsin tunnistuskoodien (RIC) luettelossa, joka on “Muu” -sekoitettu pussi. Tuottajien tietojen tulkinta **Kun tarkistat lomakkeilla läpinäkyvien materiaalien optiset ominaisuudet, huomaat pian, että niitä on vaikea tulkita. Huomaat pian, että tuottajien verkkosivustojen lähestymistapa on vähemmän tieteellinen, mutta enemmän mainontaa. He puhuvat UV-säteilystä prosenteissa, mutta eivät missään nimessä mainitse materiaalin paksuutta, mikä on yksi tärkeimmistä imeytymisen / läpäisyn näkökohdista ( https://en.wikipedia.org/wiki/Beer%E2%80%93Lambert_law ). Epäilen voimakkaasti, että he käyttävät 2 mm valotieä (paksuus), toinen mahdollisuus on 1 cm (mikä on toinen “vakio” pituus). Jos sinulla on sisäpiiritietoa, ota meihin yhteyttä!

Bullying from the top

Fri, 22 Nov 2019 00:00:00 +0000

Some numbers from the Nature 2019 graduate survey ( https://www.nature.com/articles/d41586-019-03535-y ) are discomforting. Very few of the respondents were from Finland, and therefore the aggregate from Finland has to be taken with a grain of salt. But every single incidence is one incidence too much. What worries me most is a) that bullied PhD students in Finland feel that they cannot speak out about their experiences without repercussions, and b) that bullying from the top might be more prominent in Finland as opposed to bulling from peers (if one includes other academic staff into the “top”). One student reportedly experienced bullying from the programme director (which falls under “other”, which was not separately listed by Nature in the graph). Numbers do not add up to 100% due to rounding and multiple mentionings.

Protection from UV light

Fri, 15 Nov 2019 00:00:00 +0000

First, some definitionsUV-C (100/200-280/290nm, short-wave, hard UV)UV-B (290-315nm, medium-wave, intermediate UV)UV-A (315-400nm, long-wave UV, soft UV, “black light”)Especially for UV-C, different wave-lengths cut-offs are occasionally used to define the borders between the different UV types. Some exclude the wavelengths below 200 nm from UV-C and refer to them with the term “vacuum UV (VUV)”. Others subdevide the UV-C spectrum and refer to the wavelengths between 10 and 200 nm as “UV-C-VUV”). “Extreme UV (EUV)” refers to wave lengths between 10-121 nm and at the short end of this range, radiation is considered to be ionizing (similar to X-rays). However, I do not know of any clear wavelength border that is used to define a separation between ionizing and non-ionizing radiation. Molecular biologyMost UV tables for molecular biology are used to detect ethidium bromid-stained DNA in agarose gels. They use a wavelength around 300nm (mostly 302nm), but some have a longer wavelength option (e.g. the Alpha Innotech LM-26E can be operated at 302 or 365 nm). Rule of thumb is that the longer the wave length the less damage is done to the DNA (but the signal from DNA-intercalated ethedium bromide becomes also weaker). There are 254-nm UV lamps, but these are not suitable for DNA since they will mutate your DNA within seconds. This is not surprising since the absorption maximum of DNA itself is at 260 nm and meaning that the maximum amount of radiation is absorbed by the DNA. Hence the 302 is a compromise between sensitivity and DNA-damage. Working with a UV-table is not without danger and I would assume that there is more danger from UV than from the ethidium bromide stain, which some people (scientists!) for one or the other irrational reason are too much afraid of ( https://bitesizebio.com/95/ethidium-bromide-a-reality-check/ , http://rrresearch.fieldofscience.com/2006/10/heresy-about-ethidium-bromide.html , https://blogs.sciencemag.org/pipeline/archives/2016/04/18/the-myth-of-ethidium-bromide ). I have seen “sunburn” in one of my colleagues from too long exposure to UV light from UV-tables. The face mask protects your face, but you can still burn your arms or your décolletage.UV-transmissive and UV-opaque materialsThere is no way of knowning from the (visible) light transparency of a material how efficiently the material absorps UV light. Regular acrylic glass (“Plexiglas”) is transparent to higher wavelength UV radiation (also called UV-A, 315-400 nm) and is therefore not suitable for protecting the eyes ( https://www.gsoptics.com/transmission-curves/ ). Acrylic glass can be rendered UV-opaque by adding UV-absorbing additives. UV-filtering acrylic glass (“museum grade acrylic”) comes in different qualities. If the UV wave length is below ~375nm, any UV-filtering grade acrylic will do. UF-4 acrylic glass protects the least: 80% of 400nm-UV is passed through a 2mm sheet. UF-3 protects better and UF-5 absorps almost all of the very near-visible light UV (>390nm).Polycarbonate (PC) is your friendHowever, when you need protection from UV, polycarbonate is your friend. 3 mm thick polycarbonate is virtually completely opaque to UV from most UV sources used for molecular biology up to 400 nm. Therefore, UV-protecting face masks and sun glasses are made mostly from polycarbonate.2 mm, which is a bit thicker than the typical thickness of polycarbonate sunglasses, is mostly sufficient but the less efficient absorption compared to thicker polycarbonate matters only for UV above ~385nm (hence, good sun-glasses protect your eyes from molecular biology UV lamps, but your face skin still gets exposed). In fact, 2 mm thick polycarbonate sunglasses have less than 2 mm polycarbonate since they have on both sides of the polycarbonate a non-scratch non-UV-absorbing coating, because polycarbonate is very soft and gets scratched very easily. Unfortunately polycarbonate plastics are difficult to recognize as their number is “7” on the resin identification code (RIC) list, which is the mixed bag of “Other”.Interpreting producers’ dataWhen you check the data sheets for the optical properties of transparent materials, you soon realize that they are difficult to interpret. You soon notice that the approach of producers’ web sites is less scientific, but more advertising. They talk about UV-transmission in %, but do nowhere mention the thickness of the material, which is one of the most important aspects of absorption/transmission ( https://en.wikipedia.org/wiki/Beer%E2%80%93Lambert_law ). I strongly suspect that they use a 2 mm lightpath (thickness), the other possibility being 1 cm (which is the other “standard” length). If you have any insider knowledge, please let me know!

University of Helsinki loses court battle about lawfulness of 2015 mass layoff procedures

Wed, 16 Oct 2019 00:00:00 +0000

In 2015, the University of Helsinki sacked around 370 of its employees (and did not prolong temporary contracts of perhaps as many). Many survived only because their contracts did not end around the time when the “central committee” of the university administration overreacted when they realized how bad the university’s financial situation really had become. About 10 years of conservative financial austerity culminated in the spring 2015-elect government led by Finnish businessman Juha Sipilä, who was jointly responsible for the massive funding cuts that led to the massive layoffs at the end of 2015.Last month, a Finnish district court ruled that the layoffs had not been legal in the sense that the University of Helsinki did not adhere to the Finnish law on several accounts (" Yhteistoimintamenettelylaki ", in English something like “Act on Collaboration in Businesses”). Notably, the court rebuked the university for its information policy and their lack of attempts to negotiate alternatives to the layoffs. This was exactly the feeling of most employees at the time: The central administration had cooked up a “solution” in some backroom meetings without consulting any of the stakeholders, and then it carelessly pushed this solution regardless of the consequences.The compensations that were granted to the plaintiffs were 5000 or 6000€ depending on the length of their employment. One can argue about the pros and cons of the US-American legal view on compensations (which aim at deterrence rather than compensation), but even for a financially challenged University, 64000€ (including 35000€ legal costs and 29000€ compensation to the five plaintiffs) will neither help the plaintiffs very much nor deter any university from repeating such actions. And judging from the response, the university’s central administration does not agree with the view of the district court, that the procedure did not follow the law.The largest Scandinavian daily newspaper Helsingin Sanomat reported about this case: https://www.hs.fi/politiikka/art-2000006245821.html and also many other magazines, e.g. http://www.acatiimi.fi/6_2019/12.php .

Lymphologie 2019

Sat, 12 Oct 2019 00:00:00 +0000

A week ago, I visited Germany to participate in the Lymphologie 2019 conference, which took place in Bad Krozingen near Freiburg.The conference is jointly organized every two years by the DGL ( Deutsche Gesellschaft für Lymphologie ) and the GDL ( Gesellschaft Deutschsprachiger Lymphologen ). The meeting is overall very hands-on and clinically oriented with many workshops and practical advice. Therefore, it’s highly recommended for practitioners who are able to understand German. However, there is also a “basic science” track, and the organizers always manage to recruit some decent scientists for this track (see here: https://www.lymphologie-kongress.de/programm/samstag-03-10-15/) . Notably, the talks are delivered in German, which doesn’t make the recruiting task easier. Lymphologists in Germany continue to play a leading role in the treatment of lymphedema (and recently lipedema) with uniquely specialized experts and facilities ( Földiklinik ), but English has become the language of biomedical research also in Germany. However, there is still a need for dissemination of research results in German language and that’s why I contribute occasionally to the German-language journal “Lymphologie in Forschung und Praxis”.

ISK 2019

Thu, 10 Oct 2019 00:00:00 +0000

The International Symposium on Kallikreins and Kallikrein-related Peptidases (ISK) took place on September 25.-27. in Prague. Being not from the kallikrein-field, I learned a lot. E.g. I was not aware that KLK4 can activate plasminogen (a fact that might explain some of our early, inconsistent results where KLK4 occasionally seemed to weakly activate VEGF-C in cell culture). Not surprisingly, many participants were interested in our findings that KLK3/PSA can activate the growth factors VEGF-C and VEGF-D, both of which are implicated in cancer progression, notably in metastasis. They confirmed that there is not very much research on the effect of KLK3/PSA mutations on human fertility, but I am sure that someone is going to look at that.Even though it is considered more prestigious to deliver a speech than to present a poster, I have to reconsider and perhaps will present next time a poster. What I would prefer most: talking AND presenting and poster. Why do so few conferences offer this possibility? What depth can you delve into if you have only 15 minutes on stage? Has the attention span of conference participants really decreased over the recent decades due to Facebook, Youtube and Instagram? Maybe: https://www.telegraph.co.uk/science/2016/03/12/humans-have-shorter-attention-span-than-goldfish-thanks-to-smart/The atmosphere at the conference was really friendly and cooperative, perhaps also owing to the relatively small number of participants. If we really should extend our excursion into the KLK-field, I have many experts to turn to for help. I also met some researchers from the Charles University of Prague, who are doing lymphatic research and it looks like we can help each other out with our specific experimental possibilities. All in all, a very successful trip. Excluding the Lufthansa flight back home, which arrived so late for transit in Frankfurt that I did not manage to do shopping there on my way back as I had originally planned (many shops in Germany do close at 5 pm).

Finnish abstract of our recent work about PSA (Prostate-specific antigen) in Duodecim

Sun, 25 Aug 2019 00:00:00 +0000

There is a nice Finnish language abstract about our recent finding that PSA (Prostate-specific antigen) activates VEGF-C and VEGF-D in the Finnish medical journal Duodecim: Eturauhassyövän merkkiaine PSA aktivoi syövän leviämiseen osallistuvia veri- ja imusuonikasvutekijöitä ( https://www.duodecimlehti.fi/lehti/2019/15/duo15024 ). Given the dominant position of the English language in medical science (and life science in general). Duodecim is arguably the only relevant, remaining Finnish language medical journal. Duodecim is the publication of the homonymous Association of Finnish Medical Doctors.

Protein Purification Course 2019

Wed, 31 Jul 2019 00:00:00 +0000

We are again hosting the DPBM protein purification course this December in our lab. Secure your place as this practical course is popular and there are only 16 seats. You can bring your own protein and we will individualize the course program based on your needs!More information: http://research.med.helsinki.fi/corefacilities/b3p/teaching.htmlRegistration : https://courses.helsinki.fi/en/dpbm-135/131042336

Ḿanuscript reviewing by annotating PDFs

Fri, 28 Jun 2019 00:00:00 +0000

Manuscripts for scientific peer-review are delivered as PDF files. Thus it appears most natural to comment the PDF file itself instead of submitting the comments as a separate text (file). However, many submission systems do not allow to submit comments in form of an annotated PDF file.In addition, there is no easy-to-use free/Open Source PDF editor for Linux (my platform of choice). Yes, there is PDFEdit ( http://pdfedit.cz/en/index.html) , but it requires substantial learning and its last release dates back to 2012. There are free online PDF editors (e.g. https://www.pdfescape.com/) , but sometimes I need a local tool. Although not Open Source and not free, the tool of my choice has been PDF Studio Pro . It has all the features I need (actually much more than I need), it is truly cross-platform (Windows, Mac, Linux), easy to use and very affordable for what it offers ($129 single permanent license). Unfortunately, Quoppa software - the maker of PDF Studio - does not offer academic discounts.PDF Studio ViewerA while ago, the makers of PDF Studio started to offer a free version called PDF Studio Viewer . This free version has gotten more useful over time. Since last year, it also supports PDF annotation, which is very important for my work, mostly when I am peer-reviewing scientific manuscripts. For many academic users, the PDF Studio Viewer might be fully sufficient.Libre Office and InkscapeOf course Libre Office Draw and Inkscape can edit PDFs, but they are not specialized for annotating. If you need to do extensive annotations, the process becomes soon very painful. In addition, Inkscape editing can be destructive (i.e. when you modify text), but I have used it e.g. to fill out forms.Apart from the lack of dedicated annotation and reviewing tools (“markups” like “replace text”, “crossout text”, “delete text”, “insert text” or callouts), Libre Office Draw is actually a quite capable PDF editor, but fails still sometimes to correctly open very complex PDF documents (I have had problems with background images/patterns). Strangely, the only reviewing tool (comments) are not exported by default. You need to check the “Export comments” box when you export your edited PDF file as PDF (the “Save” operation creates an ODG file, which you probably don’t want).PDFsamIf you do not have the need to annotate, then you might get away with the Open Source tool PDFsam . Unlike PDFEdit, PDFsam is available from the Ubuntu repositories. PDFsam also has two non-free versions ( PDFsam Enhanced and PDFsam Visual ). PDFsam Basic (the Open Source version) is just a simple GUI on top of some command line utilities, whereas the PDF Studio Viewer offers a true visual editing experience. I canot talk about the non-free versions of PDFsam as they are not available as free trials. In fact, all of the operations of PDFsam can be achieved via the command line (see here for my blog post about how to perform common PDF editing tasks using mostly the command line tool pdftk ).Reducing file sizePDFsam Basic and PDF Studio Viewer do not offer any functionality to reduce file size. The LibreOffice Draw PDF export dialog let’s you reduce image resolution and JPEG compression, which you can use to reduce file size. But at the Open Source front, the only capable tools to reduce PDF size seem to be command line tools. I use ghostscript for this task, but the command is not easy to remember:gs -sDEVICE=pdfwrite -dCompatibilityLevel=1.4 -dPDFSETTINGS=/screen -dNOPAUSE -dQUIET -dBATCH -sOutputFile=output.pdf input.pdfWith PDF Studio Pro, you obviously do not need to remember the different keywords for the different output quality option (screen, ebook, printer, prepress) as you just choose from the drop down menu between the available options. If you are looking for an Open Source graphical wrapper for ghostscript, perhaps try workerPdf . Signing documents and adding signaturesPDF Studio Viewer let’s you sign documents if you have a DocuSign subscription . However, I am mostly concerned about being able to prove myself that I created a certain document (“self-signed signature”) and not that others are able to verify my authorship. For this scenario you are out of luck with PDF Studio Viewer. And apparently, PDFSam does not offer any possibility for signing (neither self-signing nor 3rd party signing). However, Libre Office Draw allows documents signing! I have been looking for an affordable solution (not self-signed, but trusted by other PDF readers) to sign PDF documents, but there seems to be no appropriate solution if you need to sign only rarely. The basic plan by DocuSign ($10/month) appears too expensive when signing only one document per month.Take-home messageIf you want to stay with free or Open Source solutions, you probably need to combine several tools in order to cover all typical PDF editing tasks without pain: PDFsam Basic, LibreOffice Draw, PDF Studio Viewer and ghostscript. But if you edit PDFs often (as I do), buying PDF Studio Pro is clearly the way to go.

Re-purposing the growth factor VEGF-C

Sat, 22 Jun 2019 00:00:00 +0000

An eLIFE digest features our recent publication about VEGF-C ( https://elifesciences.org/digests/44478/re-purposing-the-growth-factor-vegf-c ). Even though our research did not deeply delve into the function of VEGF-C during reproduction, the reviewers comments and our answers (under the “Author response” heading) give more insight than the publication itself. We did not include the sperm motility data in the manuscript. Although sometimes stunning in its magnitude, we did not always measure increased sperm motility in response to active VEGF-C. As is common knowledge, sperm as a biological sample is of highly fluctuating consistency and quality. Interestingly, a paper in eLIFE published two years ago gives some additional insight in what we might be dealing with: Sperm competition risk drives rapid ejaculate adjustments mediated by seminal fluid . This paper shows that the swimming speed of sperm is rapidly regulated by males depending on the social situation (presence of a female or a male competitor). Imho, such factors seem to be almost impossible to control when dealing with human samples…However, the title ambiguously also refers to cancer. Based on our data, we speculate that VEGF-C can be repurposed from being lymphangiogenic to being angiogenic, and further, to be metastasis-promoting.

Lymphologische (Grundlagen-)Forschung: wie funktioniert das?

Wed, 29 May 2019 00:00:00 +0000

Vortrag für den 43. Jahreskongress der Deutschen Desellschaft für Lymphologie

PD Dr. Michael Jeltsch Universität Helsinki & Wihuri-Forschungsinstitut Haartmaninkatu 8 FIN-00290 Helsinki, Finnland michael@jeltsch.org

KLK3/PSA and cathepsin D activate VEGF-C and VEGF-D

Sat, 18 May 2019 00:00:00 +0000

Prostate-specific antigen (PSA) is well known - at least among older males - as a prostate cancer marker, but few people know its physiological function: Sperm cells are trapped in fresh ejaculate, which has a jelly-like consistence. In order to release the sperm cells, the ejaculate needs to be liquefied and precisely this liquefaction is the task of PSA.Also surprising for many people is the fact, that scientists still do not know why high PSA levels are associated with prostate cancer. In our latest research published yesterday in eLIFE , we have made a big step ahead in understanding the role of PSA in both reproductive and cancer biology.It appears that PSA (aka as kallikrein-related peptidase 3 - KLK3) and another enzyme called cathepsin D can activate two growth factors which have been implicated in cancer progression: VEGF-C and VEGF-D . These growth factors do likely contribute to tumor angiogenesis and tumor lymphangiogenesis. By inducing angiogenesis - the growth of blood vessels - the tumor ensures its own supply with nutrients and oxygen. Such blood supply is necessary for a tumor to grow beyond the size of a few millimeters. Likewise, tumor lymphangiogenesis happens when the tumor induces the growth of lymphatic vessels and it is tightly linked to the lymphatic spread (metastasis) of the tumor.Both VEGF-C and VEGF-D are produced as inactive precursors (pro-VEGF-C, pro-VEGF-D) and need to be activated in order to induce the growth of blood or lymphatic vessels. With ADAMTS3 , we have identified the enzyme that activates VEGF-C during embryonic development - which also requires vessel growth - in 2014 ( Jeltsch et al. ). However, it remained unclear whether the same enzyme is responsible also for pathological vessel growth. Now it seems likely that patholigical vessel growth uses different enzymes and PSA and cathepsin D have become prime suspects. Our next experiments will test whether we can slow down or halt cancer growth by blocking these enzymes.

1000+ citations

Wed, 15 May 2019 00:00:00 +0000

The first among my publications to brake the 1000 citations-barrier was Gerhardt et al. 2003 . With the “tip cell concept”, it set a paradigm for vascular biology research: Not all endothelial cells are equal and the tip cell is a specialized cell that marks the forefront of the angiogenic sprout. However, my contribution was limited (number 7 out of 11 authors): I produced most of the proteins that were needed for the study. This spring, Jeltsch et al. 1997 crossed the first time the 1000-citation mark. The paper describes a mouse, that overexpresses VEGF-C in the skin. It is the first ever in-vivo demonstration of a lymphangiogenic growth factor. Although not setting any paradigm, it marks the start of the molecular era in lymphatic research . What percentage of papers achieve 1000+ citations? That differs between disciplines, but e.g. according to https://en.wikipedia.org/wiki/Citation_impact on average it is less than 1 in 4000. Compare this to the average paper, which receives 7.8 citations. And even this average is heavily influenced by a few highly-cited papers ( similar to the Impact Factor ). The median number of citations is 4, meaning that about half of all papers have less than 4 citations (see here ).

Apply successfully to the University of Helsinki

Sun, 28 Apr 2019 00:00:00 +0000

What are my chances to be accepted into a Helsinki University Master’s Program?

This differs greatly from year to year and between the different programs. The admission rates for most individual programs have been anywhere between 5% and 40%, with popular programs like Environmental Change and Global Sustainability or Economics at the low end and e.g. Forest Sciences and Theoretical and Computational Methods at the high end.

ChemBio Finland

Thu, 28 Mar 2019 00:00:00 +0000

The biyearly ChemBio Finland event at the Helsinki Fair Center is taking place on this week’s Wednesday and Thursday. I presented our key project at the booth of the Academy of Finland ( http://www.aka.fi/fi/akatemia/media/Ajankohtaiset-uutiset/2019/tervetuloa-suomen-akatemian-osastolle-chembio-messuille/) . Many people showed up to listen to our work on how to move in-vitro antibody generation technologies into the 21st century using synthetic biology and Crispr.

Poor correlation of the Journal Impact Factor with scientific impact

Wed, 13 Mar 2019 00:00:00 +0000

Definition of the Journal Impact FactorThe Journal Impact Factor (JIF or short IF) of Journal X is the number of citations found from all journals & proceedings (in the Web of Science core collection ) published in 2017 to articles in Journal X, divided by the number of articles that were published in the two previous years (2016 and 2016). For the JIF, only journals and proceedings count (not books) and within journals only original articles and reviews (editorials, letters and meeting abstracts do not count).As one can easily see, there are several factors in this description that lend themselves to interpretation and manipulation by humans. First, any writing in a scientific journal needs to be classified (e.g. whether it is an article or a letter) and that classification is made by humans. Furthermore, the selection of what is included in the Web of Science core collection is not a fixed constant, but the list is updated dynamically by humans.Web of Science versus ScopusSo what about journals that are not in the WoS core collection? I have published e.g. an article in a German-language journal ( Lymphologie in Forschung und Praxis ). This Journal is not included in any WoS collection. Despite initial reservations, this review article has meanwhile gathered 8 citations, which is a remarkable success given that the median citation count of a scientific publication is four ( source ; see also this blog post ). How can I report the JIF when some grant application requires me to list it?Luckily, there is still competition to the Impact Factor, namely the Cite Score . That number was invented by the World’s largest scientific publisher Elsevier . Elsevier keeps also count of citations in the Scopus database. Scopus is less choosy when it comes to journal selection and most journals that are not listed in the WoS core collection are listed by Scopus.**ResearchGate Journal Impact?**So what do you do if your journal is not listed by either of the two big scientometric providers? There is still one other metric that you can use, namely ResearchGate . The RG Journal Impact is not well documented (at least I could not find much) but presumably uses a similar method. However, it is difficult to trust a metric if you do not know how it is calculated. I have published exactly one article that is not counted by WoS or Scopus. However, this is due to fact that the journal ( Frontiers in Biotechnology and Bioengineering ) is young. Its publisher has announced that it will receive an impact factor still this year and that the Impact Factor will be quite nice. For the time being, I am using the RG Journal Impact ( 3.02 ).Large discrepancies in the journal evaluationEven though the way the cite score is calculated is very similar to the JIF, the resulting numbers can be surprisingly different. At the bottom of this text is a comparison of the JIF, Cite Score and RG Journal Impact for three different journals from the year 2015, in which I have published. One notable difference is that the JIF takes into consideration the 2 previous years, whereas the Cite Score considers the previous 3 years. However, that does not explain the majority of the differences. The Cite Score is also less choosy when it comes to the content type: it counts - unlike the JIF - also editorials and letters (as a rule of thumb it counts everything).A weak correlationThe Impact factor is misused. It was developed to evaluate journals (for librarians to decide whether to subscribe to a journal or not) and has then subsequently been used to evaluate individual articles and even individual researchers. The correlation between the Impact Factor and the actual scientific impact (e.g. measured in terms of citations) has been steadily declining over the last decades (see e.g. this research: https://arxiv.org/abs/1205.4328) . From my personal experience, I can confirm that this is true as the correlation between the JIF and the actual number of citation among my own publications is around 0.32. This is pretty bad if your goal is to use the JIF as a proxy to predict scientific impact in terms of future citations.UPDATEThe 2018 Impact Factor for Frontiers in Biotechnology and Bioengineering is 5.122 ( https://www.frontiersin.org/journals/bioengineering-and-biotechnology# ). Congratulations!

The battle between the big publishers and the scientific community

Mon, 04 Mar 2019 00:00:00 +0000

I participated in last week’s Townhall discussion Mikä on avoimen tiedon hinta? (“What’s the price to access knowledge?”), which was precipitated by the recent discontinuation of Finnish universities’ access to journals published by the Tyler & Francis group. Mikael Laakso introduced the audience to the open access issue and the problems of rising prices, and Arja Tuuliniemi reported about the ongoing negotiations with Tyler & Francis and the Wiley group. While publishers like to portrait themselves as the researcher’s friend and ally, fact is that most of the scientific publishing industry is owned by big multinational stock market-listed corporations, which primarily answer to their share holders and researchers needs play a secondary role in the best case. While one would think that electronic publishing is driving down the prices of publishing and accessing published material, the reality shows exactly the opposite.In the current situation, where many Finnish universities are struggling with shrinking budgets, these millions of Euros could be spend better and the FinElib consortium is constantly trying to negotiate fair deals with publishing giants like Elsevier, Springer, Tyler & Francis, Wiley and SAGE . If the negotiations do not yield results before the old agreements expire, Finnish universities are sometimes cut of from access to some journals. This has happened now again (after a similar crisis in 2016). At the beginning of February this year journals published by the Taylor & Francis group have been inaccessible for Finnish researchers. Plans S (i.e. the initiative of the European Research Council to mandate open access for all state-funded research by 2020) is certainly strengthening the negotiation position of the FinElib consortium, because all European customers are essentially lining up their requests according to the Plan S requirements. However, it is still unclear how Plan S will affect smaller, not-for-profit publishers like scientific societies ( https://scholarlykitchen.sspnet.org/2018/12/06/why-society-and-not-for-profit-journals-are-worth-preserving-better-economic-and-continuing-value-for-the-community ). My personal opinion is that there is no reason to panic. A similar shutdown of Elsevier access happened at the beginning of this year (2019) at all Max-Planck-Institutes and and seems to be tolerated by scientists quite well. Even though I might not be able to instantly access all content, this situation should be rather viewed as an opportunity. You can still access all the content that you need (perhaps with extremely rare exceptions).

Increased resilience

Tue, 27 Nov 2018 00:00:00 +0000

I strongly believe that companies are genuinely interested in getting critical feedback. At the very least, it should be part of their corporate survival instinct. When dissatisfied customers simply switch to an alternative vendor without giving feedback, the damage is already done. That’s why I always give feedback if a product does not meet my high-quality expectations.However, this time I am writing about a product I have been very satisfied with, namely the new GE Healthcare Superdex 75 Increase 10/300 GL . It is a gel filtration column and an iteration of the previous Superdex 75 10/300 GL , which we have been using for the last 30 years. The biggest advantage of the “Increase” is the higher pressure-resistance. A few weeks back an overworked grad student forgot to close the column after use and returned it to the fridge, where the 20% ethanol slowly evaporated over the following 2 weeks. The fridge is ventilated and when I needed the column, the damage was already done: There was a perhaps 8 mm gap and a dry zone of approximately once inch had been developing. I immediately filled up the dead volumes with degassed 20% ethanol and started a very slow run (0.05 ml/min) for several hours, after which is switched to degassed water and then to buffer. After letting it run for about 2 days the gap was reduced to about 3 millimeters. The remaining gap was removed by adjusting with the top adapter (I needed to screw it down as much as possible).Now I needed to test the “repaired” column. I did both a functional test (separating two proteins in PBS) and the acetone test (injecting 100 µl 2% acetone in water). I was massively surprised when the aceton test showed about 19000 theoretical plates (which is more than we ever got with our old Superdex 75 columns). And the separation of the two proteins (RNaseA and BSA) showed that the column is still fully functional. However, we cannot tolerate any gel compression, since the ability of the adapter to correct for it is maxed out (GE Healthcare used to produce a longer adapter, which would allow us to compensate even further, but they chose to discontinue this product).Both the grad student and myself were relieved after getting these results because buying a new column would have set us back by 2200€ and since we have no dedicated funding to operate our core facility , I would have been forced to offload this expense to the grad student’s laboratory. Unfortunately, I did not take a picture of the damaged column as my instinctive reaction was to immediately start the rescue. However, the column in the picture below is the damaged column after the rescue operation was complete.

Thus we learn our lessons, not for life, but for the lecture-room

Tue, 27 Nov 2018 00:00:00 +0000

Non vitae sed scholae discimus (“Thus we learn our lessons, not for life, but for the lecture-room”). 2000 years ago Seneca wrote this to one of his students. My son is of the same opinion: Much of his curriculum content is irrelevant for real life. Unfortunately, I have to agree (and many experts do agree as well). Within a few years, the initial pride and joy of starting school are followed by boredom and disinterest. Just a few weeks into the autumn semester, the kids are merely waiting for the Christmas vacation. Learning should be fun and I wonder what is going wrong? How does the school manage to kill off the natural curiosity and motivation that quickly?In the beginning, I argued with my son, that it is not very important WHAT you learn, but that you learn how to learn, which should be possible with almost any topic. However, while perhaps true, this notion is at the same time a confession of failure by the ppeople, who make and implement the curricula at our schools. Why does it seem so difficult to choose topics that are interesting and relevant?100 years ago, reading, writing and basic arithmetics might have been enough. Knowledge is exploding these days, but the only answer of curriculum planners is the cram more into the plans without getting rid of teaching obsolete factual knowledge. That leaves little freedom for the teaching of methodological competencies which are deeply needed in today’s society.I get it, that schools have limited financial and personnel possibilities. However, there are teachers, who - against all material limits (in one of the richest countries in the world!) - manage to deliver a modern and enjoyable customer (sic!) experience.As an answer to the future needs of our society, some people try to push the STEM subjects (science, technology, engineering and mathematics). However, especially in these subjects, the knowledge and information growth is so fast that curricula (which are by definition rather inert) and also most teachers are not able to keep pace with. Even though the knowledge might be relevant, the more important lessons that should be taught are not of factual knowledge, but of methodological knowledge. And methodological knowledge can be taught with highly interesting and relevant topics:

Internationalization in everyday operations at Meilahti campus

Mon, 22 Oct 2018 00:00:00 +0000

Meet the rectors at MeilahtiLast Thursday (18.10.2018), the new rector of Helsinki University Jari Niemelä and the four vice-rectors (Sari Lindblom, Paula Eerola, Hanna Snellman, Tom Böhling) visited the Meilahti campus for an open question and answer event. Hardly any foreigners were present during the event. Consequently, the language of communication was Finnish. Obviously, foreigners won’t participate if they do not understand and speak the language of the event. And since foreigner’s don’t participate, there is no reason to change the language of the event, and so the circle continues… Traditionally Finnish and Swedish onlyThe Meilahti campus holds a special position when it comes to language use since until very recently, it was impossible to receive a degree from Meilahti without knowing Finnish or Swedish since the only degree programs were not offered in English. However, the situation has been changing (e.g. with the move of the Psychology Department to Meilahti and the establishment of new degree programs like TRANSMED ), but old habits die hard. Trailblazers RPU and HiLIFEThe trailblazers for internationalization at the Meilahti campus are the Research Programs Unit and HiLIFE. The postgraduate students and postdocs of the Research Programs Unit (RPU) and the HiLIFE recruitments are the two most internationalized parts of the Meilahti campus and consequently, Hannu Sariola (previous vice dean for research at Meilahti) and Tomi Mäkelä (the HiLIFE director) brought up the topic of internationalization pointing out that the rules of the university allow for more language flexibility than is actually implemented. To date, the only official languages at the University of Helsinki are Finnish and Swedish, although more English-speaking than Swedish-speaking students are enrolled. English is also the de-facto language of almost all scientific endeavors. Balancing the domestic languages with English likely has no perfect solution. If the university wants to optimize its international impact and success, the role of Finnish and Swedish inevitable has to decline unless massively more resources become available.**Separate events?**In order to engage the foreign staff as well, the dean of the faculty recently organized the faculty staff meeting twice: once in English and once in Finnish. I am not sure whether such separation is a long-term good idea, but it addresses the issue pragmatically and gets the job done. If someone suggested separating the faculty X-mas party according to language, that would be considered discriminatory, but for a working meeting, nobody seems to object…**PS:**I am not the only one who is aware that internationalization has a long way to go. There is a nice article on the Helsinki University intranet portraying the new vice rector Hanna Snellman and her take on the issue: https://flamma.helsinki.fi/en/HY377022 . However, the university keeps most of its interesting web content behind locked doors (inside their Flamma service), inaccessible to the general public, who is paying the university’s bills… What does the university fear? More transparency?

SnapGene and partial restriction digests revisited

Thu, 23 Aug 2018 00:00:00 +0000

Snapgene is a software for the wet lab molecular biologist, who does lots of cloning work (construct design and annotation). Since I last wrote about the SnapGene software ( https://www.snapgene.com/ ), many good things have happened:

International Vascular Biology Meeting 2018 organizational feedback

Wed, 20 Jun 2018 00:00:00 +0000

As member of the local organizing committee for the IVBM 2018 , I was asking conference participants for direct feedback. I received lots of praise, which I do not want to iterate here. If we are ever going to organize a large international conference again, here are the things that we should do differently next time. Maybe this list can also help other first-time organizers of large, international conferences. If this list gives you the impression that the conference was badly organized, you would be mistaken! All the important stuff worked smoothly and some of the issues below were solved before any of the participants noticed. However, there is always room for improvement of the details! And - as always - some of the issues were out of our control as we had outsourced some of the work, most notably to Confedent International . And some decisions were a compromise between the optimal and what the conference budget could accommodate. I also encourage you to contact me if you want to add something to this list; it could make things better in the future!

Minireview about key molecules in lymphatic development, function, and identification

Fri, 08 Jun 2018 00:00:00 +0000

Erich Brenner asked us more than a year ago whether we could contribute to the special issue about human lymph vessels he was editing for Annals of Anatomy. We agreed that we might be able to contribute a minireview. In the beginning, I was also hesitating, because Annals of Anatomy is not per se an open access journal. However, our university has meanwhile started to cover the article processing charges (APCs) for several publishers (including the biggest scientific publisher on this planet - Elsevier ) to make articles open access . Thus, everybody can not only read the article already now, but also share, copy and redistribute it, remix, transform, and build upon it for any purpose, even for commercial purposes as long as we - the original authors - are credited.The target audience is not the lymphatic research community, but outsiders, who need a first, very brief introduction to the molecules that are most central to the molecular biology of the lymphatic system. The selection is clearly biased by our own research history. Please write us an angry e-mail if we did not include your pet protein! If you convince us that your pet protein is central to lymphatic development or function, we’ll include it in our next review!

IVBM 2018 & 2020 (poster, talk, and virtual poster walk through)

Wed, 06 Jun 2018 00:00:00 +0000

IVBM 2018The International Vascular Biology Conference 2018 in the Finlandia Hall in Helsinki has been a big success so far. We received lots of positive feedback for the organization from the participants. Also my talk (“Everything You Always Wanted to Know About the Proteolytic Processing of VEGF-C”) and my poster received good attention.Below the poster as a PDF download.IVBM 2020The IVBM 2020 in Seoul, South Korea, moved completely online. Unfortunately, some talks are only available for a very short time (one day), and I missed already a few of those. A physical conference has the advantage that it makes sure that you can pay full attention to the event. An online event has to compete with many other issues that are trying to grab your attention.

Jeltsch Lab participates in Helsinki Running Day 2018

Wed, 23 May 2018 00:00:00 +0000

Our lab participated in the Helsinki Running Day with great results! The “Biomedicum Runners” marathon relay team: Sawan Kumar Jha, Timo Lehti, Khushbu Rauniyar, Rustem Kasymov. Individual performances by Zalina Magomedova, Michael Jeltsch (both marathon) and Alish GM (5k). Missing from the picture is Alisha GM.

Cell-based assays (Protein Interaction Biochemistry 2018)

Mon, 14 May 2018 00:00:00 +0000

A lecture about cell-based assays to determine and quantify protein interactions (part of the 2018 course Protein Interaction Biochemistry). Contains also a short introduction to ITC (isothermal calorimetry). CC-licensed.

Strike at the University of Helsinki

Tue, 27 Feb 2018 00:00:00 +0000

A strike warning has been issued for tomorrow (28.2.) for the University of Helsinki. The reason is that the negotiations about between the employers and employees about the wages and working conditions are stuck and the strike is used as a means to speed up the movement of the employer’s negotiation position towards an acceptable compromise. Business as usual? After all, there hasn’t been a strike at the university for a very long time…While almost everybody agrees that Finland’s future is built on knowledge and innovation, the appreciation of the very people that are generating knowledge and innovation seems to have hit an all-time low if appreciation is reflected by working conditions and payment levels.I guess the underlying cause is not so much the concrete offerings of the employer (or the lack thereof), but the disregard and disrespect for academic education, research, and development that has been growing over the years, accelerated by the 2015-elect government, which refuses to invest into the future. Universities should not behave like companies trying to maximize their profit on the cost of their employees and the quality of their product. With some exceptions , everybody with a little bit of self-respect is participating. All major unions, including the students’ and professors’ union, are supporting this action. Apparently, professors will go on strike for the first time in the history of this country ( https://yle.fi/uutiset/osasto/news/finnish_professors_walk_out_in_first-ever_strike/10095355 ).

VEGF-C Review in Frontiers in Bioengineering and Biotechnology

Mon, 12 Feb 2018 00:00:00 +0000

The editors of Frontiers in Bioengineering and Biotechnology, section Tissue Engineering and Regenerative Medicine (Andrea Banfi, Wolfgang Holnthoner, Mikaël M. Martino and Seppo Ylä-Herttuala) asked us to contribute to the research topic Vascularization for Regenerative Medicine. We wrote a small review about VEGF-C, which specifically addresses the molecular biology of VEGF-C in relationship to regenerative medicine, i.e., (re)growing lymphatic vessels in vitro or in vivo.You can get it from the publisher directly https://www.frontiersin.org/articles/10.3389/fbioe.2018.00007/full or from here . **UPDATE (April 1, 2023):**The question of whether Frontiers Media is a predatory publisher did not even cross our minds when we were asked to contribute with a review. I know the guest editors of this Research Topic and can vouch for their scientific integrity. However, the journal has recently ended up on the list of predatory journals ( https://predatoryreports.org/news/f/list-of-all-frontiers-media-predatory-journals ), and the issues are discussed here in detail. Our review has meanwhile gathered:

The mixed bag of the EU organic food label

Tue, 30 Jan 2018 00:00:00 +0000

Many people assume that organic production of food results in healthier food with a higher nutritional value. Hence they buy food produced according to EU rules of “organic farming”. The first set of rules was introduced in 1991 and it was amended a couple of times. If you want to market your food as “organic” within the EU and use the EU organic food logo , you need to adhere to these rules.Often the same people that usually are very critical towards EU legislation take it for granted that the EU did a good job with its organic farming directive. Unfortunately, that is not the case. The main purpose of the legislation was to unify and to enable EU-wide trade of organically grown food and not to make sure that the food was more healthy or of higher quality than non-organic food.The directive also emphasizes the avoidance of “non-organic” chemicals, but for most foods this is only a minor factor contributing to how “healthy” the food is. I shake my head over organic refined flour on the supermarket shelves. If you want to use healthy flour, you should use whole meal flour. Refined flour has much less fibers and therefore is simply not a good choice if your goal is healthy eating. It is practically irrelevant whether the wheat has been grown organically or not if you strip out the fibers. Organic refined flour is only topped by by organic sugar, where everything healthy has been stripped away and its source - organic or not - is 100% irrelevant.The organic label is actually a hodge-podge of very different practices that aim to reach very different goals. Among these are animal welfare, sustainable farming and the avoidance of some practices that are perceived as “non-organic” (e.g. GMO, “non-natural” pesticides*). But if the health value of the final product was one of it aims, than it has utterly failed.I am all in favor of treating animals well, but if I am forced to buy organic milk, I support many practices that I do not want to support. For example the rage against GMO or non-natural pesticides and fertilizers. I have no problems with cows eating GMO plants. It is clear that GMO is one of the key technologies that we need to rescue this planet (the alternative is to reduce the amount of people on this planet). And without pesticides and fertilizers, we cannot feed the planet without cutting down the last remaining rain-forests and converting them into farm land (see e.g. https://ourworldindata.org/yields-and-land-use-in-agriculture) . By buying organic food you support a political compromise and not scientifically sound rules how best to produce high quality food or to save the planet. Did you expect anything else from an EU directive? The EU was founded as “European Economic Community” and economic interests were the primary forces at work. Since I drink probably a liter of milk any given day in form of caffè latte, I should be perhaps interested in using high quality milk. Comparisons of e.g. the fatty acid profiles of organic and conventional milk have been done. Clearly, for the quality of the milk (e.g. levels of polyunsaturated fatty acids, ratio of omega-6:omega-3 fatty acids), the most important factor was not, whether it confirmed to the EU rules for organic food, but rather whether the cows were eating their greens! https://www.google.fi/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0ahUKEwj1qOuJtIDZAhVJwYMKHfH9D2QQFggrMAA&url=http%3A%2F%2Forgprints.org%2F28133%2F1%2FForschung_2011-1.pdf&usg=AOvVaw31A0-ma28xQ0oXlBpxAF6U . Conventional low-input* cow farming was superior to organic high-input** farming and the differences between conventional low-input** farming and organic low-input farming were likely not significant, although I cannot be sure about this, because the significance levels compared only organic low input farming to conventional high-input farming (I requested the original publication, but did not receive any reply yet). Whether these differences translate into measurable health effects for milk consumers is still another question and probably depends on the level of milk consumption.Interestingly, the organic vs. non-organic problem has been well recognized (see e.g. here in the German daily newspaper “Die Zeit” https://www.welt.de/wirtschaft/article147993831/So-wird-Bio-zur-schoenen-Illusion.html) . The need for differentiation has led the Finnish diary producer Juustoportti to market its milk not under the organic EU label, but under the “free-ranging cow” label ( vapaan lehmän maito ). If you want healthy milk and care about animals, but don’t want to support the anti-scientific organic lobby, this could probably be your choice. Sadly, Juustoportti also rides on the anti-GMO bandwagon. Organic (Finnish: “luomu”) milk might also come from free-ranging cows (and even conventional milk occasionally does), but the certification doesn’t necessarily require it.*Sadly, the primary principle in the distinction between allowed and non-allowed pesticides in organic farming is whether they are of “natural” origin. Safety and efficacy are only secondary. It should be obvious to any educated person that being natural does not equate being safe to eat: Botulinum toxin, the death cap mushroom and and the mineral cinnabar do all occur naturally, but they belong to the most poisonous substances known to man. **Low input farming meaning that the cows were kept outside eating grass, while high input farming means cows being mostly inside. Both types of cow farming are compatible with “organic” and “conventional” farming according to the EU directive, which shows already that something is perhaps wrong with the EU directive.

Remote desktop sessions to your Helsinki University work computer

Mon, 15 Jan 2018 00:00:00 +0000

If you have a work laptop, you can take it home to do work. But what if you have a desktop computer and need to access it from home? The technology to make this possible exists for more than 20 years, but if you think that University IT has made this easy for you, you would be wrong. In fact, I don’t know anybody who knows how to do this (let alone how to make the process easy). Even with the setup explained below, some things do not work well (e.g. I never could figure out how to get the file sharing to work with a Mac-to-Mac connection and thus I still use Fugu with a separate tunnelled sftp connection to transfer files). You have several options:

Brain drain from Finland continues

Fri, 22 Dec 2017 00:00:00 +0000

Finland is educating its citizens to a very high level, but is not able to keep this highly educated work force in the country. The net balance of university degree holder migration has been negative throughout the last decade and the trend is worsening, especially at the Bachelor’s and Master’s level. At the highest level, the interpretation is not very straightforward, since this group contains Licentiate* holders, PhDs, postdocs as well as professors. However, the negative trend is also stable, but not accelerating as fast as at the lower education levels. In this group the brain drain occurs selectively to the best countries with just 5 top countries absorbing 66% of the most highly educated migrants (USA, Great Britain, Switzerland, Germany and Sweden), while the lower degree holders are not as selective (52% of MSc and 41% of BSc holders migrate to the same top countries). Unfortunately, this statistic only reports the migration of Finnish citizens. In order to get a complete picture, one would need the same data for the migration of non-Finnish citizens. For this graph, the data from Statistics Finland was used ( http://www.stat.fi/til/muutl/2016/02/muutl_2016_02_2017-12-18_tie_001_fi.html) . All countries were grouped according to better or worse scientific output than Finland in the comparison (Nature Index, Weighted fractionalcount, https://www.natureindex.com/country-outputs/generate/All/global/All/weighted_score) . Countries that performed better thanFinland in 2016 were: USA, China, Germany, United Kingdom, Japan, France, Canada, Switzerland, South Korea, Spain, India, Italy,Australia, Netherlands, Israel, Sweden, Singapore, Russia, Taiwan, Belgium, Austria, Denmark, Brazil, Poland.* Licentiate is a degree specific to Finland and a several other countries, which is somewhere between a MSc and a PhD. In Finland, it has been decreasing in importance over the years since there is no equivalent in many other countries.

Practical Course: Purification and Characterization of Recombinant Proteins (DPBM-135)

Sun, 10 Dec 2017 00:00:00 +0000

Teaching material, results, etc. for the DPBM course “Purification and Characterization of Recombinant Proteins” ( https://courses.helsinki.fi/en/DPBM-135/120171139 ):

20th International Vascular Biology Meeting in Helsinki, Finland

Mon, 27 Nov 2017 00:00:00 +0000

The 20th International Vascular Biology Meeting 2018 (IVBM2018) will take place in Helsinki, Finland on June 3-7. Registration has opened ( https://b3p.it.helsinki.fi/IVBM/ ) and I hope to see you in Helsinki in June! I have been living here in Helsinki for about 20 years, hence feel free to ask me anything! If I cannot answer, I at least know who knows the answer.

Acatiimi article about our lab

Mon, 27 Nov 2017 00:00:00 +0000

However - unlike in the previous story - this time there is a group image, showing who does the real work!

TRANSMED - the most medical research education for your buck

Sat, 25 Nov 2017 00:00:00 +0000

Starting from this autumn term, even Finnish universities, so far the strongholds of free education, have started to demand study fees from students from outside the European Union (EU) and European Economic Area (EEA). Between 13k€ and 18k€ per year, the tuition fees are still modest compared to some other universities. At the moment, compared with other universities, you probably get the best returns for your money at the University of Helsinki .The TRANSMED Master’s Program is perhaps the best example. Given the real costs of a research-oriented medical MSc education in a world class environment, the 15k€ tuition fee per year is a bargain compared to similar programs at other universities. And even better: the chances to be accepted are surprisingly good. Some have proposed to increases the fees, but no concrete plans exist at the moment.So what is keeping foreign students from flocking to Finland? The cold winters cannot be blamed anymore. Thanks to global warming, most of the recent Christmases have been snow-free here in Helsinki. In fact, global warming seems to hit Finland harder than most other countries. Need more reasons to come? Have a look here: http://www.visitfinland.com/article/greatest-things-about-finland/

Lymphologica 2017

Wed, 01 Nov 2017 00:00:00 +0000

On the Lymphologica 2017 (Lymphologie 2017) congress in Bad Soden (Oct. 5-7, Frankfurt, Germany), I presented an introduction to the molecular biology of VEGF-C and how mutations in the genes of the VEGF-C/VEGFR-3 signaling axis can cause or contribute to hereditary lymphedema. The talk was targeted at healthcare practitioners who work in the lymphology field. A mini-review based on this talk was published in Vasomed and was available online , but has meanwhile disappeared. You can download the presentation slides and the English translation of the mini-review via the download link below.

Featured again…

Thu, 26 Oct 2017 00:00:00 +0000

Recently, our research seems to get lots of public interest: https://50tieteentekijaa.fi/tieteentekija/michael-jeltsch/ . And there is more to come… It would be nice if our government would show a similar interest in science and education. And it would be even better if they had a reasonable plan how to secure the future of science and research in Finland. The government spending for some research areas (in other words the investment into Finland’s future) has been shrinking so dramatically, that even the tabloids have picked up the topic: http://www.iltalehti.fi/kotimaa/201710122200451078_u0.shtml

Our key project featured

Wed, 25 Oct 2017 00:00:00 +0000

Our key project was featured in Tietyssti.fi . Katri Pajusola wrote the story and (at least from what I understand from the Finnish text) it seems to be a quite accurate description of what we try to do: http://www.aka.fi/fi/tietysti/luonto-ja-ymparisto/nyt-pinnalla1/tautien-hoitoon-laakitysta-ei-ainoastaan-diagnostiikkaa/

Predatory publishing - where to draw the line?

Wed, 21 Jun 2017 00:00:00 +0000

Zinni It seems that many researchers recently received an invitation to join the editorial board of the new open access journal ContROL (“Continuous Research Online Library”). The sheer number of invitation might be already a bad sign as the choice of the editorial board is a delicate one and mass emailing is arguably not a good method to assemble a high-quality editorial board. I get frequently similar requests, and when the e-mail message doesn’t clearly identify such a request as spam, I used to have a look at Beall’s list to see whether the publisher or journal has associated “red flags”. Some red flags are easy to identify. If you are an expert in the field but have never heard of the scientists who are supposed to do the expert work. One also could look at the publication record of the people to evaluate their previous work. However, nobody has the time to do that and that’s where Beall’s list came in handy.However, Beall’s list has disappeared this January from the internet. It was last updated on January 3rd 2017, but soon after that, all content was taken down. The January 3rd version is - thanks to great work of the guys at the Internet Archive - still available from here , but obviously it is not updated anymore. Nobody knows exactly why Beall took down all the content, but rumors have it, that Beall himself got threatend by parties which have a vested interest in predatory publishers remaining unnamed (read more e.g. here: http://retractionwatch.com/2017/01/17/bealls-list-potential-predatory-publishers-go-dark/).There are lot of “new” publishers out there who want to participate in the lucrative business of scientific publishing. It doesn’t really matter whether they use the open access model or not (when they are open access, they can e.g. earn on hefty “article processing charges”). Getting enough sufficiently qualified reviewers for the peer-reviewing process is hard work for the established journals and thus the peer-reviewing process of many new journals is more often than not less than rigorous.I also do not like it if it’s unclear who is behind a new open access journal. I feel an ethical dissonance if someone advocates open access, but all information about the journals background remains closed. In my opinion, there is at the moment not much need for more (open access) journals. Instead, most serious and reputable open access advocates are rather trying to improve the existing ones. One could conclude, that the relative amount of predatory journals among all newly established journals is steadily increasing and Google Trends support this notion. How can I figure out whether the ContROL journal is legit or not? I have checked out a few of the people from the Advisory Board and they appear to be real scientists with real track records of various quality. However, even reputable scientists occasionally end up on the editorial board of such journals (sometimes with and sometimes without any action on their part). That said, there is no clean demarcation line between predatory and honest publishers. Even some of the “reputable” publishers engage occasionally in some shady and controversial practices. That’s why Beall’s site lists “potential, possible, or probable predatory scholarly open-access journals”.Beall’s list has been criticized, but much of the criticism can easily be dismissed. An especially low-level attack on Beall’s integrity is e.g. the site http://scholarlyoa.net (note the similarity of the URL!), where some unnamed person(s) engage in ad-hominem attacks, logical fallacies and exaggeration in order to discredit Beall’s work. I myself doubt that the people behind this site are true friends of Open Access publishing. Throwing dirt does not do a favor to Open Access publishing. Maybe this site could even be a misguided, under-cover action by proponents of conventional publishing to discredit Open Access. There is valid criticism of Beall’s work , but none of it challenges the concept that somebody needs to monitor Open Access publishing (in the same way people are monitoring and criticizing the big commercial publishers). Maybe I should ask the publisher of ContROL a few questions. Mainly, why they still see the need for a new OA journal. ContROL promises in addition to the journal some kind of associated scientific social media and promotion platform. However, also that territory is already covered (by ResearchGate and Mendeley ). I was perplexed by the hefty “membership fee” that you need to pay in order to use their services ( https://control.zinianz.com/membership ). But unless you publish several articles per year, it seems to me overpriced. Even though they mention that they have waivers from the Article Processing Charges, I could not find any details. Why would they hide this information? Researchers from financially challenged countries need to know the costs upfront! Such lack of transparency is exactly the opposite what open access needs to achieve. The “membership fees” might also prevent the associated services from succeeding. Getting traction with a scientific social media site is difficult (even if your services are free and backed by the most powerful publisher in the world). Likely, the promised benefits won’t become reality.

Uncertainty about CRISPR's future

Sun, 18 Jun 2017 00:00:00 +0000

Some feared, that the patent decisions on the CRISPR technology this spring might lead to a monopolization of the technology . However, according to a last month’s article in Nature Methods, it is not at all clear at this moment, whether CRISPR will hit a home run for the editing of the human genome. If a single editing event is accompanied by hundreds of unwanted and unpredictable genomic changes, it would be difficult to argue in favor of it due to the unpredictability of the side effects. This is just a single study in mice , but caution is warranted. The Nature Methods article is especially interesting, since the technology just had been used in humans for the first time .Even if the intellectual property is held by a single company, it is unclear, how a patent could be enforced. CRISPR differs from many other technologies by having a very low entry barrier in terms of cost and know-how. Almost every life science researcher could do it at home in their garages…

Barriers to Electronic Lab Notebook adoption

Thu, 08 Jun 2017 00:00:00 +0000

Our lab has been interested in electronic lanb notebooks (ELNs) for a while. A recent publication in the Journal of Cheminformatics has focused on the barriers to ELN adoption. Especially in the academic world, more than 90% of scientists are still using the traditional paper lab notebook. Biggest barrier to adoption was the cost in terms of money and learning of new habits. Close runner-ups on places 3 and 4 were the implementation effort and security concerns. While the authors are clearly biased (they are developing the open source ELN ELN SciNote ), the barriers to adoption are the same that I experience in my lab and at the University of Helsinki.I was stunned when about 2 months ago I received an e-mail with the news that the University of Helsinki had negotiated a framework agreement with the LabVantage LIMS/ELN vendor Software Point. While I think a university-wide ELN solution is necessary, this deal seems anything but optimal for most research-oriented laboratories at the University of Helsinki. Several labs at the university are using ELNs already for a while and none of them have been aware of the efforts to provide a university-wide agreement for a LIMS/ELN solution. And none of those that already use a LIMS/ELN have been choosing LabVantage, but other solutions ( Labguru , SciNote , eLabFTW ). It would have been helpful to have somebody in the evaluation team, who has actual experience with LIMS/ELNs use (or somebody who has participated in LIMS/ELN development), especially since such expertise exists at the University of Helsinki.Only a few people have been involved in the negotiations while the majority of the stakeholders were not even asked for their input. When I asked explicitly about this secluded operation, the answer was: Very few units (mainly the chronology unit and a person from dept of chemistry) were involved with the purchase at the time even though the information was spread around the university and anyone was welcome to participate and state their needs. However, even though I try to actively follow the IT infrastructure developments, I did not see any announcements anywhere and also searching retrospectively, I could not find anything that would have alerted me and allowed me to participate. The labs contributing most to the international success of Helsinki University are the main stakeholders, but they were ignored. Maybe a little bit more active search for the stakeholdres would have been appropriate.The base package that was negotiated with LabVantage seems to be geared towards routine and clinical lab work, but not towards innovative research. Among the two modules that are mostly necessary for life science research work are the ELN and the storage management. Unfortunately, many life-science specific routines (searching for DNA and protein sequences with blast-like search algorithms) are totally absent from the offer, but are very much needed for life science. The lack of a free API (like eLAbFTW features or SciNote soon will feature) prevents users from incorporating their own, existing code or their own database systems. Every small change would require to involve the LabVantage developers and that will be a very slow and costly process. In reality, this means that shortcomings of the system will never be addressed. The base package can be taken into use by any lab at the university after a single payment of 200€ for each user (no floating licenses, only dedicated users). For our lab that would amount to 2000€, but a low price tag is not a selling point in itself.Within the framework agreement, any lab can pay for the additional modules on its own, but the heft price tag of 17500€ make it unlikely that anybody will do so. I am unwilling to lobby for a joint purchase, because there is no way of knowing, whether these modules would be suitable for everyday lab work. Unlike most other vendors, LabVantage doesn’t offer a free trial of the system. It makes me suspicious, if a vendor doesn’t offer a trial. If the product is good, a trial will convince potential customers to buy. If the product is good, what could be the downside of a trial for the vendor? We have ourselves tested several ELN solutions over the last two years and some systems received very bad feedback by those people who use them every day (e.g. cumbersome data import, unintuitive interface, slow server responses). As a matter of fact, for oligonucleotide management and protein/enzyme storage, we still use the absolutely outdated open source LIMS that I co-authored about 15 years ago as a PhD student ( http://phplabdb.sourceforge.net , now at https://github.com/mbekaert/phplabdb) . In my lab, we use eLabFTW . We have a local installation on the Helsinki University intranet (which can be accessed via VPN from everywhere) and anybody from Helsinki University can get an account there. If you are interested in trying it out, please contact me!The key question remains unanswered: Why were the majority of stakeholders not pulled into the decision-making process?

Gemstone hunting in Finnish Carelia

Wed, 31 May 2017 00:00:00 +0000

Last Sunday, we participated in the spring excursion of the Finnish Gemstone Hobbyists’ Society ( Suomen Jalokiviharrastajain Yhdistys ) to a spectrolite quarry near Ylämaa in Finnish Carelia. Spectrolite is a variety of labradorite , which shows a rich iridescense. The Finnish spectrolite is peculiar because of its dark base color. Strictly speaking, the term “spectrolite” applies to the Finnish variety of iridescent labratorite only. The trip was a success as we returned tired and with many kilograms of specimens.

Essentials facts about VEGF-C in lymphology

Fri, 05 May 2017 00:00:00 +0000

Essentials facts about VEGF-C in lymphology

Dr. Michael Jeltsch, Adjunct Professor, University of Helsinki & Wihuri Research Institute, Finland, michael@jeltsch.org

Vascular endothelial growth factor C (VEGF-C) is essential for the development and growth of the lymphatic vasculature. Together with VEGF-D, it forms the lymphatic subgroup within the VEGF family of growth factors, whose other members (PlGF, VEGF/VEGF-A, VEGF-B) are primarily responsible for the growth and function of blood vessels. VEGF-C was discovered as a ligand of the tyrosine kinase receptor VEGFR-3 (1) and its specific effect on lymph vessels was first described in 1997 (2,3). About one-third of hereditary lymphedema cases in humans result from mutations in genes involved in VEGF-C signaling (4). The complete absence of VEGF-C leads to death during embryogenesis (5). Likely for this reason, clinical cases of hereditary lymphedema are characterised by a partial inactivation of the signal transduction. VEGFR-3 (6) is affected in most cases, but mutations of the hereditary lymphedema are described or suspected for all components of the VEGF-C signal transduction described below, partly within a multifactorial inheritance.

Forever Young

Sun, 30 Apr 2017 00:00:00 +0000

I was asked by the Novo Nordisk Foundation (specifically by Dr. John Peter Wittschieben) to say a few words from the successful applicants’ perspective during the “ How to Get Funding from International Foundations ” info event, which took place on April 26th in Biomedicum Helsinki.Useful informationTo be clear: The event was very useful. Specifically it was useful due to the detailed information provided by the Novo Nordisk Foundation and JDRF , who presented during the event. In the very beginning, I was surprised to hear our Dean talk in his introduction about the “lucky ones that received the funding”. In my naïveté, I always assumed that funding was distributed according to excellence and ability, not according to luck. While more experienced researchers like Mikael Knipp were able to give good advice, I could not. Obviously, I cannot boast with my own funding rates (which are about 5%, one of 20 applications being successful).**No time for science, too much time for grant proposal writing?**Some participants expressed surprise about the current widespread complaints of researchers about low funding rates, arguing that a rejected application leads to an improved renewed application in the next round. I agree, that the improvement might be substantial for the first few rounds, but then it becomes a game of diminishing returns. I write an average of 20 grant applications in order to get one accepted, and for 15 of these, I rather agree with E.P. Diamandis, who in Clinical Chemistry complained about the $20+ billion loss due to unsuccessful application writing.**Who is a “Young Investigator?”*The other question that - interestingly - was discussed (and which I had wondered about already for years), was the term of “young investigator”. The bottom line was, that everybody is a young investigator who does not hold a full professorship. This might be the only sensible definition, as the average age of principal investigators has been steadily rising during the last decades (see e.g. here ). Many investigators will therefore stay forever young (or at least until they retire).It is difficult to be creative if you are struggling with fundingAlthough I could not convince many (maybe nobody), I objected to the notion that is is desirable to combine the goal of creativity and applicability in academic research. True creativity originates mostly from a primary motivation and utilitarian aspects actually get in the way of creativity. This is not to say, that creative research cannot be very useful. To make them an important criteria in the distribution of funds is just asking too much from the money source, namely to be able to predict the future. Creativity and the push towards “applicability/impact” of research are not only orthogonal to each other, but are pushing into opposite directions. If the research is struggling with funding, it is difficult to be creative. The basic needs for survival need to be met before people can realize their possibilities. In addition, when foundation ask for short term applicability, they appear to me like politicians, who think in terms of the 4 or 5-year election cycle. For much of academic research, we cannot predict its future uses. In addition, potential applications are mostly MUCH more than 5 years into the future. If the push towards applicability results in shifting the balance from basic towards applied science, the pipeline (basic research > applied research > engineering) will dry out from its source. Maybe this push towards applicability will also accelerate the blurring of the lines between the traditional universities and the universities of applied sciences. *I have to side with Marx this time: Nicht das Bewußtsein bestimmt das Leben, sondern das Leben bestimmt das Bewußtsein.

A Very Short History of Antiangiogenic Tumor Treatment

Mon, 24 Apr 2017 00:00:00 +0000

I covered the antiangiogenic tumor treatment topic in the Cancerbio Summer School (CBSS) 2017. As a review I recommended the following: Weis SM, Cheresh DA. Tumor angiogenesis: molecular pathways and therapeutic targets. 2011. Nature Medicine 17:1359-70. http://www.nature.com/nm/journal/v17/n11/pdf/nm.2537.pdf

Overrun by the Big Wheel?

Fri, 24 Mar 2017 00:00:00 +0000

Despite focus on internationalization English information about education reform incomplete and lateThe Big Wheel reform is rolling over me and I don’t notice it. There has been some information in English about the process on the University’s intranet . However, during the drafting, most of the documents were initially only available in Finnish and due to the delay caused by translation, foreign staff without English language proficiency was largely excluded from the process. Loosing this input was certainly not helpful, since several goals of the Big Wheel reform are related to internationalization, e.g. harmonizing the degree structures within Europe (“3+2+3 system”) and making the degree programmes internationally attractive and competitive.Excellent students potentially excluded from studying at our UniversityConcluding from the application numbers for the Master’s programmes that’ll start in September 2017, there is still much work to be done to make the programmes “internationally attractive and competitive”. Virtually all programmes reported a decline in applications from Non-EU/EEA countries, which probably will result in much less income from tuition fees than the university would like (Master’s thesis tuition fees at the University of Helsinki are between 13000 and 18000€/year depending on the programme). We probably loose potentially excellent students and there is a diffuse suspicion that the general level of education might suffer. 30 scholarships of varying amounts are available for Non-EU/EEA students. However, only about 10 of the recipients will be able to completely recoup the tuition fee with their scholarship (see here: https://www.helsinki.fi/en/studying/how-to-apply/scholarship-programme) . I also think that the advertisement for the study programmes could be definitely improved.Information about available scholarships: clear enough or confusing? I also fear that many potential applicants were confused about the scholarship programme (so was I, and still am). Our own Master’s programme’s web pages ( https://www.helsinki.fi/en/programmes/master/translational-medicine-transmed ) do not mention the scholarships prominently (or was that on purpose?). Even worse, the link on the Helsinki University’s pages to check whether or not a student is required to pay the tuition fee has been half dead for a while (“You can check this FAQ at the Studyinfo website whether or not you are required to pay tuition fees” (original on this page ). Hopefully it died only after the application deadline finished…Educational reform of the PhD degreeThe Big Wheel reform concerns all three degrees: Bachelor’s, Master’s and Doctorate (PhD). Internationalization is especially relevant to the PhD degree and those Master’s programmes that are entirely in English (e.g. Translational Medicine or Life Science Informatics). Even though about half all PhD students in my unit (Research Programs Unit) are foreigners, hardly any of them knows what the “Big Wheel” is about. Big Wheel discussion at Meilahti campusAfter almost all is set and done, an info event about the Big Wheel was announced for the Meilahti campus (31.3.2017). The e-mail message was exclusively in Finnish. I often have given feedback when important events were not announced in English (more often than not getting no response). That’s why I wrote a message straight to the rector and the vice rector of the university. The e-mail conversation is attached below. Suffice to say that the university is still dedicated to increase internationalization despite this not being without problems…What was discussed at the hearingThe part of the discussion that happened in English was circling around the PhD education. A very valid request was not to fix something that is not broken. In the international comparison, PhD education is for the most part excellent in Finland and the only perceived problem is its length.At the moment a Finnish PhD thesis in life science requires the graduate student to publish in scientific journals. As a consequence, most of the research in Finland is done by PhD students. The exact number and quality of publications required differs between faculties as there is no formal consensus. Typical are 3-5 papers, sharing of authorship is accepted to a certain degree. Not all publications need to be first-author contributions.Finish PhD graduates are competitiveWhile a PhD from a Finnish University is internationally very competitive, PhD graduates are typically much older than those from most other countries. This begs the question: so what? The typical length of PhD studies in Finland has been generally assumed to be around 7 years. However, nobody knows exactly (not even the university itself, since tight rules to register PhD studies have not existed until recently), but there seems to be a very slow movement towards a shorter duration (and less requirements). Strong forces act against shortening of PhD studiesThe fact that the PhD studies last so long in Finland is the result of natural selection. Pushing with regulation for faster PhD education will have many unintended consequences. There are strong forces acting against shortening the PhD studies, especially for highly talented students that aim at an academic career: E.g. the relative ease to get scholarship funding during the PhD studies and the high unemployment among fresh PhDs in Finland.Age limits for PhD degrees for fundingPointed out by Kalle Saksela, a major obstacle to shorting the PhD education is the general funding situation of academic research. With every funding cycle, funding rates are pushing new all time lows. Successful applicants have a very compelling portfolio of high quality publications, which needs time to acquire. However, major competitive research funding (Academy of Finland, ERC) puts limits on applicants (e.g. “no more than 7 years after PhD completion”), which have no relationship to the quality of the application.Four yearsThe very clear message from vice rector Hämäläinen (Jukka Kola had already left the discussion, when it switched from Finnish to English) was that the PhD studies must be shortened in order to reach comparability with other countries. The target is 3+2+4 (3 years for the Bachelor’s studies, 2 more years for the Master’s studies, and then 4 years for the PhD studies). The idea put forward by the vice rector was to simply move some of the studies that are done at the moment under the PhD umbrella into the early postdoctoral period. A big question is obviously who is going to pay for this move? There needs to be a substantial increase in research funding to be able to pay salaries for postdocs unless we want to lower the overall domestic research output. Already now it borders to financial suicide to employ a postdoc with an Academy Research Fellow budget.

Purification and Characterization of Recombinant Proteins

Mon, 20 Mar 2017 00:00:00 +0000

We are organizing (again) a practical hands-on protein purification course from December 4th to 20th. We maximally can accommodate 16 participants, which will form groups of 2 to 4 participants. Each group needs 3 full days to go thru the practical exercises, but day 3 of the course will be overlapping with day 1 of the next group. Venue is Biomedicum Helsinki, rooms A516a1 (where the machinery is) and B318a/b (our lab). We will purify a protein (VEGF receptor 3) using a two-step protocol (affinity chromatography + gel filtration) on the the Äkta Avant FPLC device. On the third course day we’ll assay its interaction with its ligand (VEGF-C) on the ITC (isothermal calorimetry) device. We have given a similar course in 2015 ( http://www.helisci.fi/hbgs/FPLC2015/) . This new course ( https://courses.helsinki.fi/en/DPBM-135/120171139 ) will have a similar structure, but we expand it by one day to analyze protein interactions making use of the new isothermal calorimetry device of our B3P core facility. The documentation and results will be also available from here . Since we can run maximally two samples at a time (we have “only” two FPLC machines), we will have to split the participants into groups (of 2-4 students/group) and repeat the 3-day course several times depending on the number of participants.

Angiogenesis landmark publications

Thu, 09 Mar 2017 00:00:00 +0000

According to Nature, our Science paper from 1997 is a landmark paper for the angiogenesis field: *“A paper establishing the role of VEGF-C and VEGF-R3 signaling in lymphangiogenesis. A new field is born."*The collection of landmark papers for the angiogenesis field from the last 80 years ( http://www.nature.com/focus/angiogenesis/classics/vegf.html ) was published first in 2003 and unfortunately has not been updated to include later seminal studies. However, until today, most of these 86 papers are still must-reads for every PhD student in the angogenesis field.

"Silver" and "gold" coating a 5 cent coin

Tue, 07 Mar 2017 00:00:00 +0000

Last Friday, I coated with my kids 5 cent (copper) coins. They look pretty nice even though its only zinc and brass. All you need is a clean copper coin (you can clean old coins efficiently with vinegar), sodium hydroxide (NaOH), zinc powder and a hot plate. The original method (see this PDF ) uses a bunsen burner, but we did the heating and the final conversion of the zinc-plated coin into a brass-plated coin simply by placing it on our kitchen’s hot plate. Hot sodium hydroxide is pretty dangerous, so be warned (eye protection) and keep the kids under control!

No interest (in retrospection and introspection)?

Fri, 17 Feb 2017 00:00:00 +0000

There was much talk about last years “changes” at the university. Surprisingly, nobody seems to be interested anymore in the topic. At least this is the impression that I first got, when I went to the public hearing event at the Meilahti campus. The lecture hall 1 of Haartman Institute, where the hearing was supposed to take place, was completely empty when I arrived. Because only a handful of people had bothered to show up, the hearing had been moved to a table in the nearby Cafeteria. Hardly noticed by anyone, a review group has started its work to analyze the “changes” at the University of Helsinki, which took place during the last one and a half years. I guess the idea was to figure out what preventable mistakes have been done. According to this university source , Jukka Kola, who is the public face for many of the controversial decisions during this period, got to decide himself about the members of the review group. Because of this, the review group will have to be very careful not to appear biased in their report.

Science good, coffee bad

Thu, 26 Jan 2017 00:00:00 +0000

Last week I took part the Vascular Cell Biology Gordon Research Conference in Ventura (California). My two previous Gordon Conferences (2001 Rhode Island, 2014 Lucca/Italy) were outstanding and also this one did not disappoint.Even though there were many European researchers (19%), the US made up for 69% of the participants (Asia 6%, rest of the Amerikas 5%). This is probably a good representation of where the cutting edge research in vascular biology happens. Makes me wonder why the coffee in the US is as bad as it is (my bias got confirmed again). It cannot be explained by the lack of scientific expertise.Gordon conferences are designed to promote the exchange of unpublished data and hence I am not writing anything about the science. One exception: There are clinical trials to treat lymphedema with leukotriene B4 inhibitors ), but this is already public knowledge and the mouse studies are mostly published ( http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0008380) . So no secrets leaked here… I myself presented a poster about the continued CCBE1 story that is currently under review and some preliminary data about additional VEGF-C activating enzymes.Obviously, the outcome of the presidential elections was a popular topic during lunch and dinner conversations especially as it relates to science funding and science policy. Opinions ranged from “We have no clue what to expect” to “Be afraid. Be very afraid.” I personally enjoyed about 8 hours of Trump presidency since my return flight from Los Angeles to Munich left last Friday at a quarter past five in the afternoon.In the free afternoons, I tried to catch the America-exclusive Taurus Pokémon for my daughter Milena. Sadly, the conference location was almost entirely devoid of poke stops and therfore I was chronically short of poke balls. Insiders told me that Santa Monica beach is the place to go to in order to catch Pokémons. I actually planned to go there Friday morning, but it was raining cats and dogs and so I tried my luck at the airport and about an hour before departure I finally managed to catch a Taurus and another one just before boarding the plane. So all in all a very successful conference journey!

Kapa HiFi excels, Phusion works sort-of, Q5 and Platinum SuperFi disappoint

Fri, 02 Dec 2016 00:00:00 +0000

My last NEBuilder assembly got stuck because I couldn’t get two of the PCR reactions to work. I needed one small fragment and two ~3-kb-fragments. I needed to insert a 2A-sequence in between the small and one of the 3-kb-fragments and thus added the necessary sequences as tails to the primers. The template was not especially GC-rich, nothing too complicated, but only the small fragment did amplify in my first attempt. When also my second attempt failed to amplify the 3-kb-fragments, I decided to try out some alternative polymerases. For cloning purposes, I have been using exclusively Phusion High Fidelity DNA polymerase (from New England Biolabs or from ThermoFisher ) for the last years, but maybe there was something better and more robust? I received three different free samples for testing: KAPA HiFi HotStart , NEB Q5® High-Fidelity and ThermoFisher Platinum SuperFi™ . My graduate student did the PCRs yesterday and I ran the gels today. From the gel quality, you can see that I don’t have much routine anymore, but the overall results are quite clear and in the future, our go-to polymerase for tricky templates will be KAPA. I think KAPA’s proofreading capabilities are a bit below Phusion, but I do not care if 2% instead of 0.5% of the DNA products contain a mutation.In the attached PDF file, you can see, that my grad student included two more samples for the Phusion polymerase, where she used the same conditions, but a different template (supercoiled plasmid instead of linear DNA). Surprisingly, the Phusion polymerase did a much better job to amplify from supercoild DNA than from (the same) linear DNA; I cannot explain that…

Key project funding

Fri, 07 Oct 2016 00:00:00 +0000

This post is inspired by our recent success in the Key Project Funding call of the Academy of Finland . One of the main time killers for scientists is to apply for money to finance their research. Scientists spend more and more time preparing grant applications because of the growing competition for the shrinking resources.After deducting the time for teaching and administration, they maybe able to spend a few hours each week doing research. Last week over lunch, a friend of mine ask me what our funding rates were. I did not know, because I have been avoiding the inconvenient truth. I calculated today and the depressing result is that they are in the low single digit range and this seems to be a quite average figure (for us, 2015 was an exceptionally successful year and the 2016 number might perhaps still improve since several decisions have not been made yet).Improving academical productivity by increasing the 1600 hours of yearly working time on paper is meaningless if 400 hours of this time are spent in vain, i.e. for unsuccessful grant applications. The financial damage and opportunity costs to the system are enormous and a colleague of my recently pointed me to this 2015 article in Clinical Chemistry , where the monetary value wasted by grant application writing was conservatively estimated for the US to be at least $20 billion per year.Our budget includes new positions for researchers, but we don’t know yet where and when these people will be able to start their work. In theory, the hosting organization (i.e. the Research Program of the University of Helsinki) guarantees the infrastructure. However, the Research Program cannot generate lab space from nothing. The university is just trying to save money by minimizing the floor space it rents. While some people celebrate successful grant applications, my view is more down-to earth: After the grant decision is before the grant decision*.*Citation modified after Sepp Herberger , coach of 1954 soccer world cup winner Germany, who famously stated “After the game is before the game.”

OpenBIS for Dummies

Tue, 06 Sep 2016 00:00:00 +0000

If you have considered moving from paper to electronic lab notebooks as we are at the moment, you might have come across the OpenBIS solution. You want to install OpenBIS, but have not clue how to go about it? I didn’t have much of a clue either and therefore tried repeatedly until I succeeded. Luckily, I got some help from the ETHZ OpenBIS and our local computing support team, but obviously they cannot compensate for the lack of insight into Jetty and postgresql…If you just quickly want to try it, it might be easier to download the VirtualBox image, where everything is preinstalled and preconfigured ( https://wiki-bsse.ethz.ch/display/bis/openBIS+ELN-LIMS+Virtual+Machine ). However, I didn’t have any fast hardware to run the VirtualBox image and concluded that it would be fast enough on bare metal using an old computer.The notes below are written from memory and from the final configuration files that worked. However, I will still setup the server from scratch executing only what I have been writing down below in order to make sure I have not missed anything important. However, in the meantime I want to get this information out. I would have been happy if I had found some “OpenBIS installation for Dummies” instructions. In order to have a very long support, I chose for the installation Ubuntu 16.04 Server (the VirtualBox image uses Ubuntu 14.04 Desktop) and the latest version of OpenBIS 16.05.1 (you need to apply for an account to be able to download the software). The electronic lab notebook (ELN) plugin comes bundled with that release. Doing that, you have a problem with Java 7 support (it is not going to maintained for long and I will try to run OpenBIS ELN with Java 8 soon, but this walk-through uses a Java 7 PPA for Ubuntu 16.04).1. Do a fresh install of Ubuntu 16.04.1 Server. Create during the install the admin user “openbis”. When it asks for software selection, choose OpenSSH and Postgresql in addition to standard system utilities. Upon first login (as openbis user), update and upgrade all the software to the latest version and install emacs (or whatever text editor you prefer) and unzip:sudo apt install unzip emacs24-nox2. Install Java 7. Thi sis just one way how to do it:sudo add-apt-repository ppa:openjdk-r/ppa sudo apt-get updatesudo apt-get install openjdk-7-jre-headless3. To setup postgresql correctly, change the configuration file /etc/postgres/9.5/main/pg_hba.conf. All lines ending in peer, the peer should be changed into trust! After that, reload postrgresql:sudo systemctl reload postgreql4. If you are installing to a virtual machine like virtualbox, it would make sense to install the guest utilities as this will make you life easier (virtualbox-guest-utils). Make a shared (permanent, automout folder) and add openbis to the vboxsf group:sudo usermod -a -G vboxsf openbis4. Place the compressed openBIS installer file into the home directory of the openbis user.5. Untar/gzip the installer:tar -xvzf openBIS-installation-standard-technologies-S233.0-r36799.tar.gz6. Change into the uncompressed directory:cd openBIS-installation-standard-technologies-S233.0-r367997. Change the following things in the console.properties file:INSTALL_PATH=/home/openbis/DSS_ROOT_DIR=/home/openbis/dataELN-LIMS = truePATHINFO_DB_ENABLED = trueINSTALLATION_TYPE = serverFor this try I have not changed the password of the keystore, but you should do it for security reasons if you use the server for production!8. Run the installer (not as root, but as openbis user):./run-console.sh9. When the installer asks to enter the password for the openBIS ‘admin’ user, type in the password you want to use when logging in as admin into the web interface.10. When installation is done, go to ~/openbis/servers/openBIS-server/jetty/etc and edit the file service.properties. You actually have not to edit anything for the installation to work, but we needed to configure the system for login authentication via Ldap.authentication-service = file-authentication-service => authentication-service = file-ldap-authentication-serviceIf you use ldap alone (i.e. authentication-service = ldap-authentication-service), you need to have some special users in the ldap directory. We are authenticating via our university’s ldap serer only regular users of the system and hence, e.g. the admin user needs to be authenticated locally. This admin user is setup during the install, but you need to have both file and ldap authentication active for this to work. This is our ldap server address as specified in the service.properties file. It contains the authentication base, which you need to ask from your sysadmins:ldap.server.url = ldap://ldap2015.it.helsinki.fi/OU=people,DC=helsinki,DC=fiThis is the ldap user and his password on the ldap server (don’t ask me why the ldap people use such complicated word monster for such a simple concept):ldap.security.principal.distinguished.name = OU=openbis,OU=login,DC=helsinki,DC=fi``ldap.security.principal.password = PASSWORDThe following paramters are specific to our ldap server. We use OpenLDAP and since OpenBIS seems not to support TLS, we use ssl:ldap.security.protocol = ssl``ldap.security.authentication-method = simple``ldap.queryTemplate = (&(%s))OpenBIS requires https. You can either leave the self-signed certificate (provided by the ETHZ) or install an own certificate. If you keep the self-signed certificate, all users will get a warning when they try to log into the web service. There seems to be an additional problem as the uploading of files seems not to work with the self-signed certificate since the https request via port 8444 doesn’t result in an intercept that is presented in the browser window to users to override.Hence we had no choice but to get a real certificate, which is luckily easier today than still one year ago due to the letsencrypt folks. Nevertheless, getting the certificate stuff right took us some time. We are operating the OpenBIS server inside the University network and it is not visible from the outside. Users who want to access it from outside need to use a VPN.Therefore we had to install a temporary “fake” server with the same name on a publicly reachable IP and generate a letsencrypt certificate (letsencrypt is not yet automated for jetty). I used the automated method for apache2 on my own server at Digital Ocean and then retrieved the two important files (fullchain1.pem and privkey1.pem) from the /etc/letsencrypt/archive/eln.jeltsch.org directory and moved them over to our OpenBIS server. To convert them into the correct format for the java keystore, I used the following commands:openssl pkcs12 -export -out keystore.pkcs12 -in fullchain1.pem -inkey privkey1.pemkeytool -importkeystore -srckeystore keystore.pkcs12 -srcstoretype PKCS12 -destkeystore keystore.jksThe first command asks for an export password. It doesn’t matter what you use (I used 12345678). The second command asks for a destination keystore password. Enter here “changeit” if you have not changed the default keystore password (“changeit”) during the setup. Then it also asks you for the source keystore password (which is the 12345678 that I just used above).Then you still have to add the contents of this keystore to the already exisiting keystore. There are probably many ways to do this, but I used a graphical tool called Keystore Explorer . You simply open both keystores (you need the “changeit” password for this), you delete the existing entry for ETHZ and add the only (letsencrypt) entry from the newly generated keystore. Replace the files “keystore” and “openBIS.keystore” in the directory ~/openbis/servers/openBIS-server/jetty/etc/ with the modified keystore. Both files are identical, I don’t know atm the relevance of this duplication. You also have to replace ~/openbis/servers/datastore_server/etc/openBIS.keystore with the new version of the keystore. For some reason, uploading did not work and in order to enable uploading, the service.properties of the datastore server needs to specify the host-address of the datastore server:https://eln needs => https://eln.jeltsch.org. Since we used a different host for the certificate generation, there was a host name mismatch and we had to override manually the hostname settings:Change it in the files /etc/hostname and /etc/hosts, then reboot. However, the installer took only the first part of the full name for the service.properties files of the datastore server. Our server’s name is eln.jeltsch.org and it resulted in https://eln, which did not resolve in our network, since we got the letsencrypt certificate signed on another server. After we changed the service.properties files and after rebooting we were finally ready to test the server:11. Starting the server: Log into the server as openbis user.cd ~/openbis/bin/./allup.sh12. On another computer, navigate in your web browser to “ https://eln.jeltsch.org:8443/openbis/webapp/eln-lims" . If you have not installed a publicly trusted certificate, the browser will now warn you that the connection is not secure. Just click “Advanced” and confirm the security exception. You need to login as admin/PASSWORD (which you specified during the install).There are some tutorials on how to use the ELN. However, the people in my lab told me that the UI is not very intuitive and that I need to teach them the basics. I think it might make sense to describe in a tutorial the typical setup in a typical small life science lab: what work spaces with what access rights for whom and to describe common scenarios (e.g. if some reagent lists need to be accessible by outsiders, etc.). I also have many ideas for improvements. It would be e.g nice to get more “ELN previews” for uploaded documents. At the moment, images are previewable, but e.g. PDF files not (I have not tried SVG files yet, but we use them quite a lot for image annotation). This certainly is not my last post about OpenBIS and until we take it into production use (likely beginning of next year) I still have to learn much.

Cloning club - workshop material

Tue, 30 Aug 2016 00:00:00 +0000

Collection of the course materials for the DPBM -organized Cloning Club . There are files in (at least) two different formats for each lecture: PDF and ODP (Open Document Presentation). The ODP file is editable using LibreOffice software. If you want to open it with Microsoft Office, you need to convert it first using either LibreOffice or some online conversion tool (like cloudconvert ). The material by the course organizer (in Open Document and PDF format) is available under the creative commons license (excluding adapted material, which is explicitly marked). Material from course participants (in PowerPoint format) is provided at the terms of the creators. I might add improved versions the meeting/lecture slides later based on participants feedback.

University rankings (and how to manipulate them)

Mon, 29 Aug 2016 00:00:00 +0000

Whow. Helsinki University was again able to improve its position in the Shanghai Ranking and is now number 56. However, even the University’s own press release had kind of a gloomy tune as if this was the last blossom before the final decay. It is true that the basis of the current success has patiently been built by the researchers over the last decades. Nevertheless, when politicians now draw the conclusion that the cuts of the educational budget are responsible for this success, they are probably right.Perhaps the cuts actually did contribute to the surge in productivity: All the scientists that unexpectedly were suddenly unemployed obviously continued to work furiously on their current projects to get their current manuscripts ready for publication. Papers are the overwhelmingly dominant currency in the academic job market. And these unemployed scientists might publish faster than before since unemployed scientists have no teaching duties…However, more importantly, the Helsinki numbers of the individual Shanghai Ranking indicators for 2015 and 2016 differ significantly only the per capita academic performance (publications/number of academic staff) and the number of highly cited scientists. Since the job cuts at Helsinki Universities have been going on already for a while even before the massive cuts of this spring, it appears reasonable to claim, that the 56th position is partly due to the job cuts, which did influence directly and rapidly the number of academic staff.The Shanghai Ranking emphasizes research, whereas in other rankings, Helsinki has even been dropping. E.g. in the QS World University Rankings , Helsinki dropped from position 67 (2014/15) to 96 (2015/16). Between these two rankings, the QS team made “improvements” to their ranking system and these were almost exclusively responsible for the drop if you look at the data closely. They “normalized” the citation ratio per faculty according to the subject, and life science got badly punished by being a “high citation field”. Very simply put, a citation to a paper in Arts and Humanities now counts about 40 times as much as a citation to a paper in Life Science/Medicine. Each of the 5 big fields (Arts & Humanities, Engineering & Technology, Life Sciences & Medicine, Natural Sciences, Social Sciences & Management) contributes now equally with 20% to the final rating in the citation per faculty category (detailed explanation of the normalization from here: http://content.qs.com/qsiu/Faculty_Area_Normalization_-_Technical_Explanation.pdf).Why on earth do they punish a field for having a bigger impact? Papers in the humanities are not cited as much as papers in life science. Maybe this could be due to the fact that their average publication is not as relevant for their own field as is a life science publication for the life science field? I agree that there are cultural differences between fields, but who is to say how much is due to such cultural differences versus low quality or irrelevant research? Exactly that’s what QS World University Ranking’s did by making up “normalization” factors essentially claiming equal relevance.However, all such rankings are easily manipulated. E.g. the citation to faculty (member) ratio can easily improved by outsourcing services that were previously performed by faculty scientists (and that’s what Helsinki University is just doing at the moment). Similar to the impact factor for journals, university rankings are losing their relevance if the goal is to score high and not to excel at research and teaching ( Goodhart’s law : When a measure becomes a target, it ceases to be a good measure).The Shanghai Ranking has been criticized much. It undervalues teaching since teaching performance doesn’t enter directly the calculation at all, and it favours big universities since 50% of the rating are based on sheer numbers which are not normalized to account for the size of the university. Nevertheless it it the only reproducible (and therefore scientific) dataset from the three big rankings ( https://link.springer.com/article/10.1007/s11192-012-0801-y ) since both the QS and the Times Ranking rely heavily on opinion and reputation surveys, which are notoriously difficult to reproduce.What is the take-home message? Helsinki University is probably as good as it used to be during the last decade and the big fluctuations are just artifacts resulting from changed ranking methodologies or resulting from administrative adjustments to the financial realities brought upon us by the Finnish voters in the 2015 parliamentary elections.

Let's beat cancer together!

Sun, 07 Aug 2016 00:00:00 +0000

Sawan and me registered as “The Jeltsch Laboratory” team to the Helsinki Twilight Run , which is a charity event to support the Finnish Cancer Foundation . However, Sawan caught a summer flu and had to skip the whole event. My goal was to stay below 1 hour and I managed. There were actually more participants from the RPU (Research Programs Unit) ; I ran into Tiia and Julia. Maybe we should next year start as a joint RPU team (or whatever the RPU will be called if we really manage to change our name)?

The Staden package on Ubuntu for bioinformatics dinosaurs

Wed, 27 Jul 2016 00:00:00 +0000

Mostly we use the SnapGene software when we check the sequences of our DNA constructs. However, sometimes SnapGene’s alignment view is not flexible enough and then I fall back to using the ancient Staden Package . I just had upgraded from Ubuntu 14.04 to 16.04 and hence did not have Staden installed. I was pleasantly surprised when the installation of Staden took only about 15 seconds because finally - thanks to the Debian Med team - Staden is available from the universe repository (actually already since October 2014).sudo apt install stadenStaden is clearly not as intuitive as it could be, but it is very powerful and lends itself to automated processing of data. If you have the opportunity to learn it, I would encourage you to do so. The Finnish CSC recorded the Staden course from 2004, in which I participated and you can get the recordings from Funet TV . I just had briefly considered switching from Ubuntu to SuSE because of the ongoing wireless connection debacle that Canonical can’t seem to fix, but considering how non-trivial a manual install of Staden is, this is a big plus for Ubuntu. There are obviously dedicated Linux distributions for bioinformatics purposes, but they all tend to lag behind the latest and greatest developments of the major distros.

Moving from Paper to Electronic Lab Notebooks

Tue, 26 Jul 2016 00:00:00 +0000

Electronic lab notebooks (ELN) are the future. While this statement appears self-evident, it is not clear what software will establish itself and which ones will disappear. When I first checked the ELN market about three years ago, there were only a handful of solutions. Now there are already maybe about a hundred different software companies that try to cash in on the trend. And what is even more worrisome is the fact that the list of vendors contains already about 20 abandoned products…Thus, settling on a software is a serious decision for a lab and even more so for a whole institute. Many points need to be taken into consideration. Just to mention a few of them:- How sure is it, that the software is available and supported in 10 years? If the company disappears, your data might as well. All vendors will claim that your data is safe. You should be realistic given the widespread deception of customers and authorities by companies. Just think about VW…- What is the upfront investment and what are the running costs? If they charge you for storage space, the price might initially be low, but don’t underestimate how much data you will accumulate with all the new high res imaging and sequencing technologies. Once you are doing superresolution, you easily can gather a many GB each week. E.g. SciNote includes 100 GB of storage for 2 teams, which can fill up within a few weeks depending what type of research you are doing. I was trying to figure out how to buy storage beyond 100 GB, but I could not figure out how. I hope that the usability of their ELN is not on the same level… - How free is your data? Can you easily (and in an automated fashion in regular intervals) pull out your data if you need to? In what format can you get your data? If it is only PDF or Word files, just forget about it. You should get a real database dump that can be used to populate other systems. I would not trust any company to tell me ahead of time that they will go belly-up soon and that I should rescue my data…- Where are the data stored physically? This determines e.g. what law the data falls under and who has access to it. How much can you trust a small company overseas to keep your data private and secure? Let’s remind everybody of the data breaches that affected Sony, Linkedin, IRS, T Mobile, UPS, JP Morgan Chase… Some vendors offer in-house hosting, but the pricing seems to be too high for many academic labs to make this a viable alternative.- Open Source seems to be a solution to may of these problems. However, with diminishing computing infrastructure support from the university, the maintenance requirements of such a system need to be very low in order to make this feasible.- If it is marketed as “free”, what do they mean with free? Often, the “free” offering is not sufficient for any serious work and hence misleading. “Free” as in “free beer” is also not enough… Many labs need also the freedom to adapt the software to their specific needs, which excludes proprietary solutions without public APIs.In my lab we have been testing a few of the available solutions. Our emphasis was on open source solutions since only Open Source solutions make it easy to test the software extensively. So far we have tried:

RPU Seminar 2016

Fri, 24 Jun 2016 00:00:00 +0000

Available Downloads

Get the slides in PDF format.

Download PDF

Cloning Club

Wed, 22 Jun 2016 00:00:00 +0000

Together with the Doctoral Programme in Biomedicine (DPBM) we are organizing in autumn 2016 a workshop and a practical course about cloning (course code 921244).Dates and venue (workshop): Weekly discussion workshop (8 events each 1 to 1.5 hours) starting Tuesday 30.8.2016; venue: meeting room 7 (Biomedicum Helsinki, 5th floor, except 27.09. and the last workshop on 25.10., which take place in BM B136A); 1 creditDates and venue (practical course): Decentralized lab course (at the participants schedule and venue or - for participants without own access to the necessary facilities - in the first two weeks of November in our lab); 1 creditCourse information page: http://www.helisci.fi/hbgs/cloning-club2016 Registration page: https://elomake.helsinki.fi/lomakkeet/71701/lomake.html Detailed course info: PDF Advertisement poster: PDF Course material: Material will be added after every meeting here . Cloning has the appeal of being boring. However, all starts with DNA. Genetic engineering is not only here to stay, but will become more and more important: we are just scratching the surface of its potential. Almost all biomedical research involves DNA constructs: expression vectors to transfect cells, shuttle plasmids to make viruses, constructs to generate transgenic animals.The skill to generate a DNA construct is needed until the arrival of that promised device, which will spit out any plasmid a few hours after you have fed it the plasmid’s sequence. Many new technologies are available and as a result, it is more difficult to choose than in the old days when restriction enzyme cloning was the only option. Today, demands and options are endless and you need to choose the right strategy to maximize success and speed.

Echtes Biohacking

Mon, 13 Jun 2016 00:00:00 +0000

Steven Novella hat einen interessanten Blog-Artikel ūber Biohacking geschrieben. Ich schliesse mich seiner Meinung grösstenteils an, dass die meisten diesen Begriff zu Unrecht fūr sich in Anspruch nehmen, weil sie eben nichts konzeptionell Neues machen, was diesen neuen Begriff rechtfertigte. Allerdings haben sich für die Anwendung dieses Begriffes und seine Abgrenzung zur DIY-Biologie und diversen Körper-Modifikationsbewegungen noch keine einheitlichen Maßstäbe etabliert.Die Definition von Biohacking als die “Freiheit, seine Biologie tiefgrūndig zu erforschen” ist weitgehend nichtssagend. Das Wort Hacking hat im allgemeinen Sprachgebrauch meist den Beigeschmack des Illegalen oder zumindest des Halblegalen. Diesem Sprachgebrauch folgend könnte man Doping im Sport als Biohacking bezeichnen, Kaffeetrinken aber eher nicht (einmal davon abgesehen, dass Kaffeetrinken zumindest für einige Leute den Tatbestand des Doping erfüllt). Ein anderes Beispiel, das ich als “echtes” Biohacking bezeichnen würde wäre der Gebrauch von Crispr/Cas um seine eigene DNS zu editieren. Oder die Herstellung von Medikamenten in der eigenen Garage.Die Frage ist: Macht irgendeiner sowas? Gentechnologische Verfahren und die Herstellung von Pharmazeutika sind im universitären und kommerziellen Bereich streng reglementiert, weil solche Verfahren einige Risiken mit sich bringen. Es ist daher nicht verwunderlich, dass die regulierenden Behörden sich nicht darüber freuen, noch eine weitere Szene auf Anzeichen von Bioterrorismus überwachen zu müssen.Tatsächlich wird es immer leichter, die diesbezüglich notwendigen Werkzeuge herzustellen und zu benutzen. Biotechnologie in der Garage ist Wirklichkeit, zumindest hat die Zeitschrift Nature diesem Thema ein News Feature gewidmet. Schon vor geraumer Zeit habe ich einen Vortrag gehört von Thomas Landrain, einem der Köpfe hinter dem La Paillasse-Labor (Thomas: du hattest versprochen, die Internet-Seiten von La Paillasse ins Englische zu übersetzen!), einem Biotechnologie-Laboratorium, dass ohne Startkapital in einer Pariser Vorstadt-Garage gegründet wurde und dass wirklich interessante Projekte durchführt (hier ein Artikel von Thomas Landrain über DIY-Biologie ). Und auch Konferenzen wurden schon zum Thema DIY-Biologie veranstaltet: https://www.synenergene.eu/news-item/paris-conference-what-can-do-it-yourself-biology-do . Aber wo ist die Grenze zwischen DIY-Biologie und Biohacking? E. coli-Bakterien zu modifizieren, damit sie Erythropoietin herstellen, dann das Protein aufreinigen und in sich selbst injizieren, um seine sportliche Leistung zu verbessern würde wahrscheinlich jeder als Biohacking durchgehen lassen. Meiner Meinung nach ist dieses Beispiel gar nicht so abwegig, sondern wäre durchaus mit den Mitteln der heutigen DIY-Biologie realisierbar.

Real biohacking

Mon, 23 May 2016 00:00:00 +0000

I have read an interesting blog post by Steven Novella about biohacking . I completely agree that most people that push biohacking are not doing anything, that would justify the use of the term. A new term should be used if you are doing something conceptually new. However, the use of the term biohacking and its relationship to DIY biology and diverse body modification movements has not settled yet.The definition of biohacking as the “freedom to explore biology deeply” makes the term rather meaningless. Hacking as a term has always carried the notion (rightly or not) of doing something illegal or at least borderline legal. To follow this analogy, doping in sports could be considered biohacking (but not drinking coffee - notwithstanding the fact that coffee does fulfil the criteria of doping for some people). Other examples that I would call “true” biohacking would be the use of Crispr/Cas to modify your own DNA. Or developing medical drugs to treat diseases in your own garage.The question is: does anybody do such things? The development of such techniques is highly regulated in both academic research and commercial enterprises and real genetic engineering carries real risks. Not surprisingly, law-enforcement officials are not very happy about still another subculture to watch for signs of bioterrorism . However, the tools are getting easier and easier to use and garage biotech is a real thing (at least Nature thought it is worth a News Feature ). Already a while ago, I did listen to a talk by Thomas Landrain, one of the brains behind the La Paillasse lab (Thomas: you promised that the La Paillasse web pages would be translated into English!), which is a biotech lab that was started with zero money in a garage in a Paris suburb. They are doing quite interesting research (see e.g. this article about his take on DIY biology). There are also conferences about DIY biology: https://www.synenergene.eu/news-item/paris-conference-what-can-do-it-yourself-biology-do . But when does DIY biology become biohacking? Modifying E. coli bacteria to produce erythropoietin and then purifying and injecting it into yourself to increase your sports performance would certainly qualify as biohacking. Imho that example would actually be feasible considering the state of the DIY biology technology…

Unicorn 7 user separation requires manual intervention in a network user environment

Mon, 09 May 2016 00:00:00 +0000

Since we are operating our Äkta Avant in a multiuser environment, we need to separate the methods and results of the different users. By default, every network user is at the moment able to see every method and every result that has been generated on the machine by any other network user. This is a considerable privancy and security issue as a malicious user could delete (or even worse: modify) methods and results.Our Äkta is set up in a way that allows users to log into the Unicorn 7 computer with their university login/password via the regular Windows network authentication mechanism. However, if several people share the responsibility of a run, this setup becomes impossible as they would need to devulge their passwords to each other. Hence we have created a local account which can be used by users who wish to share the operation of the Äkta.After logging into Winodws, users still have to log into the Unicorn 7 software, which users do with their university login and password (“Windows authentication”). Using this setup, every user is able to see all methods and results, which is not acceptable.When setting up a new user with Unicorn version Access>Folders") and exactly which folders were accessible by that user and the user would see only his/her own methods and results. Since the folder structure under Unicorn 5 was a folder structure of the Windows file system, users could always copy methods and results from one folder to another and thereby make them available despite the limitations set by the Unicorn 5 program.When I first read that Unicorn 7 supports Windows network authentication, I had hoped that we would be able to avoid the painful user setup which we had to go thru for each user on the Äkta Explorer. However, the pain continues as setting up the user privileges once for a group doesn’t give us user isolation.Firstly, one cannot restrict access of individual users in Unicorn 7, but only access of groups. We had to create one Access Group for each network user, add the network user to this group, create a separate home folder for the group and then restrict the folder access to this home folder. Hundreds of clicks were required for a handful of users since the default is no access to anything and every single privilege check box needs to be enabled except for the admin privileges.In that respect, Windows (and every other OS) is way smarter than Unicorn. If a university employee logs into a machine that he or she has never been logging into before, it creates all the necessary default local folder structure automatically and mounts that users private home folder without granting access to everything other employees have been doing on that specific machine. I think that should be an option on Unicorn as well. Maybe it is and I just can’t figure it out?Another big drawback of the above described method of separating each user into an own access group is that login into the Unicorn program becomes a major ordeal: In addition to writing user name and password the user has to select the correct access group for the login to be successful. And even worse: In our setup we cannot avoid that every university employee belongs to two access groups: A manually created access group for each user for user separation and the “default” which works via the Windows network authentication - maybe Kerberos?). Hence, if users do choose the default access group (which is called “Users” in our case), they are able to log in, but they don’t see their methods and results.There are two reasons we cannot delete the “Users” access group: One is the mandate of the faculty and secondly (and we have tried), we cannot delete it anymore as many people have already created methods and generated results being in the access group “Users”. Thus UNICORN prevents us from deleting this account. I am working on this problem: I should be able to access directly the underlying MS-SQL database in order to change the ownership of the methods and results. However, GE was not exactly forthcoming when I was asking about access right handling. The answer was:The DB access credentials in a standalone UNICORN solution are encrypted and are not public. If you had an enterprise solution (hosting your own (SQL server) DB) you would have control of the credentials and in theory you could extract the wanted information (the format is something that you have to figure out by yourself and is not supported by us). You can upgrade your solution to an enterprise if you want.This sounds worse than it is, because we have physical access to the MS-SQL server and pulling out the access credentials seems not very difficult. But it takes my time to find the exploit to “break into our own system” and that is what annoys me. However, according to Lisa Bromark from GE, the 7.0.2 update seems to correct this issue:UNICORN can be configured to use a new database password. It is possible to generate an encrypted password or to enter an already encrypted password. This is done by running the UNICORN Service Tool after UNICORN installation.However, it is unbelievably difficult to get the update (at least it seems to take weeks). Distribution is apparently still via optical media and snail mail. I think the last time I got myself software via a CD/DVD was more than 10 years ago. However, GE told me that they are just moving UNICORN software updates to “electronic distribution”. Welcome to the 21 century!

Good leadership?

Mon, 02 May 2016 00:00:00 +0000

When I started as a principal investigator at the University of Helsinki , I was advised to take the “Good leadership” course which was arranged by Personnel Training . Together with 14 other research group leaders, I learned between November 2013 and March 2014 from Sanna-Marja Heinimo and other experts i.a. the “skills for effectively developing, coaching, empowering and leading others to getting best results”.At the end of the course, we had a dinner with Jukka Kola , who is now credited for implementating the extensive (and according to many observers overboarding) cost savings that were forced upon the university by the budget cuts mandated by the prevailing political powers.I do not want to discuss here whether such drastic measures were necessary or a less extensive savings strategy would have been sufficient. Even the decision whether to save or to practise deficit spending in an economic downturn is mostly not based on facts but on ideology. In economics, fashion and Zeitgeist are at work in addition to hard data. Therefore, it is not surprising that prominent economists are holding opposing views concerning the effects of deficit spending. But I go off on a tangent here…I simply wanted to express my total disappointment. Not in the savings themselves, but in the way HOW the savings were implemented in relation to the “good leadership” practises that we have been advised to practise.The decisions were not sufficiently openly discussed. Still now, the grounds for many lay-offs remain incomprehensible and controversial (see e.g. this article in the major Finnish daily newspaper Helsingin Sanomat). Since transparency was noticeably absent, the talk about good leadership by the top management of the university seemed to have been hardly more than lip service. I do not doubt that they have the best intentions in mind for the greater good of the university. Just who defines the greater good? Most oligarchs define it themselves, don’t they?So it is not surprising that in the recent workplace well-being survey, the satisfaction with the strategic leadership at the university level (rectors and vice-rectors) was at an all-time low. If the polls would be repeated now, the results would likely be much worse, especially if the fired people would still get a voice. Notably, it is not only the average employee of the University of Helsinki, who does not trust the leadership any more. My feeling is that the distrust now pervades researchers at all career stages. What future is possible with such a constellation?Google is consistently named among the best American companies to work for and they decided to spend millions of dollars and many years to research how to create the best work teams. The single most decisive factor in determining the innovation outcome, creativity and productivity of a team was psychological safety ( see this NYT Magazine article ). Guess how safe university employees are feeling at the moment.When we were talking with Jukka Kola, I was very impressed with his clear commitment towards increased internationalization at the University of Helsinki. However, I already wondered back then how realistic the goal to “actively recruit top international staff” is. Now it seems even more unlikely that this goal can be reached to a meaningful degree since universities start to experience a new wave of brain drain. Even at the students’ level, where the internationalization has made amazing progress in the last 20 years, we might see a decline with the introduction of tuition fees for non-EU/ETA students .

The logic of the Äkta Avant fraction collector

Mon, 02 May 2016 00:00:00 +0000

After we solved all the [teething troubles with our Äkta Avant]((/en/akta_avant), we finally dare to let customers use it. Our customers are very heterogeneous covering complete novices to FPLC and experienced Äkta Explorer users (and everything in between). When we have been giving feedback to GE, our perspective is obviously biased towards a certain type of user. However, taking care of customers is giving us now a new perspective since we get confronted with the usability problems that they cannot solve by themselves. Here I just want to mention one stumbling stone, that has repeatedly brought up to us: the rationale behind the operating mode of the fraction collector. Unlike in the older systems, the fractions collector cannot be manually reset to “First position” or to any arbitrarily defined position as was possible e.g. under Unicorn 5.It took us ourselves quite a while to get used to the internal logic of the fraction collection process and we needed guidance from GE. The fact that the system is not behaving intuitively is underlined by the fact that some of the answers that we received from GE experts were incomplete (leading for us to some unpleasant sample losses). Finally we received from GE support a table that describes the behaviour of the fraction collector (see below). However, even that table is incomplete and we have added a few lines that describe some non-standard situations for which the table does not provide an answer. These changes and additions to GE’s description have been marked in red.

HiLoad 26/60 Superdex pg gel filtration chromatography column performance

Mon, 11 Apr 2016 00:00:00 +0000

The most common protein purification technique that we use is gel filtration (also called size exclusion chromatography). In gel filtration, proteins are separated by their size (or more correctly by their “Stokes radius”, which is largely determined by their size and shape). For gel filtration of large protein amounts, we bought GE Healthcare’s HiLoad 26/60 Superdex 200 prep grade about 9 years ago (the 26/60 has been replaced by HiLoad 26/600, but both are almost identical). With this column you can very cleanly separate two proteins that have a size difference of 100%. Therefore it is suitable to separate monomeric from dimeric versions of the same protein. The columns “expiry date” was 2012-03. Our experience is that under proper handling, such a column can easily reach a life span of 10 to 15 years (we don’t use it very often, we store it in 20% ethanol, if we don’t need it for longer periods of time, we keep it at +4°C).

Python for Kids (and bioinformaticians)

Sat, 12 Mar 2016 00:00:00 +0000

I started to teach my son programming and we both are enjoying it. First we did a bit of html/php since he wanted to make an online quiz on his website, but now we started to work through the (German) book “Python für Kids” ( http://python4kids.net ). I chosen Python because it’s a modern, easy-to-read language, and nowadays probably the most popular first choice for starting programmers. It’s open source, easy to install on any system and you can get write powerful programs after a short learning period. Python for Kids uses the Turtle module, which enables a graphics-oriented introduction into programming. The graphics on the left is one of the results. Another very useful Python teaching resource for kids is Code Club .Python is also a very good choice for biologists and bioinformaticians, but since it is a multi-purpose language, you don’t limit yourself to certain tasks. There is Biopython , which is a very good toolset for the handling of DNA and protein sequences and even 3D structures.

How much PCR product can you get?

Thu, 10 Mar 2016 00:00:00 +0000

How much PCR product does one get from a typical PCR reaction? 50-120 ng/µl seems to be a typical result, but it very much depends on your PCR conditions. If you need to minimize your primer concentration to maximize specificity, your yields can be significantly below that. Vice versa, if specificity is not an issue (e.g. for some PCR clonings), you can get many times more.Let’s consider the typical maximum amount of a single PCR reaction, which is 100 µl. And let’s assume we do not have specificity issues and therefore we can use large amounts of primer (1 µM each) and dNTPs (0.2 µM). Since the synthesis of every molecule of double-stranded PCR product consumes one primer, the theoretical maximal molar concentration of double-stranded (ds) DNA product is the same as your primer concentration: 1 µM. 1 µM dsDNA would equal 100 pmol for a 100 µl PCR reaction. How much is that in micrograms? That is of course dependent on the length of your PCR product: e.g. 100 pmol dsDNA of 1000 bp is equal to 66 µg.Can you really get that much? Not in our example of a 1000-bp-product. The reason is that the building blocks of the DNA, the dNTPs, become exhausted long before the primers do. For the 1000 bp product, only 40% of the primers are used up when the dNTPs run out (assuming a GC to AT ratio of 50:50 in your amplicon). To make one molecule of a 1000 bp dsPCR product, you need about 2000 molecules of dNTPs. For our example, a 400-bp PCR product would therefore be optimal as both primers and dNTPs get exhausted at the same rate.It seems that if you want to get larger amounts of longer PCR products you would need to increase the dNTP concentration. However, in our example of a 1000 bp product, the theoretical maximal amount of PCR product is about 26µg, which is massive and sufficient for most applications. There is an online calculator, that lets you play around with primer and dNTP concentration and product length: http://www.bioline.com/us/media/calculator/01_14.html

Review of GE Healthcare's Äkta Avant 25

Wed, 02 Mar 2016 00:00:00 +0000

About one year ago, we secured funding in an internal faculty call to replace the old Pharmacia Äkta Explorer 100 FPLC machine of the Protein Production and Purification core facility . The Äkta Explorer had been purchased in 1996(?) when the Swedish brand Pharmacia still existed. In 2014, the worse case scenerio happened and both monochromator and Xenon flash lamp broke almost simultaneously, which left us with a bill of almost 10000€. Hence we wanted to replace the machine with a contemporary model. There are only two companies offering serious devices in this space, which is GE Healthcare ( Äkta product line ) and BioRad ( NGC product line ). GE Healthcare inherited the Äkta brand from Pharmacia via multiple mergers, while BioRad is a relatively new contender with their NGC models, which they released only a few years back.We opted for the Äkta Avant 25 . We definitely wanted to have a cased, refrigerated fraction collector. And we wanted to have a familiar user experience. We often run automated purifications and we do not like our proteins to be for longer times at room temperature in open tubes into which bacteria and dust from the air can enter.By now, we have operated the Äkta Avant for about half a year and we have meanwhile a good idea how it compares to the Äkta Explorer. Even though the Avant is more modern than the Explorer, all users of our core facility still use the Explorer. They are familiar with the user interface of Unicorn 5.11 and seemingly have no interest in learning the - admittedly - more complicated UI of the Avant. But the other reason it was only in internal use so far was the fair amount of problems that we have encountered. With our old Äkta Explorer, we have never seen so many problems in such rapid succession. I don’t know whether our situation is typical (according to GE Healthcare’s representatives it is not). Nevertheless, here are the issues that we encountered:

The Jeltsch Laboratory

Sat, 23 Jan 2016 00:00:00 +0000

My laboratory’s web pages at the University of Helsinki

Centrifugal and centripetal embryonic lymphatic development

Tue, 19 Jan 2016 00:00:00 +0000

Since the beginning of last century, researchers have been arguing about the embryonic origin of the lymphatic system. Some claimed that it is in its entirety an outgrowth from blood vessels (so-called centrifugal hypothesis with Florence Sabin and Louis-Antoine Ranvier as early proponents, this mechanism of growth is called “lymphangiogenesis”). Others maintained the view that the lymph vessels do form newly from precursor cells in the mesenchyme (so-called centripetal hypothesis with George Huntington and Charles McClure as early proponents, this mechanism is called “lymphvasculogenesis”). This controversy has been going on for more than a century and several published studies within the last years show, that the truth lies somewhere in between both views. Such synthesis had been proposed already in 1932 by van der Jagt. Kenny Mattonet and myself wrote a short update on the topic and you can read the English version or the German original .

FPLC Protein purification course

Mon, 04 Jan 2016 00:00:00 +0000

Eight postgraduate students registered for the FPLC protein purification course , which took place in December. If I learned anything, than that protein purification during a course should be done ALWAYS with a protein and a protocol, that has been used before successfully MANY times. Student-provided proteins are a great source for learning, but the time restraints of a course format did not allow us to finish the purification of these proteins during the course.Technical Problems with the new Äkta Avant 25In addition, the Äkta Avant 25 , that we newly purchased from GE Healthcare this summer, broke TWICE during the course. First the controlling computer broke (RAID failure). HP delivered the replacement drive within 24 hours and after the RAID had rebuilt itself, we could continue the course. However, during the first run after this incident, the Äkta ran into an overpressure problem. We identified a faulty flow restrictor as the cause, but we did not want to continue as we have had severe problems with air bubbles in previous runs. Therefore we performed the runs on the old Äkta Explorer 100 . GE Healthcare quickly had their service engineer check out the system, but since he did not have a spare with him, we had to wait until Monday 14.12. until the Äkta Avant was again fully functional.What we purified: soluble VEGFR-3 (VEGFR-3/Fc) and HepsinWe did purify soluble human VEGF receptor-3 (the first three domains of its extracellular domain connected to the constant Fc part of human IgG). This is a purification that we have done many times. It is equivalent to the purification of antibodies using Protein A sepharose.We had prepared in advance conditioned cell culture medium. We produce most of our proteins in insect cells (mostly Drosophila S2) and the VEGFR-3/Fc had been secreted by the S2 cells into the medium after induction of the metallothionein promoter with 1 mM Cu2+ for about 4.5 days. The preparation of the medium for purification consists only of 1) getting rid of the cells by centrifugation and 2) filtration to remove precipitates and other small particles that might clog the column. There is no need to adjust the pH.Rapid neutralization after low pH elution IS IMPORTANTWe ran the medium over a disposable 5-ml HiTrap recombinant Protein A column over night at about 1ml/min and eluted with a low pH buffer. The eluted 2-ml fractions were immediately neutralized with 400µl 1M Tris pH 8.5. Here we made a small mistake during one of the two purifications. GE Healthcare had not released the casettes for the 5-ml-collection tubes (they still have not done so even though they did promise them already for September 2015) and we used 15-ml Falcon tubes to collect 2-ml fractions, into which we had pre-aliqotted 400 µl of the neutralization solution. However, the mixing in these tubes was not efficient and the prolonged exposure to low pH resulted in a partial damage to our protein. This can be seen when comparing the size exclusion chromatograms of Group 2 versus Group 4: For Group 4 the first peak (aggregated protein) is much larger and more heterogenous compared to the same peak for Group 2.In fact, when VEGFR-3/Fc is eluted by low pH from protein A columns, it always precipitates at higher concentrations soon after elution, but dissolves again upon neutralization. This did not happen in the fractions 5.A.3 and 5.A.4 (Group 4) due to the inefficient mixing of elutate and neutralization buffer in the 15-ml-Falcon tube (the fraction size of 2 ml was probably to blame as well; 1 ml would have been better). During the run for Group 2, we removed the tubes immediately after the run had ended and thereby mixed the buffers, while for Group 4 the run finished during night time and the eluate remained largely unmixed until the morning.Alternatively, we could have eluted with a highly concentrated chaotropic salt at near-neutral pH (which we’ll do next time in case we have an automated run where the elution happens in the middle of the night). Pierce offers a (proprietary) “gentle” elution buffer of pH 6.6. I don’t know the Pierce buffer composiiton, but it is a highly concentrated solution of some chaotropic salt. 3M potassium/sodium thiocyanate or 4M magnesium chloride in buffered solutions around pH 7 are frequently used chaotropic salts for this purpose.HepsinThe student-provided proteins were challenging. First, their concentrations in the starting material was very low. While we can see clearly the protein when the VEGFR-3/Fc conditioned medium is run on a PAGE gel and stained with Coomassie, no such band is visible for the Hepsin. In addition, it appeared that a significant fraction of the protein seems not to contain the histag (anymore) and therefore is not captured with the first purification step. The fraction of Hepsin-H6 that does bind to the Ni2+ sepharose elutes already at an imidazole concentration of 20 mM, which makes washing the column challenging. The Hepsin with the longer histag (H10) survives the 20 mM imidazole wash, but it suffers also from low expression levels.Below are the chromatograms of the individual runs and the annoteded images of the Comassie-stained PAGE gels. The detailed protocol for the operation of the Äkta Avant 25 is still under preparation…

SnapGene - Simply the best DNA manipulation software

Fri, 01 Jan 2016 00:00:00 +0000

Our lab has been using different software packages to plan, document and visualize DNA constructs. Among those that we liked a lot for a long time were Textco’s GeneConstructionKit (GCK) and Clone Manager (Professional) . The latter runs unfortunately only under Windows. However, since several of our computers run Ubuntu Linux , we did run GCK versions 2.5 and 3 using WINE (a compatibility layer that allows us to run native Windows programs under Linux). However, with the upgrade to version 4, GCK became unusably slow under WINE and we were looking for a replacement. We contacted the developers of GCK, but they apparently were either not willing or able to help us. I suppose that the codebase of GCK is probably more than 20 years old and for that reason nobody dares to touch it. Just around that time, SnapGene was released and it fulfilled almost all of our requirements:

Know your rights

Thu, 19 Nov 2015 00:00:00 +0000

In a series of articles in the magazine Acatiimi , Mia Weckman from the Finnish Union of University Researchers and Teachers (FUURT) was introducing the Finnish legal system and legislation concerning the work place. This series was specifically aimed at foreign new employees and written in English and is therefore one of the few sources of information if you don’t know the Finnish language. However, let’s keep in mind that paper and displays don’t blush. Many of the rules were developed and are well suited for work traditional work places but less so for academic research, which flourishes best when driven by enthusiasm and devotion and not by duty. Nevertheless, since we are far from that ideal, you should know your rights. Here are the topics and the links:

Top 8 Science Podcasts to Listen to

Wed, 11 Nov 2015 00:00:00 +0000

My top 8 podcasts targeted at scientists (but not only for scientists). Try them: they are entertaining and keep you up to date with what’s going on in science generally. If you focus on your narrow field of expertise, you’ll become narrow-minded. Many leading science magazines have jumped on the podcast band wagon (e.g. Science Magazine Podcast , Nature Podcast ), but I mostly enjoy the genuine podcasts, that established the science podcast genre. There’s a limit to what one can listen to (for me that’s one hour a day during my cycling commute) and I include a few that I like listening to, but that don’t make it into my regular schedule at the moment. In the order of decreasing personal preference:

Being indexed

Tue, 03 Nov 2015 00:00:00 +0000

There are many databases storing and analysing scientific publications . “Being indexed” or “being listed” simply means for a journal that one of these databases includes the articles that are published in this journal. Importantly, several of these databases also include citation data for each article; therefore they are often referred to as journal citation databases. Since there are many such databases, virtually every journal is “listed” somewhere and if you want to get your journal listed, there are several guides out there, e.g. Getting your journal indexed . However, in the life sciences, there are a few databases that are substantially more important and authoritative than others. The big three are MEDLINE , Web of Science and Scopus . How are these three databases different? Clearly, the most important journals are covered by all of them. But less important journals and journals that publish in non-English languages might be only listed by one or two of the three. The databases have different journal selection criteria (see below) and the selection is subject to constant change.MEDLINE MEDLINE is a non-commercial database that is maintained by the US-American National Library of Medicine and the selection of journals happens under NIH -oversight. MEDLINE and especially its online portal PubMed are exceptional due to their free accessibility for everybody. In fact, PubMed is probably the only transparent academic bibliographic database that can be used for free by everybody to research life science literature. MEDLINE currently indexes 5620 journals.Web of ScienceThe Web of Science comprises several databases and they used to be maintained by the Institute of Scientific Information (ISI), before it was sold to Thomson Scientific & Healthcare (nowadays Thomson Reuters ). The ISI was founded by Eugene Garfield , who is considered to be the father of bibliometrics and scientometrics . The Web of Science currently indexes 13762 journals (combined Arts & Humanities, Expanded Science and Social Sciences Citation Indexes).ScopusThe other commercial journal database is Scopus , which is owned by Elsevier , the largest publisher of scientific journals. Scopus is the largest of these three databases covering many more journals than the other two. According to some, this is due to the somewhat loosely applied journal selection criteria ( http://www.issi2015.org/files/downloads/all-papers/1198.pdf) . There has also been some discussion about the independence of the journal selection for commercial databases. After all, according to a study published in PlosOne, five companies control more than half of all academic publishing, with Elsevier dominating at about 25% of the market ( http://dx.doi.org/10.1371/journal.pone.0127502) . Scopus indexes currently over 22000 journals.People have been comparing databases and citation counts (e.g. here ). One database, that I have been omitting is Google Scholar . Even though the free accessibility of Google Scholar and its broader approach to measure impact have advantages as opposed to Web of Science or Scopus, Google Scholar is - similar to the general Google search engine - not very open about what journals and sources its search covers. In my opinion, this is a big draw-back, but on the other hand Google probably constantly has to tweak its algorithm to avoid exploitation. If you want to know more about Google Scholar as a citation database, I recommend this article . Journal ListsMEDLINE: ftp://ftp.nlm.nih.gov/online/journals/lsi2015.xml,http://www.ncbi.nlm.nih.gov/nlmcatalog?cmd=historysearch&querykey=1 (currently indexed)http://www.ncbi.nlm.nih.gov/nlmcatalog/?term=reportedmedline (all)Web of Science/Thomson Reuters: http://ip-science.thomsonreuters.com/mjl/Scopus : https://www.elsevier.com/__data/assets/excel_doc/0015/91122/title_list.xlsx Journal selection criteriaMEDLINE: https://www.nlm.nih.gov/pubs/factsheets/jsel.htmlWeb of Science/Thomson Reuters: http://wokinfo.com/essays/journal-selection-process/Scopus : https://www.elsevier.com/__data/assets/pdf_file/0006/95118/SC_FAQ-content-selection-process-22092014.pdf

This year's Nobel prizes

Mon, 12 Oct 2015 00:00:00 +0000

Three of this year’s nobel prizes were given for topics we work on: The prize in Medicine was shared by Youyou Tu and William Campbell/Satoshi Ōmura. Campbell and Ōmura received their share for the development of an anti-parasite drug that is effective against roundworms (nematodes), which are the cause of river blindness, lymphatic filariasis and a few other diseases. Nematodes, that cause lymphatic filariasis (like Brugia malayi) are living in the lymphatic system. Many nematodes do express a VEGF-C-like molecule, but the function of this parasite-VEGF-C for the nematode’s life cycle has never been looked at.The prize in Chemistry was shared by Tomas Lindahl, Paul Modrich and Aziz Sancar for their mechanistic studies of DNA repair. We are right now experimenting with such mechanisms, especially the cytidine deamination, which we exploit in order to generate mutations on demand. When cytidine is converted into uracil (which can happen spontaneously or mediated by an enzyme), the enzyme Uracil-DNA glycosylase (UNG) removes the uracil base. Then another enzyme (apurinic/apyrimidinic endonuclease) cleaves the backbone 5’ to the abasic site and DNA polymerase beta excises the abasic sugar phosphate residue and inserts a cytosine thus repairing the damage.The third prize is the one in Economic Sciences, which went to Angus Deaton. “He pioneered the analysis of individual dynamic consumption behavior under idiosyncratic uncertainty and liquidity constraints.” (from the Advanced Information PDF by the Royal Academy. I freely translate: He researched how peoples ‘spending behaviour changes in the face of irregular and insufficient income. That describes quite well our lab’s financial situation and we indeed work on that issue, because science without money doesn’t work.

Difficult start

Wed, 26 Aug 2015 00:00:00 +0000

UPDATE: I asked the Academy for the funding rates for the Academy Professor positions, but there are so few of these positions that you don’t get any usable statistics out of that data. I received a very transparent answer from the Academy (including the numbers I was asking for). The decision to preferentially cut funding from postdoctoral researchers was a conscious one by the Academy to preserve the means to do competitive research for projects and Academy Research Fellows. However, the trend to move funding from younger to older researchers seems to be general and has been going on already for half a century in the US (see e.g. here: http://metamodern.com/2009/11/27/great-science-great-scientists-and-icons/ or here: http://nexus.od.nih.gov/all/2012/02/13/age-distribution-of-nih-principal-investigators-and-medical-school-faculty/) . Our future depends on new ideas and innovations. I am not sure, whether it is true that younger investigators come up with more new ideas and innovations as claimed in the blog post above ( http://metamodern.com/2009/11/27/great-science-great-scientists-and-icons/) , but if that is the case, moving money away from them would a bad idea in the long run.Getting a research position funded by the Academy of Finland is becoming increasingly difficult. What worries me most is the fact that the savings are concentrated at the “lower” end of the academic career ladder: The success rate of applications for the postdoctoral researcher positions has been deteriorating most while Academy projects’ funding remained largely untouched in the Research Council for Health. This Tuesday, the Academy presented these numbers at the Ask & Apply event for this September’s funding call at the Medical Faculty. Academy Research Fellow funding was also stripped down, but much less than the postdoctoral researcher funding. Strangely enough, the slide omits the success rate of applications for Academy professor positions. Is this indicative of a generation conflict, where established researchers are successfully trying to secure the dwindling resources for themselves? I would need to know the application success rate for the Academy Professors and the granted amounts in order to draw any conclusions.

Erkrankungen des Lymphgefäßsystems (Diseases of the Lymphatic System)

Wed, 05 Aug 2015 00:00:00 +0000

The 6th edition of the the book Erkrankungen des Lymphgefäßsystems (Diseases of the Lymphatic System) is out. It’s a German language textbook, for which Kenny Mattonet, Jörg Wilting and myself wrote the fifth chapter (Genetic causes of primary lymphedema). Get it from here , since Amazon still sells the old, 5th edition. If you have a really good excuse why you should get one for free, mail me! I have a few copies.

Neon electroporation device chickens out

Tue, 04 Aug 2015 00:00:00 +0000

UPDATE: We are not the only ones that try to economize on our running costs. This lab published its experiments in with the Neon system in Analytic Biochemistry . Thanks to Joachim Goedhart ( @joachimgoedhart ) for bringing this to our attention! The Neon transfection device from Life Technologies (oops, Thermo Fischer nowadays and former Invitrogen ) was introduced about five years ago to the market. It is designed for easy electroporation of mammalian cells. We have had the device available since 2011, but it was not much in use. I don’t know whether the low adoption rate is due to the user-unfriendliness (I still don’t know how to put the electrode tip to the pipettor despite having done this hundreds of times, it’s just really finicky mechanics), expensive running costs (for its desposible gold-plated electrodes and the proprietary transfection buffer) or something else I cannot figure out.However, there are a few things that I wanted to share because real useful information about the Neon device is scarce on the web.The first thing that we had constant problems with were air bubbles in the electrode tip, which result in desastrously low electroporation efficiencies. The only way to really prevent this is to prepare at least 25% more cell suspension than actually needed. When you prepare only 10% more, the last electroporation will certainly arc due to unaviodable air bubbles (the cell suspension additionally sticks easily to the outside of the pipette tip which contributes to the need to prepare more than actually needed). As a consequence of this, we ran out of electroporation buffer R long before we ran out of pipette tips. Additionally one cannot purchase buffer R separately. The Life Technologies representative with whom I corresponded promised to send us a small batch of pipette tips/buffer in good will (that was in January), but we are still waiting for that to arrive…Unforatunately, recently our old Gene Pulser II electroporation device broke. Bio-Rad doesn’t repair it anymore and also doesn’t provide spare parts. It was mostly used for E. coli electroporation. I knew that the Neon device was not designed to electroporate E. coli. Why not and why can’t it be used for that purpose? It turns out that the electric field strength is by far not enough for E.coli (in the BioRad Gene Pulser II, a typical bacterial electroporation achieves an electrical field of 12.5kV/cm, whereas the Neon barely achieves around 850V/cm. However (I thought), the neon can do much longer pulses than the Gene Pulser II (Neon is advertised to be able to give pulses up to 100 ms, whereas the typical pulse length of the Gene Pulser II is about 5 ms). In addition to this, the Neon can deliver automatically multiple pulses. So I wanted to test whether a long and/or repeated pulse with lower field strength can transform E. coli. However, it appeared that when you use water (or 10% glycerol) as the E. coli transfection buffer (which you usually do), the machine complains the tip electrode doesn’t make contact. This is due to the fact that the machine tests whether you have inserted the tip correctly by sending a small current through the system and that current doesn’t flow if you have resuspended your E. coli in water. In order for the machine to “accept” an inserted pipette tip electrode, you need somewhere between 10 and 20 mM NaCl. So I used 15 mM sodium chloride as E. coli electroporation buffer and set the electroporation parameters to 2500V and 100 ms. Surprise: The machine refuses to give such pulse because it is “Over power limit!”. The maximum pulse length it can deliver with 2500V is 19 ms. Unfortunately even that pulse cannot be given automatically multiple times (again: “Over power limit!”). Therefore I manually executed this pulse between 1 and 20 times, but not a single bacterium received any DNA and all bacterial plates remained blank.The manual states:"The Neon TM device is designed to only input certain values and limits for each value are listed below. If your input value exceeds the maximum value, an error is displayed.Input Voltage range: 500–2,500 VInput Pulse Width range: 1–100 msInput Pulse Number range: 1–10Unfortunately, this can be very easily misunderstood. It was not clear to me that one cannot combine the three parameters within these ranges freely. One should think that Life Technology has better technical writers (but maybe they don’t use the device…)Bottom line: The device is utterly useless for anything but mammalian cells. Also some other interesting applications (e.g. electroporation of nematodes or other small critters) are difficult or impossible. While the machine might be a good choice for many mammalian cells, it’s much more limited than the old-fashioned BioRad Gene Pulser II.P.S.: I used the buffer E to fill the pipette station (for use with 10 µl tips). However, I also tested instead of buffer E a mixture of 90% 150 mM sodium chloride and 10% glycerol (which gives me the same conductivity as buffer E has). However, I still really would like to know the composition of buffer R. Why? Because I think that the tip electrodes can be recycled more often than only twice (other manufacturers of pipette tip electrodes advertise that their electrodes can be recycled many more times (e.g. the BactoZapper , although they don’t give precise numbers either). The Neon manual states that “Oxide formation at the piston surface area can be generated if the tips are used more than 2 times, which decreases electrode function of the piston.” The electode is gold plated and gold should be more resistant to oxide formation than the stainless steel electrodes of the BactoZapper…

Lymphangiogenesis in health and disease

Thu, 11 Jun 2015 00:00:00 +0000

Available Downloads

Get the presentation in PDF format.

Download PDF

Best paper award

Fri, 01 May 2015 00:00:00 +0000

[

![](/sites/]( http://www.med.helsinki.fi/english/news/2015/20150505_Jeltsch.html)We have won Circulation’s 2014 Best Paper Award in the category of Basic Science. Circulation is the leading cardiology journal and the organ of the American Heart Association . Already when we published the paper (titled [/files/files/Jeltsch%20et%20al.%20-%202014%20-%20CCBE1%20Enhances%20Lymphangiogenesis%20via%20A%20Disintegrin.pdf">“CCBE1 Enhances Lymphangiogenesis via A Disintegrin and Metalloprotease With Thrombospondin Motifs-3–Mediated Vascular Endothelial Growth Factor-C Activation”](/sites/<?php print $_SERVER[)), it was clear that it provided a major overhaul of our understanding of the VEGF-C growth factor and it got featured by Open Heart . The article manages to provide multiple new insights:

Follow us on Google+ and support cancer research!

Fri, 17 Apr 2015 00:00:00 +0000

This is an invitation to all of you to follow my lab’s new Google+ pages. This is your chance to support cancer research. You will need a Google+ account to follow us: https://plus.google.com/101997423182393816561

Writing scientific articles in German - a waste of time?

Wed, 08 Apr 2015 00:00:00 +0000

It appears strange to us, but one hundred years ago the lingua franca of science was German. Although my former boss Kari Alitalo had warned me, I wrote in 2013 a two part review about lymphangiogenesis in German and I was shocked to see, that it had not been cited at all since. In order to make it available for a broader audience, we translated it now into English. Given the fact, that the average article gets about 4 citations altogether, we need only to be cited five times to be above average…

Resistance to streptomycin and spectinomycin

Sun, 11 Jan 2015 00:00:00 +0000

Many cDNA clones from the ORFeome gene collection come in a pENTR223.1 plasmid*. To grow these clones most people use spectinomycin because that’s what the antibiotic resistance gene is called in the maps on the ORFeome collaboration and what the protocol requires.However, a thorough look at the literature shows, that the same selection marker should work equally well with streptomycin. Well, what’s the difference? Mainly the price: While 5 grams of spectinomycin from Sigma cost 112.7€ here in Finland (Sigma 85555-5G) , the same amount of streptomycin is only 17,80€, more than 6 times cheaper (Sigma S6501-5G) .The resistance gene in pENTR223.1 is the aminoglycoside adenylyltransferase gene aadA (streptomycin 3’’(9)-O-nucleotidyl transferase; aminoglycoside 3"-adenylyltransferase (AAD(3”)(9); ANT(3”)(9)), which confers resistance to both spectinomycin and streptomycin. However, there are related aminoglycoside adenylyltransferases, that do not confer resistance to both antibiotics, but only to one or the other. Hence you need to know exactly what spectinomycin resistance gene your plasmid carries if you want to replace spectinomycin with the cheaper streptomycin. Plasmid maps are often not helpful: I have seen the aadA gene in pENTR223.1 annotated with SmR (Streptomycin Resistance, like in SnapGene) or SpnR (Spectinomycin Resistance, like in the maps from the ORFeome collection).To experimentally test, whether pENTR223.1 confirms resistance to both antibiotics, I grew an insert-containing pENTR223.1 plasmid in 100µg/ml spectinomycin and 100µg/ml streptomycin and it grew well under both conditions, whereas the untransformed parental E.coli strain (NEB5-alpha) did not grow in either. However, the differences are not always clear-cut when you look at different concentrations of these antibiotics. Streptomycin/spectinomycin inactivating aminoglycoside adenylyltransferases have preferred, but not exclusive substrate specificities. this means that some resistance to a low concentration of streptomycin can be conferred by the aminoglycoside adenylyltransferase that targets primarily spectinomycin (or vice versa). However, in practise, some of them are exclusive enough to justify to classify them as either SmR or SpnR. If you need to know, you can always try it out…The other thing I learned while doing this is that the negative selection marker ccdB DOES NOT work in XL1 Blue, while it does work in NEB5-alpha. Apparently, ccdB does not work in DH5alpha and JM109 either (what’s the difference between DH5alpha and NEB5alpha?).* pENTR-223.1 is also called pDONR-223.1 or pENTR223.1-Sfi due the two SfiI sites flanking the insert. People tend to call the plasmid pDONR before the insertion of the cDNA and pENTR if the plasmid contains the cDNA. However, this usage pattern is not ubiquitous. Upon insertion of the insert (using the Gateway BP reaction) the pDONR223.1 vector looses the ccdB and chlR/CmR selection markers and the resulting backbone is referred to mostly as pENTR223.1.

Lab cam

Fri, 02 Jan 2015 00:00:00 +0000

2-week Lab Course

Tue, 30 Dec 2014 00:00:00 +0000

I had no idea how much work it is to organize a practical lab course. Had I known, Pirjo would have had a much harder time to convince me to give this course for the Doctoral Programme in Biomedicine (DPBM)l . Kari had warned me… The accompanying lecture course had been running from September to November. The practical course had been offered with 16 free slots, but that was totally unrealistic given that we were confined to my 23.7 square meters of lab space. Teaching lab space is available, but without equipment and all the other infrastructure that is needed for such an undertaking. 8 people registered to the practical course and - luckily - half of those pulled out in the last moment with insufficient possibility to commit to the heavy workload that the course required. Thus we ended up with four students and three projects. Under no circumstances would we have managed with more.The idea was to offer each participant the possibility to realize his own DNA cloning and protein expression project. Something that would be relevant for his own PhD studies. For that matter, I had meetings with the three groups one month in advance to plan the cloning and to order the necessary materials. We were working in parallel on the following three projects:

38. Annual Congress of the German Society for Lymphology

Sun, 05 Oct 2014 00:00:00 +0000

I participated in the 38th Congress of the German Lymphological Society ( http://www.dglymph.de/ ) in Halle (Saale). The conference was very refreshing and interesting: It was very different from the meetings I typically attend because it was focussed on the practical aspects of clinical and ambulant management of diseases that involve the lymphatics. Because my talk was an introductory lecture about lymphangiogenesis research, it did not contain any unpublished data and hence I make it available for download. However, the slides are in German and - depending on the target audience - might require some commentary. The talk is a chronological account of the important publications in the field of lymphangiogenesis research starting from about 20 years ago; heavily biased towards my own work and work in which I have been participating.

New Mechanisms of Lymphangiogenesis and Lymphedema

Fri, 26 Sep 2014 00:00:00 +0000

Here is the presentation that I could not give, because my schedule was too tight to allow for a 1 hour 20 minute delay. If you have questions concerning the talk, please ask via e-mail: michael@jeltsch.org.My Lufthansa flight LH855 from Helsinki to Frankfurt got delayed by 1 hour 20 minutes. Because I had only 1 hour 15 minutes to change my plane in Frankfurt on my way to the 40th Congress of the European Society of Lymphology in Genova/Italy, I did not even board the plane and rather canceled my talk. Because I have another appointment on Saturday in Germany, I had planned the return flight for Friday early morning and hence could not move my talk either. Next time I’ll be smarter.

Practical Molecular Biology and Genetic Engineering

Mon, 08 Sep 2014 00:00:00 +0000

Collection of the presentation slides for the DPBM course Practical Molecular Biology and Genetic Engineering . There are files in (at least) two different formats for each lecture: PDF and ODP (Open Document Presentation). The ODP file is editable using LibreOffice software. If you want to open it with Microsoft Office, you need to convert it first using either LibreOffice or some online conversion tool (like cloudconvert ). All material is available under the creative commons license . I might add improved versions of the lecture slides later based on participants’ feedback. The slide about restriction enzymes (REs) and how to calculate the necessary RE amounts to digest a certain amount of DNA is in the file of Lecture 1.

Fiddling around with CSL

Wed, 06 Aug 2014 00:00:00 +0000

When writing manuscripts and grant applications, you always and again have to update the bibliography. This is what reference management systems are for. There are many of them (see http://en.wikipedia.org/wiki/Comparison_of_reference_management_software) . I have been using mostly EndNote, Bibus or Zotero ( http://www.zotero.org ), which I am using also at the moment. It has the advantages to be truly cross-platform, open-source and compatible with both LibreOffice and Microsoft Office. In the past, I have also been using for a short while Papers (by Mekentosj, who claimed they NEVER would do a Windows version), Bookends, Mendeley, and RefWorks (which is licenced by my university). None of them is perfect and even the most commercialized of them (Endnote, now owned by Thomson Reuters) destroyed one of my (MS Word) manuscripts totally when it crashed. Some of these programs store the formatting instructions for inline citations and the bibliography in the so-called CSL (Citation Style Language, an XML-type language, http://en.wikipedia.org/wiki/Citation_Style_Language).However , I could not find an easy editor for CSL: the in-built one from Zotero is not great, neither is the online CSL editor ( http://editor.citationstyles.org/visualEditor).However , I needed a way to quickly export my own published papers to create a “List of Publications” for grant applications. Hence I created a group in Zotero and added all my own publications into this group. I now mark them all, right click and select “Create Bibliography from items”. In the pop-up dialog, I choose the style and mark the radio-buttons “Bibliography” and “Copy to Clipboard”). Back in my word processor I just have to paste the clipboard and I most of the work is done. However, I could not find any good style for this, so I created one myself (which is based on Vancouver). Feel free to use it…

From the molecular biological foundations to causal treatment options for diseases of the lymphatic system

Tue, 22 Jul 2014 00:00:00 +0000

PD Dr Michael Jeltsch, University of Helsinki, Finland

Research into the molecular basis of lymphangiogenesis in embryonic development and pathological processes has led to a rapid expansion of our knowledge (Krebs and Jeltsch 2013a, 2013b). The molecular biology era of lymphatic research began with the discovery of VEGF growth factors and their receptors 25 years ago. This review therefore focuses on these molecules.

The case against FastDigest®

Wed, 25 Jun 2014 00:00:00 +0000

Restriction enzymes continue to be important

In 2006, the innovative Lithuanian biotech company Fermentas launched a new product line for molecular biology researchers: the FastDigest restriction enzymes. Together with the polymerase chain reaction (PCR), restriction enzymes (REs) are arguably the most important tools in molecular biology. They made recombinant DNA technology possible in the early 1970s. Until every lab can afford a reliable DNA laser printer (which is probably still a decade away), restriction enzymes are the tools of the trade. Novel cloning techniques (like In-Fusion , Gibson Assembly or SLICE ) have their place, but still lack the robustness of traditional restriction enzyme cloning.

We got featured by Circulation!

Mon, 12 May 2014 00:00:00 +0000

The molecular basis of Hennekam syndrome

Thu, 20 Feb 2014 00:00:00 +0000

Finally our CCBE1 manuscript is out! You can access it from the Circulation’s homepage . If your library does not have a subscription, just drop me an e-mail . It nicely complements the article by Le Guen et al. from Ben Hogan’s group in Development. While Le Guen and colleagues analyzed the interaction of CCBE1 with the VEGF-C/VEGFR-3 pathway mainly at the genetic level in zebrafish, we tried to describe the molecular details of the interaction using in vitro assays which we complement with in vivo mouse data. We describe that the primary lymphangiogenic factor VEGF-C is produced as an inactive precursor (pro-VEGF-C). Pro-VEGF-C (that is the 29/31-kDa-form) does bind to VEGFR-3 on endothelial cells, but is unable to activate it. Until now, the common wisdom was that pro-VEGF-C is only a less potent activator of VEGFR-3 than mature VEGF-C. In fact, it actually acts as a competitive inhibitor of mature VEGF-C. The task of CCBE1 is to assist the ADAMTS3 protease in cleaving cell-surface bound pro-VEGF-C and thus to localize the concentration of active VEGF-C. In hereditary diseases that are caused by mutations in CCBE1 ( Hennekam syndrome ), this activation of VEGF-C is impaired and causes lymphedema. Because of the importance of lymphatic vessels in many diseases, CCBE1 and ADAMTS3 are interesting drug targets. In cancer, for example, it would be a tremendous benefit if one could prevent the activation of VEGF-C and thus prevent VEGF-C-mediated metastasis.

SVS or lymphatic system?

Sun, 26 Jan 2014 00:00:00 +0000

In 2003, I wrote a review article about the lymphatic system , in which I briefly discuss the general setup of the lymphatics in different animals and I got the part about the lymphatic system in fishes wrong. Or at the very least it was incomplete.While mammals, birds, reptiles and amphibia are quite easily defined animal classes, there is no animal class “fishes”. Different ways exist to classify “fishes”, but at least three animal classes are needed to accommodate the living “fishes”: cartilaginous fishes, ray-finned bony fishes and lobe-finned fishes. Almost all research on the lymphatic system of fishes had been done on teleost fishes (one of three infraclasses of the ray-finned bony fishes). Teleostei comprise most of the living fishes including the mostly studied zebrafish (Danio rerio) . So everything that follows is about this infraclass (and hence might not apply to sharks and sturgeons to name just two non-teleost fishes).

Historic articles about the lymphatic system

Sat, 25 Jan 2014 00:00:00 +0000

Permission to self-archive

Tue, 21 Jan 2014 00:00:00 +0000

Thanks to Jörg Wilting , I finally received permission from the Deutsche Gesellschaft für Lymphologie (German Society for Lymphology ) to self-archive two review articles that I have been writing last year for the journal Lymphologie in Forschung ind Praxis . This is important, because otherwise, the impact sphere of the review would have been very limited. The first article discusses the molecular main players of lymphangiogenesis: VEGF-C and VEGF-D and their functions in embryonic lymphangiogenesis. The second article tries to summarize the roles that VEGF-C and VEGF-D play in diseases that are affecting the lymphatic system.

Being the boss

Fri, 01 Nov 2013 00:00:00 +0000

Almost accidentally, I got promoted. I am now a principal investigator or group leader. I never have been especially keen on being the boss. There are enough cushy and mediocre PIs in this world and my (now former) boss Kari Alitalo with his level of devotion and excellence is a shadow probably impossible to step out of.Nevertheless, before I was too old to apply for a group leader position from the Academy of Finland , I decided in 2011 to give it a try. I might regret if I never even tried. The first attempt failed. One year later, my PhD was 9+ years old and I had to pledge special reasons to be able to compete again (I had taken long childcare time-outs for both of our children). Although I essentially submitted the same application I got lucky this time in what has been described by someone as the “Academy Lottery”.And my worst expectations became reality: Instead of doing research I mutated into a money acquisition machine. That is partly due to the Academy giving substantially less funding than I applied for. Every year the Academy has less and less money to distribute and faces the tough decision to fund fewer researchers or to fund the same number of researchers, but give everybody less… I once had an email conversation with Alexander Stubb (when he was still approachable for ordinary people like me) about the declining budget for research, but at least the present Finnish government seems to underestimate the long term effects of the continuously deteriorating financial situation of academic research in Finland. The situation is so bad, that most talented people are leaving this country at the first opportunity.Due to the full cost model , I am practically forced to stick to the budget when it comes to the labour cost. And that’s why there’s no money left to pay for the day-to-day expenses like chemicals and reagents. Until one of my grant applications is successful, we’ll have to do research on a shoestring budget…BTW: My lab’s new web pages hosted by the university’s servers are still not up. But since they’re ready, I put them up on my own server .

Stripping

Fri, 01 Nov 2013 00:00:00 +0000

Reprobing membranes with with a different antibody is a very common task in the lab. Various protocols exist to strip membranes and the classic method is the one that uses SDS, β-mercaptoethanol and heating. I used to do it that way, but it’s a smelly business, because β-mercaptoethanol smells like rotten eggs. Then suddenly everybody in the lab started to use the Re-Blot Plus Solution from Millipore and so did I. Until I realized by chicking the Material Safety Data Sheet that they sell cheap chemicals for a premium price. Now I make the stripping buffer myself. My 10x solution has the following composition:

A Nobel Prize for angiogenesis research?

Sun, 27 Oct 2013 00:00:00 +0000

In 2008, during a dinner in Stockholm (when I participated in the Novo Nordisk Foundation 8th Annual Conference on Vascular Biology in Diabetes Complications) I proposed to Christer Betsholtz to award the Nobel Prize to the world-wide community of postdocs, which are the unsung heroes of today’s research. But the Statutes of the Nobel Foundation forbid to award the price to more than three people. However, statutes can be changed and the Nobel Foundation did exactly that 40 years ago when they stopped awarding the price to dead people. And in this changing world, less and less discoveries and inventions are made by individuals. But here’s my newest proposal, which adheres to the rule of maximally three: Kari Alitalo is probably the only Nobel Prize worthy researcher in the country where I work (Finland). Seriously: after Judah Folkman has passed away, there are not many options to award the prize to somebody from the angiogenesis field. Judah Folkman was the father of the hypothesis, that all tumors should be treatable by anti-angiogenesis ( Folkman J. Tumor Angiogenesis: Therapeutic Implications. New England Journal of Medicine. 1971;285(21):1182–6 ). The Nobel Prize committee missed that chance. And because the field has already significantly contributed to the treatment of cancer (and arguably will still contribute much), it is not so far off to think of a shared prize for the discoverers of the VEGFs. VEGF was discovered more or less independently by several research groups around 25 years ago, among them Napoleone Ferrara ’s and Harold Dvorak ’s. Most notably, Ferrara’s group at Genentech continued the research most successfully until today resulting in the first antiangiogenic cancer drug in 2004. While the discovery of VEGF and the resulting angiogenesis research was not dependent on any single lab, the lymphangiogenesis field was essentially single-handedly re-invented and brought into the molecular era by Kari Alitalo in the years following 1995 - after it had become senile and was lingering without any significant progress since the 1960s. A shared prize to Ferrara, Dvorak and Alitalo? There is an anti-VEGF-A cancer drug on the market and the only thing lacking is a successful anti- or pro-VEGF-C drug. Both are in clinical trials as of this writing ( anti-VEGF-C , pro-VEGF-C ).

Self Archiving and Open Access

Sun, 07 Jul 2013 00:00:00 +0000

I recently wrote a review article for the journal Lymphologie in Forschung ind Praxis . Its title was “Die lymphangiogenen Wachstumsfaktoren VEGF-C und VEGF-D” and it was the first paper I wrote in my mother tongue, German. This journal’s impact factor has been consistently below 1, which is not uncommon for non-English journals. However, in the big European countries like Germany, France and Italy, there are still many doctors who are not comfortable reading English. I though I’d help them out catching up on the latest in lymphatic research. Opening up access to science and visibility of science is all good, so I thought.Because my boss argued that it was a waste of time (I hope to prove him wrong - help me out here DLG !), I minimized the effort by engaging another knowledgeable German researcher at the University of Helsinki. Luckily I had already a draft when I was asked to write the review, even though I started to write it about two years ago and it was targeted for my website. When the article was published I received two physical reprints. When I tried linking to the online version of the article, I had to realize that it was behind a paywall . Because most publishers nowadays support self archiving , I asked the publisher about their policy. I presume that the publisher did not have any policy in place concerning self archiving, because they said they would agree to it, but I would have to get the green light from the board of directors of the DLG .I really hope to get this permission because this is the only way I can fulfill reprint request without hassle (yes I could copy the pages and send them by post (but aren’t we living in the 21st century?). If I won’t get the permission, one legal and easy way to distribute this article would be to put a pre-print version (i.e. the manuscript that I wrote) online. Luckily the copyrights of the publisher cover only the published version and not the pre-print versions. Others have done it this way (and they attached a list of the changes, that were made to make the pre-print version identical to the published version). This is a suboptimal solution, but maximizing accessibility and visibility. My University has a loose requirement to publish only in Open Access journals. However, exceptions to this policy of the University of Helsinki concerning Open Access are made on a regular basis, but they will get more and more difficult as the EU tightens their funding policy including the requirements for Open Access to research results . According to the EU’s interpretation, a journal could be considered Open Access if it allows for self archiving of the published article, self archiving being the second, “green” route to Open Access. The Academy of Finland (my main funding source) has a similar interpretation: “We further recommend that Academy-funded researchers publish their articles in open-access scientific journals, if there are online journals in the field in question that are at least of the same high quality as traditional subscription journals. The articles can also be saved in open-access electronic archives.” For employees of Helsinki University, self archiving is mandatory since 2010 .That makes sense to me: As a scientist I work with tax payers’ money; therefore all tax payers should have access to the results of my work. Even though I worked for this review only in my spare time, technically the requirements still apply as I used a computer, that was paid with tax payers’ money… Stay tuned and if you need the article now (and don’t want to wait for the DLG to decide), please e-mail me!

Academic Portfolio 2013

Mon, 27 May 2013 00:00:00 +0000

Below my updated Academic Portfolio in PDF format. Since it is public, I had to black out confidential information concerning ongoing confidential collaborations and my research plans.

Lymphangiogenese-Regulation durch Wachstumsfaktoren

Thu, 19 Jan 2012 00:00:00 +0000

Alle Zellen unseres Körpers benötigen Sauerstoff und sie werden über das Blut damit versorgt. Deshalb ist das Gefässsystem das erste funktionsfähige Organ im wachsenden Embryo. Bevor das Herz seine Pumpfunktion aufnimmt, deckt der Embryo seinen Sauerstoffbedarf einzig durch Diffusion. Dies ist ihm allerdings nur bis zu einer Grösse von einigen Millimetern möglich.Tumoren haben das gleiche Problem, wenn sie eine ähnliche Grösse erreichen. Beide - der wachsende Embryo und die Krebsgeschwulst - können ihr Wachstum nur fortsetzen, wenn es ihnen gelingt, ein Gefässsystem zu bilden, das ihnen den benötigten Sauerstoff und die Nährstoffe bereitstellt.Das Krebswachstum ist also abhängig vom Wachstum und von der Neubildung von Blutgefässen. Andererseits gibt es aber auch Krankheiten, die von unzureichendem Blutgefäss-Wachstum charakterisiert werden. Bei der koronaren Herzkrankheit z. B. können die Blutgefässe dem Herzmuskel nicht genügend Sauerstoff liefern.Neben dem Herz-Kreislaufsystem gibt es noch ein anderes Gefässsystem: das Lymphgefässsystem. Es leitet überschüssige Gewebsflüssigkeit zuruck ins Blut und spielt eine wichtige Rolle in der körpereigenen Abwehr gegen Bakterien und Viren. Ähnlich dem Blutgefässsystem spielt das Lymphsystem eine wichtige Rolle in vielen Krankheiten. Lymphödem-Patienten z. B. leiden unter Schwellungen der Gliedmassen, weil entweder nicht aysreichend Lymphgefässe vorhanden sind oder die vorhandenen in ihrer Funktion eingeschränkt sind. Auch die Verbreitung von Krebs (Metastasierung) hängt eng mit dem Lymphsystem zusammen, weil Krebszellen die Lymphgefässe als Transportwege innerhalb des Körpers benutzten.

My favorite podcasts

Thu, 05 Jan 2012 00:00:00 +0000

My favorite podcasts. I enjoy almost every single episode:

Computer-related stuffSecurity news and education about security and how computers and the internet work: Security Now!
Everything Linux: The Linux Action Show!
Every week one Open Source project is the topic: FLOSS Weekly

Science and Skepticism

How I became an "Adjunct Professor" ("dosentti") at the University of Helsinki

Wed, 04 Jan 2012 00:00:00 +0000

Compared to getting my PhD degree, the “dosentti” thingy was easy. I started in the beginning of 2011 and received the title the same year in December. I don’t know whether the process differs between different Finnish universities and some of the formalities might be specific to the University of Helsinki , but nevertheless, below I list the steps I took to get the title. There are also instructions available from here .

Introduction into lymphatic research

Thu, 20 Oct 2011 00:00:00 +0000

Lecture 1: The cardiovascular system vs. the lymphatic system: Anatomy and Physiology
Lecture 2: Molecular make-up of the lymphatic system
Lecture 3: The lymphatic system in disease
Lecture 4: Model organisms in lymphatic research , .tex file
Lecture 5: Fundamental techniques in lymphatic research
Lecture 6: Current questions in lymphatic research

Structure/function relationships within the VEGF/VEGF receptor families

Wed, 03 Aug 2011 00:00:00 +0000

The 8th International Duodecim symposium on “Endothelial growth factors in cancer and cardiovascular diseases” took place in the Vanajanlinna mansion from 9th to 11 June, 2011. It is just a bit more than 100 km from Helsinki and I did the trip by bicycle. This is the abstract for the poster I made for the meeting:

Academic Portfolio 2011

Tue, 08 Mar 2011 00:00:00 +0000

This is my Academic Portfolio in PDF format. Since it is public, I had to black out confidential information concerning confidential ongoing collaborations, my research plans and the contract research I am doing for Vegenics Ltd./Circadian Technologies . I assembled this for my application for the title of Adjunct Professor .

Äkta Explorer FPLC core facility

Wed, 26 Jan 2011 00:00:00 +0000

Nowadays I spend much of my time at work on the purification of proteins which regulate angiogenesis and lymphangiogenesis . Therefore, I am taking care of the necessary machinery that the Molecular Cancer Biology Research Program owns: the fast protein liquid chromatography (FPLC) machine. Prof. Jorma Keski-Oja acquired about 15 years ago one of the first (and in 2010 discontinued) Äkta Explorer machines from Swedish producer Pharmacia (who merged in 1997 with Amersham to become Amersham Pharmacia Biotech, who was in turn bought by GE Healthcare in 2004). In the year 2000 the equipment moved from the Haartman Institute into the Biomedicum Helsinki . While I have maintained web pages for this piece of research infrastructure for the last five years (including online reservation and data backup), they were only available from inside the Helsinki University network.Now, I managed to have web pages about the Äkta Explorer FPLC core facility added to the web site of the Medical Faculty . At the moment, we are adding the WAVE cell culture system to our facility to be able to produce large amounts of cells/cell culture supernatant (up to 25 liters of bacterial, insect or mammalian cell culture) for protein production.

HBGS course

Mon, 10 May 2010 00:00:00 +0000

All documents related the the HBGS course Tags in protein expression, detection and purification. Most documents are available in both PDF and OpenOffice format. Feel free to repurpose the documents. They are licensed under the Creative Commons Attribution-Noncommercial-Share Alike 1.0 License .

VEGF-C/VEGFR-2 complex structure took 13 years to solve

Wed, 03 Feb 2010 00:00:00 +0000

Finally our paper was accepted for publication in PNAS (downloadable also from here ). I started the project by making the first construct 13 years ago, but it went nowhere for the first 9 years due to insufficient concentration of efforts and a few unlucky choices in the experimental design. I opted for bacterial protein first, but although the refolding worked, it was very inefficient (Ala mutation and a smart trimming of N- and C-terminus. More…

Recombinant proteins

Fri, 25 Sep 2009 00:00:00 +0000

A dynamically updated list of proteins used to be here, but I shut down the communication to our lab’s database server due to security concerns.

Chicken embryo

Tue, 18 Aug 2009 00:00:00 +0000

Through a hole in the egg shell you can visually follow the complete chicken development. Click the video link below to see the heart beat!

The Molecular/Cancer Biology Lab 2008

Sat, 11 Jul 2009 00:00:00 +0000

Giant soap bubbles

Thu, 11 Jun 2009 00:00:00 +0000

There are hundreds of web pages describing recipes for giant soap bubbles. Some of the more interesting ones are The Bubblesphere , Bubble Town , Soap Bubbler , Riesenseifenblasen durch polymere Additive (in German) , Nanotech Kids . Why another web posting about soap bubbles? Because almost all of them use ingredients that are not available where I live (i.e. Finland). I got a recipe from a soap bubbler who performed at a kindergarden event in my neighbourhood and here is my modified version (including brand names which were absent from the original recipe):

The Molecular/Cancer Biology Lab 2008

Mon, 11 May 2009 00:00:00 +0000

The Molecular/Cancer Biology Lab 10 years ago

Tue, 05 May 2009 00:00:00 +0000

I cleaned my computer files and I found this historical photo collage…

And here is another historical document. It’s an article about the Alitalo laboratory in the “Yliopisto” magazine from September 2002:

Storage and Handling of Proteins

Wed, 22 Oct 2008 00:00:00 +0000

Judah Folkman dies at age 74

Fri, 15 Feb 2008 00:00:00 +0000

Judah Folkman died of a heart attack at Denver airport on January 14. He was in transit to a conference in Vancouver. His importance for the field of vascular biology cannot be overstated; the web is full of his obituaries ( The Lancet , Nature , Cell just to link a few). I personally met him first when he acted as an opponent in Arja Kaipainen’s PhD thesis defense in spring 1997. Dear Nobel prize committee: You were again waiting too long.

Installing Staden 2003b on Suse 9

Thu, 24 May 2007 00:00:00 +0000

Download the sources .
cd into /usr/local and become su.
tar -xvzf /home/jeltsch/Documents/staden_linux_2003.0b1.tar.gz (jeltsch is my usename, thus has to be replaced for other users!!!!)

EMBOSS and GCK for the assembly and documentation of construct sequences

Thu, 05 Apr 2007 00:00:00 +0000

I am trying to use EMBOSS for the assembly of vector sequences. Long time ago, I used the CGC seqed program for this purpose and at the moment I use the Gene Construction Kit . EMBOSS doesn’t have a straight equivalent for seqed and one has to use a bunch of other tools to replace its functionality. Look at this comparison between CGC and EMBOSS .

Software development projects for Molecular Biology

Thu, 05 Apr 2007 00:00:00 +0000

GCK2.5-related

GCK2.5 debug under wine** There are still some bugs that make using gck2.5 sometimes a pain under wine. Especially the inability to annotate regions, to search for a sequence and to open a new file.
GCK2.5 export** GCK2.5 is not able to export in embl format with the regions converted into features. It can, however, export comments to text file and plain sequence to a text file. It should be trivial to write a perl script that takes these two files and converts them into one embl file, EMBOSS cirdna/lindna or pDRAW32 file.
GCK2.5/wine desktop integration** When clicking on files that are associated with Windows programs (using wine), the Linux file manager (e.g. Konqueror) passes the file as an argument to the associated Windows application and the file is opened under wine. However GCK2.5 refuses to accept the file as an argument. When clicking on a .gcc file, GCK2.5 starts up, but opens an empty window and I have to open the .gcc file from within GCK2.5. Unnecessary clicking, especially when I need to navigate over several folder hierachies. When GCK2.5 is running natively under Windows, is it possible to start GCK2.5 with a construct file as a command line argument? I should check that out.

pDRAW32-related

What nfs and smb shares are available on a server (showmount, smbclient)?

Thu, 05 Apr 2007 00:00:00 +0000

The command to figure out what shares are available e.g. on the computer 192.168.0.2 type:For nfs: /usr/sbin/showmount -e 192.168.0.2For samba: smbclient -L 192.168.0.2

Development - Carnegie Stage Comparison